ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl11a04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|Z93397.1|CEZC482 Caenorhabditis elegans Cosmid ZC482, comple... 40 3.5
2emb|AL139241.11| Human DNA sequence from clone RP11-34A14 on chr... 40 3.5
3emb|AL049176.3|HS141H5 Human DNA sequence from clone RP6-141H5 o... 40 3.5
4emb|AL035461.11|HS967N21 Human DNA sequence from clone RP5-967N2... 40 3.5
5gb|AC011355.6| Homo sapiens chromosome 5 clone CTC-354H18, compl... 40 3.5
6gb|AC096949.2| Homo sapiens chromosome 1 clone RP4-581O6, comple... 40 3.5
7gb|AC126425.2| Lemur catta, clone -162D1, complete sequence 40 3.5
8gb|AC131599.2| Lemur catta, clone -206F2, complete sequence 40 3.5
9gb|AC093901.2| Homo sapiens BAC clone RP11-730J4 from 2, complet... 40 3.5
10gb|AC102491.19| Mus musculus chromosome 1, clone RP24-529L13, co... 40 3.5
11dbj|AB001684.1| Chlorella vulgaris C-27 chloroplast DNA, complet... 40 3.5
12dbj|AP002987.3| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 3.5
13dbj|AP002456.3| Homo sapiens genomic DNA, chromosome 11q clone:R... 40 3.5
14dbj|AP001929.5| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 3.5

>emb|Z93397.1|CEZC482 Caenorhabditis elegans Cosmid ZC482, complete sequence
          Length = 36302

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 181   tttccttttctctttttctg 200
             ||||||||||||||||||||
Sbjct: 35437 tttccttttctctttttctg 35418



to top

>emb|AL139241.11| Human DNA sequence from clone RP11-34A14 on chromosome 10 Contains the
             3' end of gene FLJ37160, the LOXL4 gene for lysyl
             oxidase-like 4, a novel gene and a CpG island, complete
             sequence
          Length = 188192

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 181   tttccttttctctttttctg 200
             ||||||||||||||||||||
Sbjct: 19096 tttccttttctctttttctg 19077



to top

>emb|AL049176.3|HS141H5 Human DNA sequence from clone RP6-141H5 on chromosome Xq22.1-23
             Contains the 3' end of the gene for a likely ortholog of
             mouse neuralin 1 (NRLN1), complete sequence
          Length = 121600

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 167   tgtcttgccacaggtttcct 186
             ||||||||||||||||||||
Sbjct: 42276 tgtcttgccacaggtttcct 42257



to top

>emb|AL035461.11|HS967N21 Human DNA sequence from clone RP5-967N21 on chromosome 20p12.3-13
              Contains the CHGB gene for chromogranin B (secretogranin
              1), a novel pseudogene, the gene for CGI-09 protein
              (CGI-09), the C20orf154 gene for a novel MCM2/3/5 family
              member, a pseudogene similar to part of cytochrome c
              oxidase I, the C20orf155 gene for a novel CDP-alcohol
              phosphatidyltransferase family member, the 3' end of a
              novel gene and four CpG islands, complete sequence
          Length = 139352

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 178    aggtttccttttctcttttt 197
              ||||||||||||||||||||
Sbjct: 102619 aggtttccttttctcttttt 102600



to top

>gb|AC011355.6| Homo sapiens chromosome 5 clone CTC-354H18, complete sequence
          Length = 114276

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 180   gtttccttttctctttttct 199
             ||||||||||||||||||||
Sbjct: 52890 gtttccttttctctttttct 52871



to top

>gb|AC096949.2| Homo sapiens chromosome 1 clone RP4-581O6, complete sequence
          Length = 106449

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 181   tttccttttctctttttctg 200
             ||||||||||||||||||||
Sbjct: 94582 tttccttttctctttttctg 94563



to top

>gb|AC126425.2| Lemur catta, clone -162D1, complete sequence
          Length = 154718

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 181   tttccttttctctttttctg 200
             ||||||||||||||||||||
Sbjct: 27273 tttccttttctctttttctg 27254



to top

>gb|AC131599.2| Lemur catta, clone -206F2, complete sequence
          Length = 155606

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 181   tttccttttctctttttctg 200
             ||||||||||||||||||||
Sbjct: 90464 tttccttttctctttttctg 90483



to top

>gb|AC093901.2| Homo sapiens BAC clone RP11-730J4 from 2, complete sequence
          Length = 161153

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 182    ttccttttctctttttctgc 201
              ||||||||||||||||||||
Sbjct: 144694 ttccttttctctttttctgc 144675



to top

>gb|AC102491.19| Mus musculus chromosome 1, clone RP24-529L13, complete sequence
          Length = 190728

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 180   gtttccttttctctttttct 199
             ||||||||||||||||||||
Sbjct: 22737 gtttccttttctctttttct 22718



to top

>dbj|AB001684.1| Chlorella vulgaris C-27 chloroplast DNA, complete sequence
          Length = 150613

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 187   tttctctttttctgccgatt 206
             ||||||||||||||||||||
Sbjct: 74780 tttctctttttctgccgatt 74761



to top

>dbj|AP002987.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-428C14, complete
             sequence
          Length = 166893

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 177   caggtttccttttctctttt 196
             ||||||||||||||||||||
Sbjct: 74125 caggtttccttttctctttt 74144



to top

>dbj|AP002456.3| Homo sapiens genomic DNA, chromosome 11q clone:RP11-956A8, complete
             sequence
          Length = 114109

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 234   tttagagctaagcaaactga 253
             ||||||||||||||||||||
Sbjct: 94632 tttagagctaagcaaactga 94651



to top

>dbj|AP001929.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-640N11, complete
             sequence
          Length = 161547

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 234   tttagagctaagcaaactga 253
             ||||||||||||||||||||
Sbjct: 31460 tttagagctaagcaaactga 31479


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,210,095
Number of Sequences: 3902068
Number of extensions: 2210095
Number of successful extensions: 57691
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 57670
Number of HSP's gapped (non-prelim): 21
length of query: 270
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 248
effective length of database: 17,147,199,772
effective search space: 4252505543456
effective search space used: 4252505543456
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top