Clone Name | rbastl10h05 |
---|---|
Clone Library Name | barley_pub |
No. | Definition | Score (bits) |
E Value |
1 | ref|XM_958751.1| Neurospora crassa OR74A hypothetical protein (N... | 40 | 0.92 | 2 | ref|XM_331949.1| Neurospora crassa OR74A hypothetical protein (N... | 40 | 0.92 | 3 | emb|AL392108.4| Human DNA sequence from clone RP11-551P18 on chr... | 38 | 3.6 | 4 | gb|AC130831.4| Mus musculus BAC clone RP24-80P9 from 14, complet... | 38 | 3.6 |
---|
>ref|XM_958751.1| Neurospora crassa OR74A hypothetical protein (NCU02751.1) partial mRNA Length = 3477 Score = 40.1 bits (20), Expect = 0.92 Identities = 20/20 (100%) Strand = Plus / Minus Query: 12 ttttcgtttgacttatctct 31 |||||||||||||||||||| Sbjct: 2639 ttttcgtttgacttatctct 2620
>ref|XM_331949.1| Neurospora crassa OR74A hypothetical protein (NCU02751.1) partial mRNA Length = 3477 Score = 40.1 bits (20), Expect = 0.92 Identities = 20/20 (100%) Strand = Plus / Minus Query: 12 ttttcgtttgacttatctct 31 |||||||||||||||||||| Sbjct: 2639 ttttcgtttgacttatctct 2620
>emb|AL392108.4| Human DNA sequence from clone RP11-551P18 on chromosome 10 Contains the 5' UTR of a variant of a novel gene, complete sequence Length = 145179 Score = 38.2 bits (19), Expect = 3.6 Identities = 19/19 (100%) Strand = Plus / Plus Query: 32 aaactgcgaaagaatacat 50 ||||||||||||||||||| Sbjct: 86753 aaactgcgaaagaatacat 86771
>gb|AC130831.4| Mus musculus BAC clone RP24-80P9 from 14, complete sequence Length = 233804 Score = 38.2 bits (19), Expect = 3.6 Identities = 22/23 (95%) Strand = Plus / Plus Query: 29 tctaaactgcgaaagaatacatt 51 ||||||||| ||||||||||||| Sbjct: 203212 tctaaactgtgaaagaatacatt 203234 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 516,470 Number of Sequences: 3902068 Number of extensions: 516470 Number of successful extensions: 33839 Number of sequences better than 10.0: 4 Number of HSP's better than 10.0 without gapping: 4 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 33834 Number of HSP's gapped (non-prelim): 5 length of query: 86 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 65 effective length of database: 17,151,101,840 effective search space: 1114821619600 effective search space used: 1114821619600 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)