>gb|BC083436.1| Danio rerio zgc:103601, mRNA (cDNA clone MGC:103601 IMAGE:7248727),
            complete cds
          Length = 1208

 Score = 44.1 bits (22), Expect = 0.21
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 210  atatgcagcacatttcacaata 231
            ||||||||||||||||||||||
Sbjct: 1146 atatgcagcacatttcacaata 1167

>ref|NM_001005974.1| Danio rerio zgc:103601 (zgc:103601), mRNA
          Length = 1208

 Score = 44.1 bits (22), Expect = 0.21
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 210  atatgcagcacatttcacaata 231
            ||||||||||||||||||||||
Sbjct: 1146 atatgcagcacatttcacaata 1167

>gb|AC102258.12| Mus musculus chromosome 1, clone RP24-197K20, complete sequence
          Length = 166838

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 30     agcaatggtgccaacaagac 49
              ||||||||||||||||||||
Sbjct: 137870 agcaatggtgccaacaagac 137851

>gb|AC157923.4| Mus musculus chromosome 1, clone RP23-178F20, complete sequence
          Length = 204025

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 30     agcaatggtgccaacaagac 49
              ||||||||||||||||||||
Sbjct: 133001 agcaatggtgccaacaagac 132982

>dbj|AP006716.1| Staphylococcus haemolyticus JCSC1435 DNA, complete genome
          Length = 2685015

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 49      cacagatgctgcaactacaa 68
               ||||||||||||||||||||
Sbjct: 1175682 cacagatgctgcaactacaa 1175701

>emb|BX572098.1| Prochlorococcus marinus MIT9313 complete genome; segment 4/7
          Length = 346683

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 94    aatgcaacagaaacccaacc 113
             ||||||||||||||||||||
Sbjct: 42571 aatgcaacagaaacccaacc 42590


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,014,788
Number of Sequences: 3902068
Number of extensions: 2014788
Number of successful extensions: 32610
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 32598
Number of HSP's gapped (non-prelim): 12
length of query: 255
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 233
effective length of database: 17,147,199,772
effective search space: 3995297546876
effective search space used: 3995297546876
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)