Clone Name | rbastl09f05 |
---|---|
Clone Library Name | barley_pub |
>gb|AC009027.10| Homo sapiens chromosome 16 clone RP11-123C5, complete sequence Length = 178256 Score = 46.1 bits (23), Expect = 0.068 Identities = 26/27 (96%) Strand = Plus / Plus Query: 103 cccagcaaccaaatgtggtttcgacac 129 ||||||||||||||||| ||||||||| Sbjct: 13768 cccagcaaccaaatgtgttttcgacac 13794
>gb|AC009131.6|AC009131 Homo sapiens chromosome 16 clone RP11-502K10, complete sequence Length = 180835 Score = 46.1 bits (23), Expect = 0.068 Identities = 26/27 (96%) Strand = Plus / Plus Query: 103 cccagcaaccaaatgtggtttcgacac 129 ||||||||||||||||| ||||||||| Sbjct: 98308 cccagcaaccaaatgtgttttcgacac 98334
>emb|AL837505.21| Mouse DNA sequence from clone RP23-181N6 on chromosome 4, complete sequence Length = 186045 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 203 aataaagacattacatggaaa 223 ||||||||||||||||||||| Sbjct: 110194 aataaagacattacatggaaa 110214
>gb|AC138395.8| Mus musculus chromosome 3, clone RP24-128I24, complete sequence Length = 171020 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 tattctgtagatagatagat 40 |||||||||||||||||||| Sbjct: 138337 tattctgtagatagatagat 138356
>gb|AC092120.4| Homo sapiens chromosome 16 clone RP1-168P16, complete sequence Length = 113368 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 291 cagcaggctggaaatagtct 310 |||||||||||||||||||| Sbjct: 2058 cagcaggctggaaatagtct 2077
>emb|AL109842.7|HSDJ726A1 Human DNA sequence from clone RP4-726A1 on chromosome 6q22.2-23.1 Contains part of the TCBA1 gene for T-cell lymphoma breakpoint associated target 1, complete sequence Length = 120998 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 297 gctggaaatagtcttgcaat 316 |||||||||||||||||||| Sbjct: 64505 gctggaaatagtcttgcaat 64486
>gb|AC159968.3| Mus musculus chromosome 3, clone RP23-256J12, complete sequence Length = 153684 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 21 tattctgtagatagatagat 40 |||||||||||||||||||| Sbjct: 78720 tattctgtagatagatagat 78739
>dbj|BA000032.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromosome 2, complete sequence Length = 1877212 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 144 tatcgcagcagcagataagc 163 |||||||||||||||||||| Sbjct: 1191289 tatcgcagcagcagataagc 1191270
>gb|AC005693.3| Arabidopsis thaliana chromosome 2 clone T25N22 map mi310, complete sequence Length = 80891 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 49 tactcttacacattagaaat 68 |||||||||||||||||||| Sbjct: 13207 tactcttacacattagaaat 13226
>gb|AC103890.1| 16q24.3 clone, complete sequence Length = 129848 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 291 cagcaggctggaaatagtct 310 |||||||||||||||||||| Sbjct: 8895 cagcaggctggaaatagtct 8876
>gb|AC137932.1| Homo sapiens chromosome 16 clone GS2-740I5, complete sequence Length = 129785 Score = 40.1 bits (20), Expect = 4.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 291 cagcaggctggaaatagtct 310 |||||||||||||||||||| Sbjct: 120891 cagcaggctggaaatagtct 120910
>gb|AC013264.4| Homo sapiens BAC clone RP11-184N4 from 2, complete sequence Length = 149445 Score = 40.1 bits (20), Expect = 4.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 50 actcttacacattagaaatacaaa 73 ||||||| |||||||||||||||| Sbjct: 118148 actcttaaacattagaaatacaaa 118125 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,029,976 Number of Sequences: 3902068 Number of extensions: 4029976 Number of successful extensions: 95315 Number of sequences better than 10.0: 12 Number of HSP's better than 10.0 without gapping: 12 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 95291 Number of HSP's gapped (non-prelim): 24 length of query: 319 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 297 effective length of database: 17,147,199,772 effective search space: 5092718332284 effective search space used: 5092718332284 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)