ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl09f05
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC009027.10| Homo sapiens chromosome 16 clone RP11-123C5, com... 46 0.068
2gb|AC009131.6|AC009131 Homo sapiens chromosome 16 clone RP11-502... 46 0.068
3emb|AL837505.21| Mouse DNA sequence from clone RP23-181N6 on chr... 42 1.1
4gb|AC138395.8| Mus musculus chromosome 3, clone RP24-128I24, com... 40 4.2
5gb|AC092120.4| Homo sapiens chromosome 16 clone RP1-168P16, comp... 40 4.2
6emb|AL109842.7|HSDJ726A1 Human DNA sequence from clone RP4-726A1... 40 4.2
7gb|AC159968.3| Mus musculus chromosome 3, clone RP23-256J12, com... 40 4.2
8dbj|BA000032.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromo... 40 4.2
9gb|AC005693.3| Arabidopsis thaliana chromosome 2 clone T25N22 ma... 40 4.2
10gb|AC103890.1| 16q24.3 clone, complete sequence 40 4.2
11gb|AC137932.1| Homo sapiens chromosome 16 clone GS2-740I5, compl... 40 4.2
12gb|AC013264.4| Homo sapiens BAC clone RP11-184N4 from 2, complet... 40 4.2

>gb|AC009027.10| Homo sapiens chromosome 16 clone RP11-123C5, complete sequence
          Length = 178256

 Score = 46.1 bits (23), Expect = 0.068
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 103   cccagcaaccaaatgtggtttcgacac 129
             ||||||||||||||||| |||||||||
Sbjct: 13768 cccagcaaccaaatgtgttttcgacac 13794



to top

>gb|AC009131.6|AC009131 Homo sapiens chromosome 16 clone RP11-502K10, complete sequence
          Length = 180835

 Score = 46.1 bits (23), Expect = 0.068
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 103   cccagcaaccaaatgtggtttcgacac 129
             ||||||||||||||||| |||||||||
Sbjct: 98308 cccagcaaccaaatgtgttttcgacac 98334



to top

>emb|AL837505.21| Mouse DNA sequence from clone RP23-181N6 on chromosome 4, complete
              sequence
          Length = 186045

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 203    aataaagacattacatggaaa 223
              |||||||||||||||||||||
Sbjct: 110194 aataaagacattacatggaaa 110214



to top

>gb|AC138395.8| Mus musculus chromosome 3, clone RP24-128I24, complete sequence
          Length = 171020

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 21     tattctgtagatagatagat 40
              ||||||||||||||||||||
Sbjct: 138337 tattctgtagatagatagat 138356



to top

>gb|AC092120.4| Homo sapiens chromosome 16 clone RP1-168P16, complete sequence
          Length = 113368

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 291  cagcaggctggaaatagtct 310
            ||||||||||||||||||||
Sbjct: 2058 cagcaggctggaaatagtct 2077



to top

>emb|AL109842.7|HSDJ726A1 Human DNA sequence from clone RP4-726A1 on chromosome 6q22.2-23.1
             Contains part of the TCBA1 gene for T-cell lymphoma
             breakpoint associated target 1, complete sequence
          Length = 120998

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 297   gctggaaatagtcttgcaat 316
             ||||||||||||||||||||
Sbjct: 64505 gctggaaatagtcttgcaat 64486



to top

>gb|AC159968.3| Mus musculus chromosome 3, clone RP23-256J12, complete sequence
          Length = 153684

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 21    tattctgtagatagatagat 40
             ||||||||||||||||||||
Sbjct: 78720 tattctgtagatagatagat 78739



to top

>dbj|BA000032.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromosome 2, complete sequence
          Length = 1877212

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 144     tatcgcagcagcagataagc 163
               ||||||||||||||||||||
Sbjct: 1191289 tatcgcagcagcagataagc 1191270



to top

>gb|AC005693.3| Arabidopsis thaliana chromosome 2 clone T25N22 map mi310, complete
             sequence
          Length = 80891

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 49    tactcttacacattagaaat 68
             ||||||||||||||||||||
Sbjct: 13207 tactcttacacattagaaat 13226



to top

>gb|AC103890.1| 16q24.3 clone, complete sequence
          Length = 129848

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 291  cagcaggctggaaatagtct 310
            ||||||||||||||||||||
Sbjct: 8895 cagcaggctggaaatagtct 8876



to top

>gb|AC137932.1| Homo sapiens chromosome 16 clone GS2-740I5, complete sequence
          Length = 129785

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 291    cagcaggctggaaatagtct 310
              ||||||||||||||||||||
Sbjct: 120891 cagcaggctggaaatagtct 120910



to top

>gb|AC013264.4| Homo sapiens BAC clone RP11-184N4 from 2, complete sequence
          Length = 149445

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 50     actcttacacattagaaatacaaa 73
              ||||||| ||||||||||||||||
Sbjct: 118148 actcttaaacattagaaatacaaa 118125


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,029,976
Number of Sequences: 3902068
Number of extensions: 4029976
Number of successful extensions: 95315
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 95291
Number of HSP's gapped (non-prelim): 24
length of query: 319
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 297
effective length of database: 17,147,199,772
effective search space: 5092718332284
effective search space used: 5092718332284
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top