ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl09c12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY532593.1| Triticum aestivum minichromosomal maintenance fac... 218 9e-54
2gb|AC102105.8| Mus musculus chromosome 12, clone RP23-89G24, com... 42 1.2
3gb|AC142351.1| Pan troglodytes BAC clone RP43-21J15 from 7, comp... 40 4.6
4emb|AL365203.19| Human DNA sequence from clone RP11-479G22 on ch... 40 4.6
5emb|BX323041.9| Zebrafish DNA sequence from clone RP71-82P7 in l... 40 4.6
6gb|AC103949.6| Homo sapiens chromosome 18, clone RP11-671P2, com... 40 4.6
7gb|AC118563.1| Homo sapiens chromosome 5 clone CTD-2243F8, compl... 40 4.6
8gb|AC026839.7| Homo sapiens chromosome 5, clone RP11-186B13, com... 40 4.6
9gb|AC008705.6| Homo sapiens chromosome 5 clone CTB-77H17, comple... 40 4.6
10gb|AC011369.4| Homo sapiens chromosome 5 clone CTB-105N12, compl... 40 4.6
11gb|AC108022.3| Homo sapiens BAC clone RP11-9D8 from 4, complete ... 40 4.6
12gb|AC010346.6|AC010346 Homo sapiens chromosome 5 clone CITB-H1_2... 40 4.6
13gb|AC090059.9| Homo sapiens 12 BAC RP11-604C20 (Roswell Park Can... 40 4.6
14dbj|AB056778.1| Macaca fascicularis brain cDNA clone:QccE-21094,... 40 4.6

>gb|AY532593.1| Triticum aestivum minichromosomal maintenance factor (MCM2) gene,
            exons 1 through 18 and complete sequence
          Length = 8809

 Score =  218 bits (110), Expect = 9e-54
 Identities = 162/178 (91%), Gaps = 1/178 (0%)
 Strand = Plus / Minus

                                                                        
Query: 118  gatggcgtcaggtgcatataacactgaattatgacatcaagaaggtacaaacatctctaa 177
            ||||||||||| | |||| ||||||||||||||| |||||||||||||| ||||||| ||
Sbjct: 8259 gatggcgtcagttccata-aacactgaattatgatatcaagaaggtacagacatctcgaa 8201

                                                                        
Query: 178  atgccactggaggcacaagggtttcagatagcaaacagtacaccaacaccagaattcccg 237
            ||||| ||| |||||||||||||||||||||||||||||||||||| | ||||| || | 
Sbjct: 8200 atgccgctgtaggcacaagggtttcagatagcaaacagtacaccaatatcagaactctca 8141

                                                                      
Query: 238  taaaacagacacgagcagtcattttgccaacttacactacaagtggacatttctagct 295
             ||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 8140 caaaacagacacaagcagtcattttgccgacttacactacaagtggacatttctagct 8083



 Score = 46.1 bits (23), Expect = 0.074
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 305  gctcttgaacaaagaggtagctg 327
            |||||||||||||||||||||||
Sbjct: 8085 gctcttgaacaaagaggtagctg 8063



to top

>gb|AC102105.8| Mus musculus chromosome 12, clone RP23-89G24, complete sequence
          Length = 188853

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 315    aaagaggtagctgaggttgat 335
              |||||||||||||||||||||
Sbjct: 103298 aaagaggtagctgaggttgat 103318



to top

>gb|AC142351.1| Pan troglodytes BAC clone RP43-21J15 from 7, complete sequence
          Length = 159635

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 166    aaacatctctaaatgccact 185
              ||||||||||||||||||||
Sbjct: 104407 aaacatctctaaatgccact 104388



to top

>emb|AL365203.19| Human DNA sequence from clone RP11-479G22 on chromosome 10 Contains the
             3' end of a novel gene (FLJ13031) (FLJ40349), the ITGB1
             gene for integrin beta 1 (fibronectin receptor beta
             polypeptide antigen CD29 includes MDF2 MSK12), an
             adenylate kinase 3 like 1 (AK3L1) pseudogene, a novel
             gene, the 5' end of a novel gene, a NADH dehydrogenase
             subunit 4L (ND4L) pseudogene, a pseudogene similar to part
             of integrin beta 2 (antigen CD18 (p95) lymphocyte
             function-associated antigen 1; macrophage antigen 1
             (mac-1) beta subunit) (ITGB2) and a CpG island, complete
             sequence
          Length = 197973

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 186   ggaggcacaagggtttcaga 205
             ||||||||||||||||||||
Sbjct: 92711 ggaggcacaagggtttcaga 92692



to top

>emb|BX323041.9| Zebrafish DNA sequence from clone RP71-82P7 in linkage group 7,
             complete sequence
          Length = 146935

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 1     gtaataaggaatttaattaa 20
             ||||||||||||||||||||
Sbjct: 99763 gtaataaggaatttaattaa 99782



to top

>gb|AC103949.6| Homo sapiens chromosome 18, clone RP11-671P2, complete sequence
          Length = 177301

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 166    aaacatctctaaatgccact 185
              ||||||||||||||||||||
Sbjct: 117250 aaacatctctaaatgccact 117231



to top

>gb|AC118563.1| Homo sapiens chromosome 5 clone CTD-2243F8, complete sequence
          Length = 105027

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 13     ttaattaaagtcattcatat 32
              ||||||||||||||||||||
Sbjct: 100831 ttaattaaagtcattcatat 100850



to top

>gb|AC026839.7| Homo sapiens chromosome 5, clone RP11-186B13, complete sequence
          Length = 156721

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 166   aaacatctctaaatgccact 185
             ||||||||||||||||||||
Sbjct: 25257 aaacatctctaaatgccact 25276



to top

>gb|AC008705.6| Homo sapiens chromosome 5 clone CTB-77H17, complete sequence
          Length = 159709

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 32    ttctgtttaaccaacagata 51
             ||||||||||||||||||||
Sbjct: 22346 ttctgtttaaccaacagata 22365



to top

>gb|AC011369.4| Homo sapiens chromosome 5 clone CTB-105N12, complete sequence
          Length = 141529

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 32     ttctgtttaaccaacagata 51
              ||||||||||||||||||||
Sbjct: 120401 ttctgtttaaccaacagata 120420



to top

>gb|AC108022.3| Homo sapiens BAC clone RP11-9D8 from 4, complete sequence
          Length = 162609

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 125   tcaggtgcatataacactga 144
             ||||||||||||||||||||
Sbjct: 18559 tcaggtgcatataacactga 18578



to top

>gb|AC010346.6|AC010346 Homo sapiens chromosome 5 clone CITB-H1_2018B2, complete sequence
          Length = 109626

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 13    ttaattaaagtcattcatat 32
             ||||||||||||||||||||
Sbjct: 56734 ttaattaaagtcattcatat 56753



to top

>gb|AC090059.9| Homo sapiens 12 BAC RP11-604C20 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 130125

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 68    ataatgattgtcccaaaagt 87
             ||||||||||||||||||||
Sbjct: 45587 ataatgattgtcccaaaagt 45606



to top

>dbj|AB056778.1| Macaca fascicularis brain cDNA clone:QccE-21094, full insert
           sequence
          Length = 1550

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 311 gaacaaagaggtagctgagg 330
           ||||||||||||||||||||
Sbjct: 727 gaacaaagaggtagctgagg 746


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,973,573
Number of Sequences: 3902068
Number of extensions: 2973573
Number of successful extensions: 58173
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 58150
Number of HSP's gapped (non-prelim): 23
length of query: 344
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 322
effective length of database: 17,147,199,772
effective search space: 5521398326584
effective search space used: 5521398326584
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top