>gb|AC112205.2| Homo sapiens chromosome 5 clone RP11-80G7, complete sequence
          Length = 137376

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 252   tttgttctctgtatgcttcctt 273
             ||||||||||||||||||||||
Sbjct: 98239 tttgttctctgtatgcttcctt 98260

>gb|AE002147.1| Ureaplasma parvum serovar 3 str. ATCC 700970 section 48 of 59 of the
             complete genome
          Length = 27093

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 72    aattacattgcatgatgaaaaagat 96
             ||||||||| |||||||||||||||
Sbjct: 21241 aattacattccatgatgaaaaagat 21217

>ref|XM_500068.1| Yarrowia lipolytica CLIB122, YALI0A14707g predicted mRNA
          Length = 4935

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 17   agaaatgtactgcgttccaa 36
            ||||||||||||||||||||
Sbjct: 2799 agaaatgtactgcgttccaa 2780

>emb|BX897700.1| Bartonella quintana str. Toulouse, complete genome
          Length = 1581384

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 78     attgcatgatgaaaaagatc 97
              ||||||||||||||||||||
Sbjct: 237598 attgcatgatgaaaaagatc 237617

>gb|AC093811.3| Homo sapiens BAC clone RP11-355H11 from 4, complete sequence
          Length = 115335

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 79    ttgcatgatgaaaaagatca 98
             ||||||||||||||||||||
Sbjct: 85230 ttgcatgatgaaaaagatca 85211

>emb|BX548049.9| Zebrafish DNA sequence from clone DKEY-217J16 in linkage group 25,
             complete sequence
          Length = 175348

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 74    ttacattgcatgatgaaaaa 93
             ||||||||||||||||||||
Sbjct: 10660 ttacattgcatgatgaaaaa 10641

>gb|AC150259.4| Aedes aegypti, clone XX-10B1, complete sequence
          Length = 206579

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 38     tcaaaaaatctgtgcagcaa 57
              ||||||||||||||||||||
Sbjct: 187083 tcaaaaaatctgtgcagcaa 187102

>gb|AC099860.13| Mus musculus chromosome 1, clone RP23-5C23, complete sequence
          Length = 230538

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 137    tctgagctactcttgtctcc 156
              ||||||||||||||||||||
Sbjct: 210828 tctgagctactcttgtctcc 210847

>gb|AC162298.4| Mus musculus chromosome 1, clone RP24-285P15, complete sequence
          Length = 138146

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 137   tctgagctactcttgtctcc 156
             ||||||||||||||||||||
Sbjct: 41457 tctgagctactcttgtctcc 41476

>dbj|AK115834.1| Ciona intestinalis cDNA, clone:cilv028l15, full insert sequence
          Length = 872

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 264 atgcttccttgggatccaca 283
           ||||||||||||||||||||
Sbjct: 603 atgcttccttgggatccaca 622

>emb|BX000434.11| Zebrafish DNA sequence from clone CH211-2E18, complete sequence
          Length = 179109

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 64    cccacaataattacattgca 83
             ||||||||||||||||||||
Sbjct: 63234 cccacaataattacattgca 63253

>emb|AL844521.15| Zebrafish DNA sequence from clone DKEY-155O15 in linkage group 19,
              complete sequence
          Length = 213269

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 114    agattaggctatgatcctca 133
              ||||||||||||||||||||
Sbjct: 135251 agattaggctatgatcctca 135270

>emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB122 of Yarrowia lipolytica
          Length = 2303261

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 17      agaaatgtactgcgttccaa 36
               ||||||||||||||||||||
Sbjct: 1498826 agaaatgtactgcgttccaa 1498845

>emb|AL117191.6|CNS01DRG Human chromosome 14 DNA sequence BAC C-2303G14 of library CalTech-D
             from chromosome 14 of Homo sapiens (Human), complete
             sequence
          Length = 155307

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 109   aaattagattaggctatgat 128
             ||||||||||||||||||||
Sbjct: 88636 aaattagattaggctatgat 88617


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,143,912
Number of Sequences: 3902068
Number of extensions: 3143912
Number of successful extensions: 50605
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 50569
Number of HSP's gapped (non-prelim): 36
length of query: 334
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 312
effective length of database: 17,147,199,772
effective search space: 5349926328864
effective search space used: 5349926328864
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)