ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl06f12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC154436.2| Mus musculus BAC clone RP24-192B24 from chromosom... 46 0.081
2gb|AC113510.9| Mus musculus chromosome 5, clone RP23-378O9, comp... 44 0.32
3gb|AC157928.4| Mus musculus chromosome 5, clone RP24-119I9, comp... 44 0.32
4ref|XM_522356.1| PREDICTED: Pan troglodytes similar to PDZ domai... 42 1.3
5emb|AL158193.13| Human DNA sequence from clone RP11-400N12 on ch... 42 1.3
6gb|AC096863.5| Genomic sequence for Mus musculus, clone RP23-110... 42 1.3
7gb|AC008704.6| Homo sapiens chromosome 5 clone CTB-77C3, complet... 42 1.3
8gb|AY855220.1| Tympanuchus cupido haplotype 9 beta-actin gene, i... 42 1.3
9emb|AL391834.8| Human DNA sequence from clone RP11-513M16 on chr... 42 1.3
10ref|NM_124945.3| Arabidopsis thaliana KCO1; calcium-activated po... 40 5.0
11gb|AC116739.13| Mus musculus chromosome 17, clone RP23-435B24, c... 40 5.0
12gb|AC158932.5| Mus musculus chromosome 3, clone RP24-338G13, com... 40 5.0
13gb|AC162894.4| Mus musculus chromosome 3, clone RP23-326A24, com... 40 5.0
14ref|XM_922613.2| PREDICTED: Mus musculus similar to KIAA1946, tr... 40 5.0
15emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ... 40 5.0
16gb|AC124436.5| Mus musculus BAC clone RP24-252O24 from chromosom... 40 5.0
17emb|CR717329.2|CNS0GGFR Tetraodon nigroviridis full-length cDNA 40 5.0
18emb|AL512631.11| Human DNA sequence from clone RP11-138I18 on ch... 40 5.0
19emb|AL139279.7| Human DNA sequence from clone RP1-80C12 on chrom... 40 5.0
20gb|AC104518.5| Mus Musculus Strain 129S6/SvEvTac chromosome 17 B... 40 5.0
21emb|AL627097.6| Mouse DNA sequence from clone RP23-59B16 on chro... 40 5.0
22gb|AC022911.6| Homo sapiens chromosome 8, clone RP11-722A15, com... 40 5.0
23gb|AC079097.6| Homo sapiens chromosome 8, clone RP11-98P2, compl... 40 5.0
24dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c... 40 5.0
25gb|AE011797.1| Xanthomonas axonopodis pv. citri str. 306, secti... 40 5.0
26gb|AC104455.2| Homo sapiens chromosome 1 clone RP4-682E18, compl... 40 5.0
27gb|AC013746.10| Homo sapiens chromosome 8, clone RP11-131P18, co... 40 5.0
28emb|BX830855.1|CNS09ZF3 Arabidopsis thaliana Full-length cDNA Co... 40 5.0
29emb|BX832523.1|CNS09YN2 Arabidopsis thaliana Full-length cDNA Co... 40 5.0
30gb|AC117651.8| Mus musculus chromosome 3, clone RP23-287I17, com... 40 5.0
31dbj|AB005245.2| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 5.0
32gb|AC110562.17| Mus musculus chromosome 17, clone RP23-268M4, co... 40 5.0
33gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete... 40 5.0
34gb|AE016877.1| Bacillus cereus ATCC 14579, complete genome 40 5.0
35gb|AC147634.3| Mus musculus BAC clone RP23-305G22 from 10, compl... 40 5.0

>gb|AC154436.2| Mus musculus BAC clone RP24-192B24 from chromosome 14, complete sequence
          Length = 180476

 Score = 46.1 bits (23), Expect = 0.081
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 201    agcagccctctcctcctctgcct 223
              |||||||||||||||||||||||
Sbjct: 147634 agcagccctctcctcctctgcct 147656



to top

>gb|AC113510.9| Mus musculus chromosome 5, clone RP23-378O9, complete sequence
          Length = 171806

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 206  ccctctcctcctctgcctcctt 227
            ||||||||||||||||||||||
Sbjct: 3468 ccctctcctcctctgcctcctt 3489



to top

>gb|AC157928.4| Mus musculus chromosome 5, clone RP24-119I9, complete sequence
          Length = 157594

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 206   ccctctcctcctctgcctcctt 227
             ||||||||||||||||||||||
Sbjct: 72406 ccctctcctcctctgcctcctt 72427



to top

>ref|XM_522356.1| PREDICTED: Pan troglodytes similar to PDZ domain containing RING
           finger 4; IMAGE5767589 (LOC466956), mRNA
          Length = 3375

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 270 tttctccatgattttgtcatg 290
           |||||||||||||||||||||
Sbjct: 813 tttctccatgattttgtcatg 793



to top

>emb|AL158193.13| Human DNA sequence from clone RP11-400N12 on chromosome 13 Contains the
             3' end of the UBL3 gene for ubiquitin-like 3 and a CpG
             island, complete sequence
          Length = 172896

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 206   ccctctcctcctctgcctcct 226
             |||||||||||||||||||||
Sbjct: 82933 ccctctcctcctctgcctcct 82953



to top

>gb|AC096863.5| Genomic sequence for Mus musculus, clone RP23-110F14, from chromosome
             17, complete sequence
          Length = 134001

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 207   cctctcctcctctgcctcctt 227
             |||||||||||||||||||||
Sbjct: 87486 cctctcctcctctgcctcctt 87466



to top

>gb|AC008704.6| Homo sapiens chromosome 5 clone CTB-77C3, complete sequence
          Length = 95906

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 52    aaaattaaaattcactttcct 72
             |||||||||||||||||||||
Sbjct: 79209 aaaattaaaattcactttcct 79229



to top

>gb|AY855220.1| Tympanuchus cupido haplotype 9 beta-actin gene, intron 2 and
           partial cds
          Length = 737

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 325 ctctgaatctgaactggcaacttgt 349
           ||||||| |||||||||||||||||
Sbjct: 291 ctctgaaactgaactggcaacttgt 315



to top

>emb|AL391834.8| Human DNA sequence from clone RP11-513M16 on chromosome 9, complete
             sequence
          Length = 112713

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 62    ttcactttcctggatctcata 82
             |||||||||||||||||||||
Sbjct: 15059 ttcactttcctggatctcata 15079



to top

>ref|NM_124945.3| Arabidopsis thaliana KCO1; calcium-activated potassium channel/
          outward rectifier potassium channel AT5G55630 (KCO1)
          transcript variant AT5G55630.2 mRNA, complete cds
          Length = 1427

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 65 actttcctggatctcataattaat 88
          |||||||||||||||||| |||||
Sbjct: 70 actttcctggatctcatagttaat 93



to top

>gb|AC116739.13| Mus musculus chromosome 17, clone RP23-435B24, complete sequence
          Length = 222382

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 210    ctcctcctctgcctccttgt 229
              ||||||||||||||||||||
Sbjct: 206449 ctcctcctctgcctccttgt 206468



to top

>gb|AC158932.5| Mus musculus chromosome 3, clone RP24-338G13, complete sequence
          Length = 159429

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 210   ctcctcctctgcctccttgt 229
             ||||||||||||||||||||
Sbjct: 80007 ctcctcctctgcctccttgt 79988



to top

>gb|AC162894.4| Mus musculus chromosome 3, clone RP23-326A24, complete sequence
          Length = 187598

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 210    ctcctcctctgcctccttgt 229
              ||||||||||||||||||||
Sbjct: 121622 ctcctcctctgcctccttgt 121603



to top

>ref|XM_922613.2| PREDICTED: Mus musculus similar to KIAA1946, transcript variant 2
           (LOC634842), mRNA
          Length = 5674

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 207 cctctcctcctctgcctcct 226
           ||||||||||||||||||||
Sbjct: 579 cctctcctcctctgcctcct 560



to top

>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome
          Length = 5178466

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 240     cgcgacccgattccgcatct 259
               ||||||||||||||||||||
Sbjct: 1911011 cgcgacccgattccgcatct 1910992



to top

>gb|AC124436.5| Mus musculus BAC clone RP24-252O24 from chromosome 10, complete
             sequence
          Length = 174497

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 206   ccctctcctcctctgcctcc 225
             ||||||||||||||||||||
Sbjct: 98116 ccctctcctcctctgcctcc 98097



to top

>emb|CR717329.2|CNS0GGFR Tetraodon nigroviridis full-length cDNA
          Length = 1063

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 199 gcagcagccctctcctcctc 218
           ||||||||||||||||||||
Sbjct: 307 gcagcagccctctcctcctc 288



to top

>emb|AL512631.11| Human DNA sequence from clone RP11-138I18 on chromosome 10 Contains the
              5' end of the gene for a protein related to the N terminus
              of tre (RNTRE) (KIAA0019) and a CpG island, complete
              sequence
          Length = 142863

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 207    cctctcctcctctgcctcct 226
              ||||||||||||||||||||
Sbjct: 100261 cctctcctcctctgcctcct 100280



to top

>emb|AL139279.7| Human DNA sequence from clone RP1-80C12 on chromosome X, complete
             sequence
          Length = 98908

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 1     gaataaaactgttgaattga 20
             ||||||||||||||||||||
Sbjct: 51095 gaataaaactgttgaattga 51114



to top

>gb|AC104518.5| Mus Musculus Strain 129S6/SvEvTac chromosome 17 BAC, RP22-187D17,
            Complete Sequence, complete sequence
          Length = 163367

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 210  ctcctcctctgcctccttgt 229
            ||||||||||||||||||||
Sbjct: 9769 ctcctcctctgcctccttgt 9750



to top

>emb|AL627097.6| Mouse DNA sequence from clone RP23-59B16 on chromosome 11 Contains a
             novel pseudogene, the Zfp287 gene for zinc finger protein
             287, three novel genes (4921522H14Rik), a WD repeat and
             SOCS box containing protein 2 pseudogene (LOC213946), the
             gene for a novel protein (MGC39058) and the 5' end of the
             Trim16 gene for tripartite motif protein 16, complete
             sequence
          Length = 161686

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 207   cctctcctcctctgcctcct 226
             ||||||||||||||||||||
Sbjct: 96945 cctctcctcctctgcctcct 96926



to top

>gb|AC022911.6| Homo sapiens chromosome 8, clone RP11-722A15, complete sequence
          Length = 176063

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      aataaaactgttgaattgat 21
              ||||||||||||||||||||
Sbjct: 152969 aataaaactgttgaattgat 152988



to top

>gb|AC079097.6| Homo sapiens chromosome 8, clone RP11-98P2, complete sequence
          Length = 159256

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 2    aataaaactgttgaattgat 21
            ||||||||||||||||||||
Sbjct: 7313 aataaaactgttgaattgat 7332



to top

>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome
          Length = 4940217

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 240     cgcgacccgattccgcatct 259
               ||||||||||||||||||||
Sbjct: 2198537 cgcgacccgattccgcatct 2198518



to top

>gb|AE011797.1| Xanthomonas axonopodis pv. citri str. 306,  section 175 of 469 of the
            complete genome
          Length = 10238

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 240  cgcgacccgattccgcatct 259
            ||||||||||||||||||||
Sbjct: 7694 cgcgacccgattccgcatct 7675



to top

>gb|AC104455.2| Homo sapiens chromosome 1 clone RP4-682E18, complete sequence
          Length = 125123

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 57    taaaattcactttcctggat 76
             ||||||||||||||||||||
Sbjct: 96443 taaaattcactttcctggat 96462



to top

>gb|AC013746.10| Homo sapiens chromosome 8, clone RP11-131P18, complete sequence
          Length = 212337

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 51     caaaattaaaattcactttc 70
              ||||||||||||||||||||
Sbjct: 149654 caaaattaaaattcactttc 149635



to top

>emb|BX830855.1|CNS09ZF3 Arabidopsis thaliana Full-length cDNA Complete sequence from
          clone GSLTLS31ZC03 of Adult vegetative tissue of strain
          col-0 of Arabidopsis thaliana (thale cress)
          Length = 1367

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 65 actttcctggatctcataattaat 88
          |||||||||||||||||| |||||
Sbjct: 70 actttcctggatctcatagttaat 93



to top

>emb|BX832523.1|CNS09YN2 Arabidopsis thaliana Full-length cDNA Complete sequence from
          clone GSLTPGH78ZG02 of Hormone Treated Callus of strain
          col-0 of Arabidopsis thaliana (thale cress)
          Length = 1337

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                  
Query: 65 actttcctggatctcataattaat 88
          |||||||||||||||||| |||||
Sbjct: 22 actttcctggatctcatagttaat 45



to top

>gb|AC117651.8| Mus musculus chromosome 3, clone RP23-287I17, complete sequence
          Length = 229602

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 208   ctctcctcctctgcctcctt 227
             ||||||||||||||||||||
Sbjct: 91987 ctctcctcctctgcctcctt 92006



to top

>dbj|AB005245.2| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUG13
          Length = 86630

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 63    tcactttcctggatctcataatta 86
             |||||||||||||||| |||||||
Sbjct: 20634 tcactttcctggatcttataatta 20611



to top

>gb|AC110562.17| Mus musculus chromosome 17, clone RP23-268M4, complete sequence
          Length = 165190

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 210   ctcctcctctgcctccttgt 229
             ||||||||||||||||||||
Sbjct: 97776 ctcctcctctgcctccttgt 97757



to top

>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome
          Length = 4941439

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 240     cgcgacccgattccgcatct 259
               ||||||||||||||||||||
Sbjct: 2219555 cgcgacccgattccgcatct 2219536



to top

>gb|AE016877.1| Bacillus cereus ATCC 14579, complete genome
          Length = 5411809

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 32     aaaaatatctaaacggtggc 51
              ||||||||||||||||||||
Sbjct: 625980 aaaaatatctaaacggtggc 625961



to top

>gb|AC147634.3| Mus musculus BAC clone RP23-305G22 from 10, complete sequence
          Length = 207157

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 206  ccctctcctcctctgcctcc 225
            ||||||||||||||||||||
Sbjct: 5925 ccctctcctcctctgcctcc 5944


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,562,492
Number of Sequences: 3902068
Number of extensions: 4562492
Number of successful extensions: 88324
Number of sequences better than 10.0: 35
Number of HSP's better than 10.0 without gapping: 35
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 88195
Number of HSP's gapped (non-prelim): 129
length of query: 373
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 351
effective length of database: 17,147,199,772
effective search space: 6018667119972
effective search space used: 6018667119972
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top