Clone Name | rbastl06d07 |
---|---|
Clone Library Name | barley_pub |
No. | Definition | Score (bits) |
E Value |
1 | emb|BX511153.9| Zebrafish DNA sequence from clone DKEYP-66D1 in ... | 40 | 4.1 | 2 | gb|AC036214.9| Homo sapiens chromosome 8, clone RP11-26J3, compl... | 40 | 4.1 | 3 | gb|AC018952.9| Homo sapiens chromosome 8, clone RP11-498N9, comp... | 40 | 4.1 |
---|
>emb|BX511153.9| Zebrafish DNA sequence from clone DKEYP-66D1 in linkage group 2, complete sequence Length = 146969 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 80 aattttttacaagaatattc 99 |||||||||||||||||||| Sbjct: 120050 aattttttacaagaatattc 120069 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 158 aattttttacaagaatattc 177 |||||||||||||||||||| Sbjct: 120050 aattttttacaagaatattc 120069
>gb|AC036214.9| Homo sapiens chromosome 8, clone RP11-26J3, complete sequence Length = 160545 Score = 40.1 bits (20), Expect = 4.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 198 atacattctagcaagaatgcaaaa 221 ||||||||||| |||||||||||| Sbjct: 102314 atacattctagtaagaatgcaaaa 102291
>gb|AC018952.9| Homo sapiens chromosome 8, clone RP11-498N9, complete sequence Length = 180535 Score = 40.1 bits (20), Expect = 4.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 198 atacattctagcaagaatgcaaaa 221 ||||||||||| |||||||||||| Sbjct: 30566 atacattctagtaagaatgcaaaa 30589 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,168,464 Number of Sequences: 3902068 Number of extensions: 3168464 Number of successful extensions: 57220 Number of sequences better than 10.0: 3 Number of HSP's better than 10.0 without gapping: 3 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 57209 Number of HSP's gapped (non-prelim): 11 length of query: 309 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 287 effective length of database: 17,147,199,772 effective search space: 4921246334564 effective search space used: 4921246334564 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)