ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl06c04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC134844.3| Mus musculus BAC clone RP24-398A1 from chromosome... 46 0.042
2emb|AL158090.3| Human DNA sequence from clone RP4-564O4 on chrom... 44 0.16
3gb|AC025767.6|AC025767 Homo sapiens chromosome 5 clone CTD-2087B... 44 0.16
4ref|NM_001011382.1| Xenopus tropicalis hypothetical LOC496850 (L... 42 0.65
5emb|CR761441.2| Xenopus tropicalis finished cDNA, clone TGas140k09 42 0.65
6gb|BC088564.1| Xenopus tropicalis hypothetical LOC496850, mRNA (... 42 0.65
7ref|XM_459762.1| Debaryomyces hansenii CBS767 hypothetical prote... 40 2.6
8ref|XM_663588.1| Cryptosporidium hominis TU502 hypothetical prot... 40 2.6
9emb|AL591063.6| Human DNA sequence from clone RP11-535K1 on chro... 40 2.6
10emb|CR382137.1| Debaryomyces hansenii chromosome E of strain CBS... 40 2.6
11gb|AC163356.2| Mus musculus BAC clone RP23-13A21 from chromosome... 40 2.6
12emb|CR388225.18| Zebrafish DNA sequence from clone CH211-193C1 i... 40 2.6
13gb|AC147235.3| Mus musculus BAC clone RP23-353B7 from 6, complet... 40 2.6
14gb|AC147617.3| Mus musculus BAC clone RP23-442G17 from 6, comple... 40 2.6

>gb|AC134844.3| Mus musculus BAC clone RP24-398A1 from chromosome 7, complete sequence
          Length = 141942

 Score = 46.1 bits (23), Expect = 0.042
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 42    acatgcatgacaataatttcaaa 64
             |||||||||||||||||||||||
Sbjct: 98832 acatgcatgacaataatttcaaa 98810



to top

>emb|AL158090.3| Human DNA sequence from clone RP4-564O4 on chromosome 20 Contains a
             putative novel gene, ESTs and GSSs, complete sequence
          Length = 35094

 Score = 44.1 bits (22), Expect = 0.16
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 34    agtcgttaacatgcatgacaat 55
             ||||||||||||||||||||||
Sbjct: 16382 agtcgttaacatgcatgacaat 16361



to top

>gb|AC025767.6|AC025767 Homo sapiens chromosome 5 clone CTD-2087B2, complete sequence
          Length = 134545

 Score = 44.1 bits (22), Expect = 0.16
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 34   agtcgttaacatgcatgacaat 55
            ||||||||||||||||||||||
Sbjct: 9262 agtcgttaacatgcatgacaat 9283



to top

>ref|NM_001011382.1| Xenopus tropicalis hypothetical LOC496850 (LOC496850), mRNA
          Length = 2132

 Score = 42.1 bits (21), Expect = 0.65
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 55   taatttcaaagcatacagccagata 79
            |||||||||||||| ||||||||||
Sbjct: 1165 taatttcaaagcatgcagccagata 1141



to top

>emb|CR761441.2| Xenopus tropicalis finished cDNA, clone TGas140k09
          Length = 2079

 Score = 42.1 bits (21), Expect = 0.65
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 55   taatttcaaagcatacagccagata 79
            |||||||||||||| ||||||||||
Sbjct: 1165 taatttcaaagcatgcagccagata 1141



to top

>gb|BC088564.1| Xenopus tropicalis hypothetical LOC496850, mRNA (cDNA clone MGC:97751
            IMAGE:6988116), complete cds
          Length = 2132

 Score = 42.1 bits (21), Expect = 0.65
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 55   taatttcaaagcatacagccagata 79
            |||||||||||||| ||||||||||
Sbjct: 1165 taatttcaaagcatgcagccagata 1141



to top

>ref|XM_459762.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0E11066g)
           partial mRNA
          Length = 2181

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 52  caataatttcaaagcataca 71
           ||||||||||||||||||||
Sbjct: 347 caataatttcaaagcataca 366



to top

>ref|XM_663588.1| Cryptosporidium hominis TU502 hypothetical protein (Chro.30237)
            partial mRNA
          Length = 2595

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 89   gcgtatattttacagaatat 108
            ||||||||||||||||||||
Sbjct: 1520 gcgtatattttacagaatat 1539



to top

>emb|AL591063.6| Human DNA sequence from clone RP11-535K1 on chromosome 6, complete
             sequence
          Length = 100426

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 14    attacatgttacaataatat 33
             ||||||||||||||||||||
Sbjct: 18958 attacatgttacaataatat 18977



to top

>emb|CR382137.1| Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces
              hansenii
          Length = 2037969

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 52     caataatttcaaagcataca 71
              ||||||||||||||||||||
Sbjct: 813683 caataatttcaaagcataca 813702



to top

>gb|AC163356.2| Mus musculus BAC clone RP23-13A21 from chromosome 6, complete sequence
          Length = 212612

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 92    tatattttacagaatatgag 111
             ||||||||||||||||||||
Sbjct: 56934 tatattttacagaatatgag 56915



to top

>emb|CR388225.18| Zebrafish DNA sequence from clone CH211-193C1 in linkage group 14,
             complete sequence
          Length = 153626

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 107   atgagccatgagtttgagattatt 130
             |||||||||||| |||||||||||
Sbjct: 34868 atgagccatgagattgagattatt 34845



to top

>gb|AC147235.3| Mus musculus BAC clone RP23-353B7 from 6, complete sequence
          Length = 193668

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 92     tatattttacagaatatgag 111
              ||||||||||||||||||||
Sbjct: 128324 tatattttacagaatatgag 128305



to top

>gb|AC147617.3| Mus musculus BAC clone RP23-442G17 from 6, complete sequence
          Length = 192625

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 92     tatattttacagaatatgag 111
              ||||||||||||||||||||
Sbjct: 168781 tatattttacagaatatgag 168762


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,318,200
Number of Sequences: 3902068
Number of extensions: 2318200
Number of successful extensions: 152493
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 152437
Number of HSP's gapped (non-prelim): 56
length of query: 203
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 181
effective length of database: 17,147,199,772
effective search space: 3103643158732
effective search space used: 3103643158732
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top