Clone Name | rbastl06b09 |
---|---|
Clone Library Name | barley_pub |
>gb|CP000002.2| Bacillus licheniformis ATCC 14580, complete genome Length = 4222334 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Minus Query: 334 ttttatctacacagccgggatttcat 359 |||||||||||||| ||||||||||| Sbjct: 2683659 ttttatctacacagtcgggatttcat 2683634
>gb|AE017333.1| Bacillus licheniformis DSM 13, complete genome Length = 4222645 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Minus Query: 334 ttttatctacacagccgggatttcat 359 |||||||||||||| ||||||||||| Sbjct: 2684519 ttttatctacacagtcgggatttcat 2684494
>gb|AC104460.2| Homo sapiens chromosome 1 clone RP11-438O11, complete sequence Length = 162514 Score = 42.1 bits (21), Expect = 1.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 52 tattatatttcagacattggatattgtatctct 84 |||| |||||||||||||| ||||| ||||||| Sbjct: 132803 tattttatttcagacattgcatattttatctct 132771
>emb|CR956632.4| Pig DNA sequence from clone CH242-197B5 on chromosome 7, complete sequence Length = 186089 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 88 gctcagtgtcaacattctga 107 |||||||||||||||||||| Sbjct: 101926 gctcagtgtcaacattctga 101907
>gb|AC136506.10| Medicago truncatula clone mth2-33c8, complete sequence Length = 135457 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 51 atattatatttcagacattg 70 |||||||||||||||||||| Sbjct: 115884 atattatatttcagacattg 115903
>emb|AL590733.8| Human DNA sequence from clone RP11-193D23 on chromosome 6 Contains the 3' end of the FLJ14440 gene for thrombospondin, complete sequence Length = 135507 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 262 caaaggtctatatggtacag 281 |||||||||||||||||||| Sbjct: 7977 caaaggtctatatggtacag 7958
>gb|AC002472.8| Homo sapiens Chromosome 22q11.2 PAC Clone p_n5 In BCRL2-GGT Region, complete sequence Length = 147086 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 362 tcctcatctgtcatatggga 381 |||||||||||||||||||| Sbjct: 91351 tcctcatctgtcatatggga 91370
>gb|AC007664.12| Homo sapiens chromosome 22 clone b453h4 map 22q11, complete sequence Length = 162470 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 362 tcctcatctgtcatatggga 381 |||||||||||||||||||| Sbjct: 47447 tcctcatctgtcatatggga 47466
>gb|AC016945.22| Homo sapiens 3 BAC RP11-31L6 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 96001 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 229 tctttcttgggtacataagt 248 |||||||||||||||||||| Sbjct: 60339 tctttcttgggtacataagt 60320
>emb|AL590792.1| Human DNA sequence from clone RP11-416F22 on chromosome 6, complete sequence Length = 51956 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 262 caaaggtctatatggtacag 281 |||||||||||||||||||| Sbjct: 6073 caaaggtctatatggtacag 6054 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,373,634 Number of Sequences: 3902068 Number of extensions: 3373634 Number of successful extensions: 57451 Number of sequences better than 10.0: 10 Number of HSP's better than 10.0 without gapping: 10 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 57421 Number of HSP's gapped (non-prelim): 30 length of query: 392 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 370 effective length of database: 17,147,199,772 effective search space: 6344463915640 effective search space used: 6344463915640 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)