ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl06b09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|CP000002.2| Bacillus licheniformis ATCC 14580, complete genome 44 0.34
2gb|AE017333.1| Bacillus licheniformis DSM 13, complete genome 44 0.34
3gb|AC104460.2| Homo sapiens chromosome 1 clone RP11-438O11, comp... 42 1.3
4emb|CR956632.4| Pig DNA sequence from clone CH242-197B5 on chrom... 40 5.2
5gb|AC136506.10| Medicago truncatula clone mth2-33c8, complete se... 40 5.2
6emb|AL590733.8| Human DNA sequence from clone RP11-193D23 on chr... 40 5.2
7gb|AC002472.8| Homo sapiens Chromosome 22q11.2 PAC Clone p_n5 In... 40 5.2
8gb|AC007664.12| Homo sapiens chromosome 22 clone b453h4 map 22q1... 40 5.2
9gb|AC016945.22| Homo sapiens 3 BAC RP11-31L6 (Roswell Park Cance... 40 5.2
10emb|AL590792.1| Human DNA sequence from clone RP11-416F22 on chr... 40 5.2

>gb|CP000002.2| Bacillus licheniformis ATCC 14580, complete genome
          Length = 4222334

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 334     ttttatctacacagccgggatttcat 359
               |||||||||||||| |||||||||||
Sbjct: 2683659 ttttatctacacagtcgggatttcat 2683634



to top

>gb|AE017333.1| Bacillus licheniformis DSM 13, complete genome
          Length = 4222645

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 334     ttttatctacacagccgggatttcat 359
               |||||||||||||| |||||||||||
Sbjct: 2684519 ttttatctacacagtcgggatttcat 2684494



to top

>gb|AC104460.2| Homo sapiens chromosome 1 clone RP11-438O11, complete sequence
          Length = 162514

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                               
Query: 52     tattatatttcagacattggatattgtatctct 84
              |||| |||||||||||||| ||||| |||||||
Sbjct: 132803 tattttatttcagacattgcatattttatctct 132771



to top

>emb|CR956632.4| Pig DNA sequence from clone CH242-197B5 on chromosome 7, complete
              sequence
          Length = 186089

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 88     gctcagtgtcaacattctga 107
              ||||||||||||||||||||
Sbjct: 101926 gctcagtgtcaacattctga 101907



to top

>gb|AC136506.10| Medicago truncatula clone mth2-33c8, complete sequence
          Length = 135457

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 51     atattatatttcagacattg 70
              ||||||||||||||||||||
Sbjct: 115884 atattatatttcagacattg 115903



to top

>emb|AL590733.8| Human DNA sequence from clone RP11-193D23 on chromosome 6 Contains
            the 3' end of the FLJ14440 gene for thrombospondin,
            complete sequence
          Length = 135507

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 262  caaaggtctatatggtacag 281
            ||||||||||||||||||||
Sbjct: 7977 caaaggtctatatggtacag 7958



to top

>gb|AC002472.8| Homo sapiens Chromosome 22q11.2 PAC Clone p_n5 In BCRL2-GGT Region,
             complete sequence
          Length = 147086

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 362   tcctcatctgtcatatggga 381
             ||||||||||||||||||||
Sbjct: 91351 tcctcatctgtcatatggga 91370



to top

>gb|AC007664.12| Homo sapiens chromosome 22 clone b453h4 map 22q11, complete sequence
          Length = 162470

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 362   tcctcatctgtcatatggga 381
             ||||||||||||||||||||
Sbjct: 47447 tcctcatctgtcatatggga 47466



to top

>gb|AC016945.22| Homo sapiens 3 BAC RP11-31L6 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 96001

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 229   tctttcttgggtacataagt 248
             ||||||||||||||||||||
Sbjct: 60339 tctttcttgggtacataagt 60320



to top

>emb|AL590792.1| Human DNA sequence from clone RP11-416F22 on chromosome 6, complete
            sequence
          Length = 51956

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 262  caaaggtctatatggtacag 281
            ||||||||||||||||||||
Sbjct: 6073 caaaggtctatatggtacag 6054


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,373,634
Number of Sequences: 3902068
Number of extensions: 3373634
Number of successful extensions: 57451
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 57421
Number of HSP's gapped (non-prelim): 30
length of query: 392
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 370
effective length of database: 17,147,199,772
effective search space: 6344463915640
effective search space used: 6344463915640
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top