>gb|AC116329.3| Mus musculus BAC clone RP24-290C19 from 5, complete sequence
          Length = 170072

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 45    ccgtagataaaaattacaacg 65
             |||||||||||||||||||||
Sbjct: 86431 ccgtagataaaaattacaacg 86411

>emb|AL356952.18| Human DNA sequence from clone RP11-809M12 on chromosome 10 Contains a
             novel gene and a CpG island, complete sequence
          Length = 129950

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 192   aaacactgcagaaactctcca 212
             |||||||||||||||||||||
Sbjct: 94033 aaacactgcagaaactctcca 94053

>emb|AL138997.18| Human DNA sequence from clone RP11-10O23 on chromosome 13 Contains a
              hepatocyte nuclear factor 4 alpha (HNF4A) pseudogene,
              complete sequence
          Length = 172342

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 192    aaacactgcagaaactctcca 212
              |||||||||||||||||||||
Sbjct: 159807 aaacactgcagaaactctcca 159787

>emb|CR390310.1| Gallus gallus finished cDNA, clone ChEST234p17
          Length = 1645

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 236 gtatgaaaacagccattcctt 256
           |||||||||||||||||||||
Sbjct: 495 gtatgaaaacagccattcctt 475

>gb|AC097489.2| Homo sapiens BAC clone RP11-226A18 from 4, complete sequence
          Length = 152039

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 50    gataaaaattacaacgttat 69
             ||||||||||||||||||||
Sbjct: 81064 gataaaaattacaacgttat 81045

>gb|AC154183.2| Mus musculus BAC clone RP23-474E16 from chromosome 17, complete
             sequence
          Length = 181773

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 202   gaaactctccatgttctact 221
             ||||||||||||||||||||
Sbjct: 59334 gaaactctccatgttctact 59315


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,685,725
Number of Sequences: 3902068
Number of extensions: 2685725
Number of successful extensions: 39942
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 39933
Number of HSP's gapped (non-prelim): 9
length of query: 334
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 312
effective length of database: 17,147,199,772
effective search space: 5349926328864
effective search space used: 5349926328864
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)