Clone Name | rbastl05h09 |
---|---|
Clone Library Name | barley_pub |
>emb|BX000531.11| Human DNA sequence from clone DAQB-12N14 on chromosome 6 Contains the OR2H1 gene for olfactory receptor, family 2, subfamily H, member 1, the UBDP1 pseudogene for ubiquitin D pseudogene 1, the MAS1L gene for MAS1 oncogene-like, the RPS17P1 pseudogene for ribosomal protein S17 pseudogene 1 and the DAQB-12N14.5 gene for a novel transcript, complete sequence Length = 89139 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 37 gtttcatcttttttgtgtctc 57 ||||||||||||||||||||| Sbjct: 24657 gtttcatcttttttgtgtctc 24677
>emb|BX247947.4| Human DNA sequence from clone DASS-372E1 on chromosome 6, complete sequence Length = 112061 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 37 gtttcatcttttttgtgtctc 57 ||||||||||||||||||||| Sbjct: 28441 gtttcatcttttttgtgtctc 28461
>emb|AL645927.3| Human DNA sequence from clone XXbac-13B8 on chromosome 6 contains the OR12D2, OR11A1, OR10C1 and OR2H1 genes for olfactory receptor, family 12, subfamily D, member 2, family 11, subfamily A, member 1, family 10, subfamily C, member 1 and family 2, subfamily H, member 1, the OR12D1P pseudogene for olfactory receptor, family12, subfamily D, member 1, a diubiquitin pseudogene, the MRG gene for MAS-related G protein-coupled receptor MRG and a ribosomal protein S17 (RPS17) pseudogene, complete sequence Length = 112578 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 37 gtttcatcttttttgtgtctc 57 ||||||||||||||||||||| Sbjct: 79126 gtttcatcttttttgtgtctc 79146
>emb|AL662869.2| Human DNA sequence from clone XXbac-128A13 on chromosome 6 contains the OR12D2, OR11A1, OR10C1 and OR2H1 genes for olfactory receptor, family 12, subfamily D, member 2, family 11, subfamily A, member 1, family 10, subfamily C, member 1, family 2, subfamily H, member 1, the gene for MAS-related G protein-coupled receptor (MRG), the OR12D1P pseudogene for olfactory receptor, family 12, subfamily D, member 1, a diubiquitin pseudogene and a ribosomal protein S17 (RPS17) pseudogene, complete sequence Length = 133836 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 37 gtttcatcttttttgtgtctc 57 ||||||||||||||||||||| Sbjct: 75793 gtttcatcttttttgtgtctc 75813
>emb|CR388393.8| Human DNA sequence from clone DADB-136A24 on chromosome 6, complete sequence Length = 159366 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 37 gtttcatcttttttgtgtctc 57 ||||||||||||||||||||| Sbjct: 100599 gtttcatcttttttgtgtctc 100619
>emb|CR759768.2| Human DNA sequence from clone DAMC-143I21 on chromosome 6, complete sequence Length = 123752 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 37 gtttcatcttttttgtgtctc 57 ||||||||||||||||||||| Sbjct: 55242 gtttcatcttttttgtgtctc 55262
>emb|CR759956.2| Human DNA sequence from clone DAAP-341G9 on chromosome 6, complete sequence Length = 81080 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 37 gtttcatcttttttgtgtctc 57 ||||||||||||||||||||| Sbjct: 21646 gtttcatcttttttgtgtctc 21666
>emb|BX927133.5| Human DNA sequence from clone DAMA-61E19 on chromosome 6, complete sequence Length = 107459 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 37 gtttcatcttttttgtgtctc 57 ||||||||||||||||||||| Sbjct: 69285 gtttcatcttttttgtgtctc 69305
>gb|AC004178.1|AC004178 Homo sapiens clone UWGC:y19x006 from 6p21, complete sequence Length = 36384 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 37 gtttcatcttttttgtgtctc 57 ||||||||||||||||||||| Sbjct: 10939 gtttcatcttttttgtgtctc 10919
>emb|AL035542.8|HS994E9 Human DNA sequence from clone RP5-994E9 on chromosome 6p21.31-22.2 Contains the OR12D2, OR11A1, OR10C1 and OR2H1 genes for olfactory receptors 12D2, 11A1, 10C1 and 2H1, olfactory receptor 12D1 pseudogene OR12D1P, a diubiquitin pseudogene, the MAS-related G protein-coupled receptor MRG gene, an RPS17 (40S ribosomal protein S17) pseudogene and GSSs, complete sequence Length = 114868 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 37 gtttcatcttttttgtgtctc 57 ||||||||||||||||||||| Sbjct: 81009 gtttcatcttttttgtgtctc 81029
>gb|AY305266.1| Cucurbita pepo clone S-N08 atp9 gene, complete sequence; and nad5 gene, partial sequence; mitochondrial Length = 9147 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Plus Query: 71 tttgaatcaaacttcaaaccacca 94 |||||||||| ||||||||||||| Sbjct: 5106 tttgaatcaatcttcaaaccacca 5129
>gb|AC122903.4| Mus musculus BAC clone RP23-44N5 from chromosome 1, complete sequence Length = 169832 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 caagccaacaaaagcacact 34 |||||||||||||||||||| Sbjct: 39943 caagccaacaaaagcacact 39924
>gb|AC012590.5| Homo sapiens BAC clone CTD-2375H4 from 7, complete sequence Length = 149708 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 63 atttacattttgaatcaaac 82 |||||||||||||||||||| Sbjct: 130464 atttacattttgaatcaaac 130445
>emb|AL109622.10|HSDJ526F5 Human DNA sequence from clone RP3-526F5 on chromosome Xq26.3-28 Contains the 3' end of a novel gene and the gene for a novel protein similar to ubiquitin-conjugating enzyme E2N (UBC13 homolog, yeast) (UBE2N), complete sequence Length = 122900 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 190 caaaaatactcttcaccaaa 209 |||||||||||||||||||| Sbjct: 93793 caaaaatactcttcaccaaa 93774
>emb|AL049699.8|HSJ747H23 Human DNA sequence from clone RP4-747H23 on chromosome 6q13-15 Contains the 3' end of the ME1 gene for malic enzyme 1 (NADP(+)-dependent, cytosolic), a novel gene, the 5' end of the AGM1 gene for N-acetylglucosamine-phosphate mutase and two CpG islands, complete sequence Length = 114201 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 57 caatcgatttacattttgaa 76 |||||||||||||||||||| Sbjct: 25954 caatcgatttacattttgaa 25935
>gb|AC090094.5| Homo sapiens chromosome 8, clone RP11-252C19, complete sequence Length = 158404 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 tttacattttgaatcaaact 83 |||||||||||||||||||| Sbjct: 79994 tttacattttgaatcaaact 79975
>gb|AC159278.3| Mus musculus BAC clone RP23-361M12 from chromosome 1, complete sequence Length = 180181 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 caagccaacaaaagcacact 34 |||||||||||||||||||| Sbjct: 19128 caagccaacaaaagcacact 19147
>gb|AC025839.12| Homo sapiens chromosome 8, clone RP11-370K2, complete sequence Length = 178009 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 304 gtgccttttcatcttcatct 323 |||||||||||||||||||| Sbjct: 19509 gtgccttttcatcttcatct 19528
>emb|AL928554.24| Mouse DNA sequence from clone RP23-131H7 on chromosome 1, complete sequence Length = 195568 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 caagccaacaaaagcacact 34 |||||||||||||||||||| Sbjct: 174662 caagccaacaaaagcacact 174643
>emb|CT573072.1| Kuenenia stuttgartiensis genome fragment KUST_D (4 of 5) Length = 896449 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 10 aaatccaagccaacaaaagcacac 33 ||||| |||||||||||||||||| Sbjct: 568813 aaatcaaagccaacaaaagcacac 568790
>emb|AL731652.1| Dog DNA sequence from clone RP81-70I6, complete sequence Length = 169460 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 82 cttcaaaccaccatctgcat 101 |||||||||||||||||||| Sbjct: 139337 cttcaaaccaccatctgcat 139318 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,924,861 Number of Sequences: 3902068 Number of extensions: 3924861 Number of successful extensions: 78209 Number of sequences better than 10.0: 21 Number of HSP's better than 10.0 without gapping: 21 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 78169 Number of HSP's gapped (non-prelim): 40 length of query: 385 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 363 effective length of database: 17,147,199,772 effective search space: 6224433517236 effective search space used: 6224433517236 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)