ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl05g10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY108343.1| Zea mays PCO065510 mRNA sequence 68 2e-08
2emb|AL109756.9|HSDJ617C6 Human DNA sequence from clone RP4-617C6... 42 1.2
3emb|AL079334.7|HSJ300O13 Human DNA sequence from clone RP1-300O1... 42 1.2
4emb|CR936503.1| Lactobacillus sakei strain 23K complete genome 42 1.2
5gb|AC129193.4| Mus musculus BAC clone RP24-136L12 from chromosom... 40 4.7
6gb|AC121987.2| Mus musculus BAC clone RP24-294E6 from 9, complet... 40 4.7
7emb|AL627344.8| Human DNA sequence from clone RP11-39H24 on chro... 40 4.7
8ref|XM_782830.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 4.7
9gb|AC058784.17|AC058784 Homo sapiens chromosome 13 clone RP11-28... 40 4.7
10emb|AM233362.1| Francisella tularensis subsp. holarctica strain ... 40 4.7
11emb|AJ749949.1| Francisella tularensis subsp. tularensis SCHU S4... 40 4.7
12emb|AL806516.4| Mouse DNA sequence from clone RP23-453N20 on chr... 40 4.7

>gb|AY108343.1| Zea mays PCO065510 mRNA sequence
          Length = 1496

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 34/34 (100%)
 Strand = Plus / Plus

                                             
Query: 317 aggcgtccatgcgcgccgggtactggtcgatgca 350
           ||||||||||||||||||||||||||||||||||
Sbjct: 369 aggcgtccatgcgcgccgggtactggtcgatgca 402



to top

>emb|AL109756.9|HSDJ617C6 Human DNA sequence from clone RP4-617C6 on chromosome 1p13.3-22.1
             Contains a novel gene, complete sequence
          Length = 111491

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 6     aaagtccaaagtaatgaaatt 26
             |||||||||||||||||||||
Sbjct: 92800 aaagtccaaagtaatgaaatt 92820



to top

>emb|AL079334.7|HSJ300O13 Human DNA sequence from clone RP1-300O13 on chromosome Xq22.1-24
            Contains part of the AMMECR1 gene for Alport syndrome
            (mental retardation, midface hypoplasia and
            elliptocytosis, chromosomal region gene 1) (FLJ341111),
            complete sequence
          Length = 63660

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 6    aaagtccaaagtaatgaaatt 26
            |||||||||||||||||||||
Sbjct: 3081 aaagtccaaagtaatgaaatt 3061



to top

>emb|CR936503.1| Lactobacillus sakei strain 23K complete genome
          Length = 1884661

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 137    acaactgctacaacaccagca 157
              |||||||||||||||||||||
Sbjct: 187000 acaactgctacaacaccagca 186980



to top

>gb|AC129193.4| Mus musculus BAC clone RP24-136L12 from chromosome 9, complete sequence
          Length = 181376

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 205   acatgcaaatccatcagcct 224
             ||||||||||||||||||||
Sbjct: 93902 acatgcaaatccatcagcct 93883



to top

>gb|AC121987.2| Mus musculus BAC clone RP24-294E6 from 9, complete sequence
          Length = 176642

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 205   acatgcaaatccatcagcct 224
             ||||||||||||||||||||
Sbjct: 22146 acatgcaaatccatcagcct 22127



to top

>emb|AL627344.8| Human DNA sequence from clone RP11-39H24 on chromosome 13, complete
             sequence
          Length = 97057

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 112   atgattaaaacccttaataa 131
             ||||||||||||||||||||
Sbjct: 26015 atgattaaaacccttaataa 25996



to top

>ref|XM_782830.1| PREDICTED: Strongylocentrotus purpuratus similar to CG4006-PA,
            isoform A (LOC582897), mRNA
          Length = 1077

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 55   tttcacacaagagcgcgcac 74
            ||||||||||||||||||||
Sbjct: 1020 tttcacacaagagcgcgcac 1039



to top

>gb|AC058784.17|AC058784 Homo sapiens chromosome 13 clone RP11-288O16, complete sequence
          Length = 163781

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 112    atgattaaaacccttaataa 131
              ||||||||||||||||||||
Sbjct: 125752 atgattaaaacccttaataa 125771



to top

>emb|AM233362.1| Francisella tularensis subsp. holarctica strain LVS complete genome
          Length = 1895994

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 144     ctacaacaccagcacaaatt 163
               ||||||||||||||||||||
Sbjct: 1715372 ctacaacaccagcacaaatt 1715353



to top

>emb|AJ749949.1| Francisella tularensis subsp. tularensis SCHU S4 complete genome
          Length = 1892819

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 144   ctacaacaccagcacaaatt 163
             ||||||||||||||||||||
Sbjct: 79459 ctacaacaccagcacaaatt 79478



to top

>emb|AL806516.4| Mouse DNA sequence from clone RP23-453N20 on chromosome X, complete
             sequence
          Length = 179534

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 42    aagttgacataagtttcaca 61
             ||||||||||||||||||||
Sbjct: 86401 aagttgacataagtttcaca 86382


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,422,460
Number of Sequences: 3902068
Number of extensions: 2422460
Number of successful extensions: 57267
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 57231
Number of HSP's gapped (non-prelim): 36
length of query: 353
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 331
effective length of database: 17,147,199,772
effective search space: 5675723124532
effective search space used: 5675723124532
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top