ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl05f12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC134590.5| Mus musculus BAC clone RP23-368K22 from 9, comple... 46 0.027
2emb|AL592433.12| Mouse DNA sequence from clone RP23-445F7 on chr... 44 0.11
3gb|AC112793.5| Mus musculus BAC clone RP23-410D16 from chromosom... 40 1.6
4gb|AC007144.13|AC007144 Drosophila melanogaster, chromosome 2L, ... 40 1.6
5emb|BX469926.18| Zebrafish DNA sequence from clone DKEY-229E3 in... 40 1.6
6gb|AE003668.5| Drosophila melanogaster chromosome 2L, section 77... 40 1.6
7emb|AL807788.9| Mouse DNA sequence from clone RP23-279F23 on chr... 40 1.6
8gb|AC111130.17| Mus musculus chromosome 5, clone RP23-339G19, co... 38 6.5
9gb|AC148003.2| Mus musculus BAC clone RP23-413H13 from chromosom... 38 6.5
10emb|AJ249834.1|DLA249834 Digitalis lanata mRNA for Acyl-CoA bind... 38 6.5
11emb|AJ459965.1|ECA459965 Equus caballus CRISP3 gene for cysteine... 38 6.5
12gb|AC140219.3| Mus musculus BAC clone RP24-270J6 from chromosome... 38 6.5
13gb|AC125351.3| Mus musculus BAC clone RP23-442M3 from chromosome... 38 6.5
14gb|AC117199.3| Mus musculus BAC clone RP23-134L22 from 10, compl... 38 6.5
15gb|AC006662.1| Caenorhabditis elegans fosmid H23L24, complete se... 38 6.5
16emb|AL356115.9| Human DNA sequence from clone RP11-486O22 on chr... 38 6.5
17gb|AC162908.4| Mus musculus BAC clone RP24-296A15 from chromosom... 38 6.5
18gb|AC116345.2| Homo sapiens chromosome 5 clone RP11-232L2, compl... 38 6.5
19gb|AC008158.16| Homo sapiens chromosome 17, clone RP11-42F20, co... 38 6.5
20gb|BC043557.1| Homo sapiens hypothetical protein LOC340090, mRNA... 38 6.5
21dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 38 6.5
22dbj|AP004851.3| Oryza sativa (japonica cultivar-group) genomic D... 38 6.5
23gb|AC109464.2| Homo sapiens chromosome 5 clone RP11-284A20, comp... 38 6.5

>gb|AC134590.5| Mus musculus BAC clone RP23-368K22 from 9, complete sequence
          Length = 180271

 Score = 46.1 bits (23), Expect = 0.027
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 3     cctcttcgcatcttcacacaaaccatg 29
             ||||||||| |||||||||||||||||
Sbjct: 49856 cctcttcgcctcttcacacaaaccatg 49830



to top

>emb|AL592433.12| Mouse DNA sequence from clone RP23-445F7 on chromosome 1, complete
             sequence
          Length = 97685

 Score = 44.1 bits (22), Expect = 0.11
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 104   tcttcctgggttttaacaaaaa 125
             ||||||||||||||||||||||
Sbjct: 35184 tcttcctgggttttaacaaaaa 35205



to top

>gb|AC112793.5| Mus musculus BAC clone RP23-410D16 from chromosome 2, complete
            sequence
          Length = 191286

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 85   actaaaggttcccatggcttcttc 108
            ||||||||||||||||||| ||||
Sbjct: 6481 actaaaggttcccatggctccttc 6458



to top

>gb|AC007144.13|AC007144 Drosophila melanogaster, chromosome 2L, region 38F-39A, BAC clone
              BACR06G10, complete sequence
          Length = 176082

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 62     aaatacaagtactcggcact 81
              ||||||||||||||||||||
Sbjct: 144804 aaatacaagtactcggcact 144823



to top

>emb|BX469926.18| Zebrafish DNA sequence from clone DKEY-229E3 in linkage group 20,
             complete sequence
          Length = 242408

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 109   ctgggttttaacaaaaaagg 128
             ||||||||||||||||||||
Sbjct: 79083 ctgggttttaacaaaaaagg 79064



to top

>gb|AE003668.5| Drosophila melanogaster chromosome 2L, section 77 of 83 of the complete
              sequence
          Length = 270158

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 62     aaatacaagtactcggcact 81
              ||||||||||||||||||||
Sbjct: 243622 aaatacaagtactcggcact 243641



to top

>emb|AL807788.9| Mouse DNA sequence from clone RP23-279F23 on chromosome 2, complete
             sequence
          Length = 57895

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 85    actaaaggttcccatggcttcttc 108
             ||||||||||||||||||| ||||
Sbjct: 49599 actaaaggttcccatggctccttc 49576



to top

>gb|AC111130.17| Mus musculus chromosome 5, clone RP23-339G19, complete sequence
          Length = 212923

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 113   gttttaacaaaaaaggaat 131
             |||||||||||||||||||
Sbjct: 49132 gttttaacaaaaaaggaat 49114



to top

>gb|AC148003.2| Mus musculus BAC clone RP23-413H13 from chromosome 18, complete
             sequence
          Length = 205418

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 17    cacacaaaccatgtcagac 35
             |||||||||||||||||||
Sbjct: 79460 cacacaaaccatgtcagac 79442



to top

>emb|AJ249834.1|DLA249834 Digitalis lanata mRNA for Acyl-CoA binding protein (acbp4 gene)
          Length = 502

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 95  cccatggcttcttcctggg 113
           |||||||||||||||||||
Sbjct: 245 cccatggcttcttcctggg 227



to top

>emb|AJ459965.1|ECA459965 Equus caballus CRISP3 gene for cysteine-rich secretory protein 3 and
             TPX1 gene for testis specific protein 1
          Length = 137520

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 114   ttttaacaaaaaaggaatc 132
             |||||||||||||||||||
Sbjct: 96196 ttttaacaaaaaaggaatc 96214



to top

>gb|AC140219.3| Mus musculus BAC clone RP24-270J6 from chromosome 18, complete sequence
          Length = 119095

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 17    cacacaaaccatgtcagac 35
             |||||||||||||||||||
Sbjct: 99438 cacacaaaccatgtcagac 99420



to top

>gb|AC125351.3| Mus musculus BAC clone RP23-442M3 from chromosome 12, complete sequence
          Length = 188024

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 20    acaaaccatgtcagactta 38
             |||||||||||||||||||
Sbjct: 92721 acaaaccatgtcagactta 92703



to top

>gb|AC117199.3| Mus musculus BAC clone RP23-134L22 from 10, complete sequence
          Length = 210514

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 117   taacaaaaaaggaatctat 135
             |||||||||||||||||||
Sbjct: 80144 taacaaaaaaggaatctat 80126



to top

>gb|AC006662.1| Caenorhabditis elegans fosmid H23L24, complete sequence
          Length = 31491

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 50    ctaaccgtgttcaaatacaagta 72
             ||||| |||||||||||||||||
Sbjct: 12498 ctaacagtgttcaaatacaagta 12476



to top

>emb|AL356115.9| Human DNA sequence from clone RP11-486O22 on chromosome 10 Contains the
             3' end of a novel gene (KIAA1128, FLJ14262, FLJ25809) ,
             the 5' end of a Siah-interacting protein (SIP) (calcyclin
             binding protein) pseudogene, ribosomal protein S3A
             pseudogene 5 (RPS3AP5) and two CpG islands, complete
             sequence
          Length = 150151

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 113   gttttaacaaaaaaggaat 131
             |||||||||||||||||||
Sbjct: 54375 gttttaacaaaaaaggaat 54357



to top

>gb|AC162908.4| Mus musculus BAC clone RP24-296A15 from chromosome 10, complete sequence
          Length = 170988

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 117    taacaaaaaaggaatctat 135
              |||||||||||||||||||
Sbjct: 134588 taacaaaaaaggaatctat 134570



to top

>gb|AC116345.2| Homo sapiens chromosome 5 clone RP11-232L2, complete sequence
          Length = 161470

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 114   ttttaacaaaaaaggaatc 132
             |||||||||||||||||||
Sbjct: 97883 ttttaacaaaaaaggaatc 97901



to top

>gb|AC008158.16| Homo sapiens chromosome 17, clone RP11-42F20, complete sequence
          Length = 148110

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 114    ttttaacaaaaaaggaatc 132
              |||||||||||||||||||
Sbjct: 128761 ttttaacaaaaaaggaatc 128743



to top

>gb|BC043557.1| Homo sapiens hypothetical protein LOC340090, mRNA (cDNA clone
            IMAGE:5187356), partial cds
          Length = 2422

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 114  ttttaacaaaaaaggaatc 132
            |||||||||||||||||||
Sbjct: 2138 ttttaacaaaaaaggaatc 2120



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2,
              complete sequence
          Length = 35954743

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 116    ttaacaaaaaaggaatcta 134
              |||||||||||||||||||
Sbjct: 318367 ttaacaaaaaaggaatcta 318385



to top

>dbj|AP004851.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1359_D06
          Length = 146805

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 116   ttaacaaaaaaggaatcta 134
             |||||||||||||||||||
Sbjct: 47151 ttaacaaaaaaggaatcta 47169



to top

>gb|AC109464.2| Homo sapiens chromosome 5 clone RP11-284A20, complete sequence
          Length = 161641

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 93     ttcccatggcttcttcctg 111
              |||||||||||||||||||
Sbjct: 101446 ttcccatggcttcttcctg 101464


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,342,691
Number of Sequences: 3902068
Number of extensions: 1342691
Number of successful extensions: 99262
Number of sequences better than 10.0: 23
Number of HSP's better than 10.0 without gapping: 23
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 99200
Number of HSP's gapped (non-prelim): 62
length of query: 137
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 116
effective length of database: 17,151,101,840
effective search space: 1989527813440
effective search space used: 1989527813440
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top