Clone Name | rbastl05e01 |
---|---|
Clone Library Name | barley_pub |
>gb|AY483152.1| Hordeum vulgare putative cellulose synthase catalytic subunit (CesA2) mRNA, complete cds Length = 3907 Score = 642 bits (324), Expect = 0.0 Identities = 351/359 (97%), Gaps = 7/359 (1%) Strand = Plus / Minus Query: 99 aaatacaagttgtttcgagtttgtacatacataataatacatccttcgggcaatagcata 158 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3827 aaatacaagttgtttcgagtttgtacatacataataatacatccttcgggcaatagcata 3768 Query: 159 cagacgacgacagctctcagtttcggctcacttacatacatttttatcctctccatttaa 218 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3767 cagacgacgacagctctcagtttcggctcacttacatacatttttatcctctccatttaa 3708 Query: 219 atcaaggtcaacaaataaagaattgctggctggctggacaatgaaacaacactggaactg 278 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3707 atcaaggtcaacaaataaagaattgctggctggctggacaatgaaacaacactggaactg 3648 Query: 279 actcactgacttgctggctggctggctgtatttctttcttcttcttcgtggccgaactgc 338 ||||||||||||||| |||||||||||||||| |||||||||||||||||||||| Sbjct: 3647 actcactgacttgct----ggctggctgtatttct---ttcttcttcgtggccgaactgc 3595 Query: 339 acagaggtgaaggggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggc 398 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3594 acagaggtgaaggggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggc 3535 Query: 399 ccagctacccaccatggaacaaaaccaataacttaacacttgttgcatgtttgttttct 457 |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Sbjct: 3534 ccagctacccaccatggaacaaaaccaatagcttaacacttgttgcatgtttgttttct 3476 Score = 93.7 bits (47), Expect = 5e-16 Identities = 50/51 (98%) Strand = Plus / Minus Query: 33 tagataaataatgtgcagcttcctctattacaaacggcattcttgccttac 83 ||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 3891 tagataaataatgtgcagcttcctctattacaaaccgcattcttgccttac 3841
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 56.0 bits (28), Expect = 1e-04 Identities = 62/71 (87%), Gaps = 3/71 (4%) Strand = Plus / Plus Query: 352 ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 411 |||||||||||||||| || |||||||||| ||||| ||||||||| ||||| ||||| Sbjct: 13688408 ggttgccgcagcctccggtttgcccaaata--ttgcagatatgaggctgagcta-ccacc 13688464 Query: 412 atggaacaaaa 422 |||| |||||| Sbjct: 13688465 atgggacaaaa 13688475
>dbj|AP005248.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBa0084P08 Length = 158656 Score = 56.0 bits (28), Expect = 1e-04 Identities = 62/71 (87%), Gaps = 3/71 (4%) Strand = Plus / Plus Query: 352 ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 411 |||||||||||||||| || |||||||||| ||||| ||||||||| ||||| ||||| Sbjct: 156027 ggttgccgcagcctccggtttgcccaaata--ttgcagatatgaggctgagcta-ccacc 156083 Query: 412 atggaacaaaa 422 |||| |||||| Sbjct: 156084 atgggacaaaa 156094
>dbj|AP004298.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0409D09 Length = 150485 Score = 56.0 bits (28), Expect = 1e-04 Identities = 62/71 (87%), Gaps = 3/71 (4%) Strand = Plus / Plus Query: 352 ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 411 |||||||||||||||| || |||||||||| ||||| ||||||||| ||||| ||||| Sbjct: 39400 ggttgccgcagcctccggtttgcccaaata--ttgcagatatgaggctgagcta-ccacc 39456 Query: 412 atggaacaaaa 422 |||| |||||| Sbjct: 39457 atgggacaaaa 39467
>dbj|AK121193.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086F23, full insert sequence Length = 4127 Score = 56.0 bits (28), Expect = 1e-04 Identities = 62/71 (87%), Gaps = 3/71 (4%) Strand = Plus / Minus Query: 352 ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 411 |||||||||||||||| || |||||||||| ||||| ||||||||| ||||| ||||| Sbjct: 3691 ggttgccgcagcctccggtttgcccaaata--ttgcagatatgaggctgagcta-ccacc 3635 Query: 412 atggaacaaaa 422 |||| |||||| Sbjct: 3634 atgggacaaaa 3624
>dbj|AK073561.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033042D15, full insert sequence Length = 4208 Score = 56.0 bits (28), Expect = 1e-04 Identities = 62/71 (87%), Gaps = 3/71 (4%) Strand = Plus / Minus Query: 352 ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 411 |||||||||||||||| || |||||||||| ||||| ||||||||| ||||| ||||| Sbjct: 3773 ggttgccgcagcctccggtttgcccaaata--ttgcagatatgaggctgagcta-ccacc 3717 Query: 412 atggaacaaaa 422 |||| |||||| Sbjct: 3716 atgggacaaaa 3706
>dbj|AK071976.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013085H01, full insert sequence Length = 1867 Score = 56.0 bits (28), Expect = 1e-04 Identities = 62/71 (87%), Gaps = 3/71 (4%) Strand = Plus / Minus Query: 352 ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 411 |||||||||||||||| || |||||||||| ||||| ||||||||| ||||| ||||| Sbjct: 1496 ggttgccgcagcctccggtttgcccaaata--ttgcagatatgaggctgagcta-ccacc 1440 Query: 412 atggaacaaaa 422 |||| |||||| Sbjct: 1439 atgggacaaaa 1429
>dbj|AK067386.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013099F14, full insert sequence Length = 3221 Score = 56.0 bits (28), Expect = 1e-04 Identities = 62/71 (87%), Gaps = 3/71 (4%) Strand = Plus / Minus Query: 352 ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 411 |||||||||||||||| || |||||||||| ||||| ||||||||| ||||| ||||| Sbjct: 2785 ggttgccgcagcctccggtttgcccaaata--ttgcagatatgaggctgagcta-ccacc 2729 Query: 412 atggaacaaaa 422 |||| |||||| Sbjct: 2728 atgggacaaaa 2718
>dbj|AK062154.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-045-H11, full insert sequence Length = 1827 Score = 56.0 bits (28), Expect = 1e-04 Identities = 62/71 (87%), Gaps = 3/71 (4%) Strand = Plus / Minus Query: 352 ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 411 |||||||||||||||| || |||||||||| ||||| ||||||||| ||||| ||||| Sbjct: 1391 ggttgccgcagcctccggtttgcccaaata--ttgcagatatgaggctgagcta-ccacc 1335 Query: 412 atggaacaaaa 422 |||| |||||| Sbjct: 1334 atgggacaaaa 1324
>gb|AC171105.1| Drosophila melanogaster clone CH223-40I08, complete sequence Length = 53089 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 274 aactgactcactgacttgctggctggctggctg 306 |||||||| ||||||| |||||||||||||||| Sbjct: 25576 aactgactgactgactggctggctggctggctg 25608
>ref|XM_470347.1| Oryza sativa (japonica cultivar-group), mRNA Length = 3905 Score = 50.1 bits (25), Expect = 0.006 Identities = 37/41 (90%) Strand = Plus / Minus Query: 31 gctagataaataatgtgcagcttcctctattacaaacggca 71 |||| |||||||||||||| ||||||||||| || |||||| Sbjct: 3692 gctacataaataatgtgcatcttcctctattccagacggca 3652 Score = 42.1 bits (21), Expect = 1.6 Identities = 60/71 (84%), Gaps = 4/71 (5%) Strand = Plus / Minus Query: 352 ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 411 ||||| ||||||||||||| ||| ||| | ||||| ||||||||| ||||||| ||| Sbjct: 3474 ggttgtcgcagcctcccgtttgctcaa---tattgcagatatgaggctgagctacc-acc 3419 Query: 412 atggaacaaaa 422 ||||||||||| Sbjct: 3418 atggaacaaaa 3408
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 50.1 bits (25), Expect = 0.006 Identities = 37/41 (90%) Strand = Plus / Minus Query: 31 gctagataaataatgtgcagcttcctctattacaaacggca 71 |||| |||||||||||||| ||||||||||| || |||||| Sbjct: 34879215 gctacataaataatgtgcatcttcctctattccagacggca 34879175 Score = 42.1 bits (21), Expect = 1.6 Identities = 60/71 (84%), Gaps = 4/71 (5%) Strand = Plus / Minus Query: 352 ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 411 ||||| ||||||||||||| ||| ||| | ||||| ||||||||| ||||||| ||| Sbjct: 34878997 ggttgtcgcagcctcccgtttgctcaa---tattgcagatatgaggctgagctacc-acc 34878942 Query: 412 atggaacaaaa 422 ||||||||||| Sbjct: 34878941 atggaacaaaa 34878931
>emb|AL031024.1|DMC196F3 Drosophila melanogaster cosmid clone 196F3 Length = 35835 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Minus Query: 274 aactgactcactgacttgctggctggctggctg 306 |||||||| ||||||| |||||||||||||||| Sbjct: 14538 aactgactgactgactggctggctggctggctg 14506
>emb|BX927082.9| Zebrafish DNA sequence from clone DKEY-182O15 in linkage group 13, complete sequence Length = 157140 Score = 50.1 bits (25), Expect = 0.006 Identities = 25/25 (100%) Strand = Plus / Plus Query: 249 tggctggacaatgaaacaacactgg 273 ||||||||||||||||||||||||| Sbjct: 68862 tggctggacaatgaaacaacactgg 68886
>ref|NM_130570.2| Drosophila melanogaster CG32810-RB (CG32810), mRNA Length = 3270 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Minus Query: 274 aactgactcactgacttgctggctggctggctg 306 |||||||| ||||||| |||||||||||||||| Sbjct: 1580 aactgactgactgactggctggctggctggctg 1548
>gb|AY070888.1| Drosophila melanogaster LD45918 full length cDNA Length = 1862 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Minus Query: 274 aactgactcactgacttgctggctggctggctg 306 |||||||| ||||||| |||||||||||||||| Sbjct: 633 aactgactgactgactggctggctggctggctg 601
>gb|AY069257.1| Drosophila melanogaster GM03763 full length cDNA Length = 3282 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Minus Query: 274 aactgactcactgacttgctggctggctggctg 306 |||||||| ||||||| |||||||||||||||| Sbjct: 1578 aactgactgactgactggctggctggctggctg 1546
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 50.1 bits (25), Expect = 0.006 Identities = 37/41 (90%) Strand = Plus / Minus Query: 31 gctagataaataatgtgcagcttcctctattacaaacggca 71 |||| |||||||||||||| ||||||||||| || |||||| Sbjct: 34969287 gctacataaataatgtgcatcttcctctattccagacggca 34969247 Score = 42.1 bits (21), Expect = 1.6 Identities = 60/71 (84%), Gaps = 4/71 (5%) Strand = Plus / Minus Query: 352 ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 411 ||||| ||||||||||||| ||| ||| | ||||| ||||||||| ||||||| ||| Sbjct: 34969069 ggttgtcgcagcctcccgtttgctcaa---tattgcagatatgaggctgagctacc-acc 34969014 Query: 412 atggaacaaaa 422 ||||||||||| Sbjct: 34969013 atggaacaaaa 34969003
>gb|AC104487.3| Oryza sativa chromosome 3 BAC OSJNBa0042I09 genomic sequence, complete sequence Length = 171376 Score = 50.1 bits (25), Expect = 0.006 Identities = 37/41 (90%) Strand = Plus / Plus Query: 31 gctagataaataatgtgcagcttcctctattacaaacggca 71 |||| |||||||||||||| ||||||||||| || |||||| Sbjct: 136265 gctacataaataatgtgcatcttcctctattccagacggca 136305 Score = 42.1 bits (21), Expect = 1.6 Identities = 60/71 (84%), Gaps = 4/71 (5%) Strand = Plus / Plus Query: 352 ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 411 ||||| ||||||||||||| ||| ||| | ||||| ||||||||| ||||||| ||| Sbjct: 136483 ggttgtcgcagcctcccgtttgctcaa---tattgcagatatgaggctgagctacc-acc 136538 Query: 412 atggaacaaaa 422 ||||||||||| Sbjct: 136539 atggaacaaaa 136549
>dbj|AK100877.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023127C10, full insert sequence Length = 4029 Score = 50.1 bits (25), Expect = 0.006 Identities = 37/41 (90%) Strand = Plus / Minus Query: 31 gctagataaataatgtgcagcttcctctattacaaacggca 71 |||| |||||||||||||| ||||||||||| || |||||| Sbjct: 3862 gctacataaataatgtgcatcttcctctattccagacggca 3822 Score = 42.1 bits (21), Expect = 1.6 Identities = 60/71 (84%), Gaps = 4/71 (5%) Strand = Plus / Minus Query: 352 ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 411 ||||| ||||||||||||| ||| ||| | ||||| ||||||||| ||||||| ||| Sbjct: 3644 ggttgtcgcagcctcccgtttgctcaa---tattgcagatatgaggctgagctacc-acc 3589 Query: 412 atggaacaaaa 422 ||||||||||| Sbjct: 3588 atggaacaaaa 3578
>dbj|AK060814.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-H07, full insert sequence Length = 1180 Score = 50.1 bits (25), Expect = 0.006 Identities = 37/41 (90%) Strand = Plus / Minus Query: 31 gctagataaataatgtgcagcttcctctattacaaacggca 71 |||| |||||||||||||| ||||||||||| || |||||| Sbjct: 1009 gctacataaataatgtgcatcttcctctattccagacggca 969 Score = 42.1 bits (21), Expect = 1.6 Identities = 60/71 (84%), Gaps = 4/71 (5%) Strand = Plus / Minus Query: 352 ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 411 ||||| ||||||||||||| ||| ||| | ||||| ||||||||| ||||||| ||| Sbjct: 791 ggttgtcgcagcctcccgtttgctcaa---tattgcagatatgaggctgagctacc-acc 736 Query: 412 atggaacaaaa 422 ||||||||||| Sbjct: 735 atggaacaaaa 725
>gb|AE003421.2| Drosophila melanogaster chromosome X, section 5 of 74 of the complete sequence Length = 304204 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Minus Query: 274 aactgactcactgacttgctggctggctggctg 306 |||||||| ||||||| |||||||||||||||| Sbjct: 55250 aactgactgactgactggctggctggctggctg 55218
>gb|AC114585.19| Mus musculus chromosome 14, clone RP23-296J16, complete sequence Length = 192819 Score = 48.1 bits (24), Expect = 0.025 Identities = 30/32 (93%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| |||||||||||||||| Sbjct: 163480 actgactgactgactggctggctggctggctg 163449 Score = 48.1 bits (24), Expect = 0.025 Identities = 30/32 (93%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| |||||||||||||||| Sbjct: 163236 actgactgactgactggctggctggctggctg 163205 Score = 48.1 bits (24), Expect = 0.025 Identities = 30/32 (93%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| |||||||||||||||| Sbjct: 163132 actgactgactgactggctggctggctggctg 163101 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| ||||||||||||||| Sbjct: 163484 actgactgactgactgactggctggctggctg 163453 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| |||| || |||||||||||||||| Sbjct: 163476 actgactgactggctggctggctggctggctg 163445 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| ||||||||||||||| Sbjct: 163240 actgactgactgactgactggctggctggctg 163209 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| |||| || |||||||||||||||| Sbjct: 163232 actgactgactggctggctggctggctggctg 163201 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| ||||||||||||||| Sbjct: 163136 actgactgactgactgactggctggctggctg 163105 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| |||| || |||||||||||||||| Sbjct: 163128 actgactgactggctggctggctggctggctg 163097 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| | |||||||||||||| Sbjct: 162904 actgactgactgactggttggctggctggctg 162873
>gb|AC158939.9| Mus musculus chromosome 5, clone RP23-204A8, complete sequence Length = 218847 Score = 48.1 bits (24), Expect = 0.025 Identities = 30/32 (93%) Strand = Plus / Plus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| |||||||||||||||| Sbjct: 108847 actgactgactgactggctggctggctggctg 108878 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| |||| || |||||||||||||||| Sbjct: 108851 actgactgactggctggctggctggctggctg 108882 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| ||||||||||||||| Sbjct: 108843 actgactgactgactgactggctggctggctg 108874
>gb|AC117690.10| Mus musculus chromosome 16, clone RP23-446I8, complete sequence Length = 189033 Score = 48.1 bits (24), Expect = 0.025 Identities = 27/28 (96%) Strand = Plus / Plus Query: 291 gctggctggctggctgtatttctttctt 318 ||||||||||||||||| |||||||||| Sbjct: 48789 gctggctggctggctgtctttctttctt 48816
>gb|AC124436.5| Mus musculus BAC clone RP24-252O24 from chromosome 10, complete sequence Length = 174497 Score = 48.1 bits (24), Expect = 0.025 Identities = 30/32 (93%) Strand = Plus / Plus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| |||||||||||||||| Sbjct: 31718 actgactgactgactggctggctggctggctg 31749 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| ||||||||||||||| Sbjct: 31714 actgactgactgactgactggctggctggctg 31745
>emb|BX470191.8| Zebrafish DNA sequence from clone CH211-89N7 in linkage group 7, complete sequence Length = 181294 Score = 48.1 bits (24), Expect = 0.025 Identities = 30/32 (93%) Strand = Plus / Plus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| |||||||||||||||| Sbjct: 76351 actgactgactgactggctggctggctggctg 76382 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| |||| || |||||||||||||||| Sbjct: 76355 actgactgactggctggctggctggctggctg 76386 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| ||||||||||||||| Sbjct: 76347 actgactgactgactgactggctggctggctg 76378
>gb|AE014176.1| Mus musculus piebald deletion region section 4 of 11 of the complete sequence Length = 395229 Score = 48.1 bits (24), Expect = 0.025 Identities = 30/32 (93%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| |||||||||||||||| Sbjct: 60909 actgactgactgactggctggctggctggctg 60878 Score = 48.1 bits (24), Expect = 0.025 Identities = 30/32 (93%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| |||||||||||||||| Sbjct: 60665 actgactgactgactggctggctggctggctg 60634 Score = 48.1 bits (24), Expect = 0.025 Identities = 30/32 (93%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| |||||||||||||||| Sbjct: 60561 actgactgactgactggctggctggctggctg 60530 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| ||||||||||||||| Sbjct: 60913 actgactgactgactgactggctggctggctg 60882 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| |||| || |||||||||||||||| Sbjct: 60905 actgactgactggctggctggctggctggctg 60874 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| ||||||||||||||| Sbjct: 60669 actgactgactgactgactggctggctggctg 60638 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| |||| || |||||||||||||||| Sbjct: 60661 actgactgactggctggctggctggctggctg 60630 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| ||||||||||||||| Sbjct: 60565 actgactgactgactgactggctggctggctg 60534 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| |||| || |||||||||||||||| Sbjct: 60557 actgactgactggctggctggctggctggctg 60526 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| | |||||||||||||| Sbjct: 60333 actgactgactgactggttggctggctggctg 60302
>gb|AC104828.4| Homo sapiens BAC clone RP11-804N11 from 4, complete sequence Length = 181489 Score = 48.1 bits (24), Expect = 0.025 Identities = 24/24 (100%) Strand = Plus / Minus Query: 369 gtctgcccaaatattttgcatata 392 |||||||||||||||||||||||| Sbjct: 85640 gtctgcccaaatattttgcatata 85617
>gb|AC091635.1|AC091635 Drosophila melanogaster, chromosome 2R, region 56F-57A, BAC clone BACR10H12, complete sequence Length = 166168 Score = 48.1 bits (24), Expect = 0.025 Identities = 30/32 (93%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| |||||||||||||||| Sbjct: 118827 actgactgactgactggctggctggctggctg 118796 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| ||||||||||||||| Sbjct: 118831 actgactgactgactgactggctggctggctg 118800
>gb|AC008347.2|AC008347 Drosophila melanogaster, chromosome 2R, region 57A-57A, BAC clone BACR03N16, complete sequence Length = 165519 Score = 48.1 bits (24), Expect = 0.025 Identities = 30/32 (93%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| |||||||||||||||| Sbjct: 12163 actgactgactgactggctggctggctggctg 12132 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| ||||||||||||||| Sbjct: 12167 actgactgactgactgactggctggctggctg 12136
>gb|AC156024.2| Mus musculus BAC clone RP23-89J1 from chromosome 16, complete sequence Length = 240451 Score = 48.1 bits (24), Expect = 0.025 Identities = 27/28 (96%) Strand = Plus / Minus Query: 291 gctggctggctggctgtatttctttctt 318 ||||||||||||||||| |||||||||| Sbjct: 23055 gctggctggctggctgtctttctttctt 23028
>emb|BX001038.6| Zebrafish DNA sequence from clone CH211-12M10 in linkage group 17, complete sequence Length = 180659 Score = 48.1 bits (24), Expect = 0.025 Identities = 30/32 (93%) Strand = Plus / Plus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| |||||||||||||||| Sbjct: 118912 actgactgactgactggctggctggctggctg 118943 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| |||| || |||||||||||||||| Sbjct: 118916 actgactgactggctggctggctggctggctg 118947 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| ||||||||||||||| Sbjct: 118908 actgactgactgactgactggctggctggctg 118939
>gb|AC145419.3| Dasypus novemcinctus clone VMRC5-468K1, complete sequence Length = 151116 Score = 48.1 bits (24), Expect = 0.025 Identities = 27/28 (96%) Strand = Plus / Minus Query: 279 actcactgacttgctggctggctggctg 306 ||||||| |||||||||||||||||||| Sbjct: 22113 actcacttacttgctggctggctggctg 22086
>gb|AC154420.2| Mus musculus BAC clone RP24-212L9 from 14, complete sequence Length = 159591 Score = 48.1 bits (24), Expect = 0.025 Identities = 30/32 (93%) Strand = Plus / Plus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| |||||||||||||||| Sbjct: 111528 actgactgactgactggctggctggctggctg 111559 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| |||| || |||||||||||||||| Sbjct: 111532 actgactgactggctggctggctggctggctg 111563 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| ||||||||||||||| Sbjct: 111524 actgactgactgactgactggctggctggctg 111555
>gb|AE003792.3| Drosophila melanogaster chromosome 2R, section 58 of 73 of the complete sequence Length = 256764 Score = 48.1 bits (24), Expect = 0.025 Identities = 30/32 (93%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| |||||||||||||||| Sbjct: 173756 actgactgactgactggctggctggctggctg 173725 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| ||||||||||||||| Sbjct: 173760 actgactgactgactgactggctggctggctg 173729
>gb|AC004250.1|AC004250 Drosophila melanogaster (P1 DS05897 (D171)) DNA sequence, complete sequence Length = 39471 Score = 48.1 bits (24), Expect = 0.025 Identities = 30/32 (93%) Strand = Plus / Plus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| |||||||||||||||| Sbjct: 22475 actgactgactgactggctggctggctggctg 22506 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| ||||||||||||||| Sbjct: 22471 actgactgactgactgactggctggctggctg 22502
>gb|AC147634.3| Mus musculus BAC clone RP23-305G22 from 10, complete sequence Length = 207157 Score = 48.1 bits (24), Expect = 0.025 Identities = 30/32 (93%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| |||||||||||||||| Sbjct: 72324 actgactgactgactggctggctggctggctg 72293 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| ||||||||||||||| Sbjct: 72328 actgactgactgactgactggctggctggctg 72297
>gb|AC156987.7| Mus musculus chromosome 7, clone RP23-78K13, complete sequence Length = 231140 Score = 46.1 bits (23), Expect = 0.100 Identities = 29/31 (93%) Strand = Plus / Plus Query: 291 gctggctggctggctgtatttctttcttctt 321 ||||||||||||||| | ||||||||||||| Sbjct: 191787 gctggctggctggctttctttctttcttctt 191817
>gb|AC161114.4| Mus musculus BAC clone RP24-338A5 from chromosome 12, complete sequence Length = 220746 Score = 46.1 bits (23), Expect = 0.100 Identities = 26/27 (96%) Strand = Plus / Minus Query: 280 ctcactgacttgctggctggctggctg 306 |||||||||| |||||||||||||||| Sbjct: 208459 ctcactgactggctggctggctggctg 208433
>dbj|AK078692.1| Mus musculus adult male eyeball cDNA, RIKEN full-length enriched library, clone:7530414M05 product:unclassifiable, full insert sequence Length = 2291 Score = 46.1 bits (23), Expect = 0.100 Identities = 26/27 (96%) Strand = Plus / Minus Query: 280 ctcactgacttgctggctggctggctg 306 |||||||||| |||||||||||||||| Sbjct: 1657 ctcactgactggctggctggctggctg 1631
>gb|AC157213.2| Mus musculus BAC clone RP23-157N5 from chromosome 12, complete sequence Length = 211304 Score = 46.1 bits (23), Expect = 0.100 Identities = 26/27 (96%) Strand = Plus / Minus Query: 280 ctcactgacttgctggctggctggctg 306 |||||||||| |||||||||||||||| Sbjct: 76446 ctcactgactggctggctggctggctg 76420
>emb|AL831746.5| Mouse DNA sequence from clone RP23-67O11 on chromosome 4, complete sequence Length = 239570 Score = 46.1 bits (23), Expect = 0.100 Identities = 29/31 (93%) Strand = Plus / Plus Query: 276 ctgactcactgacttgctggctggctggctg 306 |||||| ||||||| |||||||||||||||| Sbjct: 145721 ctgactgactgactggctggctggctggctg 145751 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| |||||| |||||||||||||||| Sbjct: 145780 actgactggctgactggctggctggctggctg 145811 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| |||| ||||||||||| Sbjct: 145772 actgactgactgactggctgactggctggctg 145803
>emb|AL035331.1|DMC33C11 Drosophila melanogaster cosmid clone 33C11 Length = 37005 Score = 46.1 bits (23), Expect = 0.100 Identities = 29/31 (93%) Strand = Plus / Minus Query: 276 ctgactcactgacttgctggctggctggctg 306 |||||| ||||||| |||||||||||||||| Sbjct: 9591 ctgactgactgactggctggctggctggctg 9561 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| |||| || |||||||||||||||| Sbjct: 9588 actgactgactggctggctggctggctggctg 9557
>gb|AC139293.4| Mus musculus BAC clone RP24-381N4 from chromosome 8, complete sequence Length = 161248 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Minus Query: 292 ctggctggctggctgtatttct 313 |||||||||||||||||||||| Sbjct: 4518 ctggctggctggctgtatttct 4497
>ref|NM_001030622.1| Gallus gallus kinesin family member 3A (KIF3A), mRNA Length = 4163 Score = 44.1 bits (22), Expect = 0.39 Identities = 25/26 (96%) Strand = Plus / Minus Query: 300 ctggctgtatttctttcttcttcttc 325 |||||| ||||||||||||||||||| Sbjct: 1421 ctggctttatttctttcttcttcttc 1396
>gb|AC152826.2| Mus musculus BAC clone RP23-111C21 from chromosome 8, complete sequence Length = 196497 Score = 44.1 bits (22), Expect = 0.39 Identities = 28/30 (93%) Strand = Plus / Minus Query: 291 gctggctggctggctgtatttctttcttct 320 ||||||||||||||| | |||||||||||| Sbjct: 109965 gctggctggctggctttctttctttcttct 109936 Score = 40.1 bits (20), Expect = 6.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 291 gctggctggctggctgtatttctttctt 318 |||||||||||||||| |||||||||| Sbjct: 109969 gctggctggctggctggctttctttctt 109942
>ref|XM_414646.1| PREDICTED: Gallus gallus similar to Kinesin-like protein KIF3A (Microtubule plus end-directed kinesin motor 3A) (LOC416331), mRNA Length = 1218 Score = 44.1 bits (22), Expect = 0.39 Identities = 25/26 (96%) Strand = Plus / Minus Query: 300 ctggctgtatttctttcttcttcttc 325 |||||| ||||||||||||||||||| Sbjct: 403 ctggctttatttctttcttcttcttc 378
>gb|AC155728.13| Mus musculus 6 BAC RP24-162H1 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 176377 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Plus Query: 304 ctgtatttctttcttcttcttc 325 |||||||||||||||||||||| Sbjct: 83827 ctgtatttctttcttcttcttc 83848
>gb|U40427.1| Caenorhabditis elegans cosmid F43C9, complete sequence Length = 34037 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Minus Query: 119 ttgtacatacataataatacat 140 |||||||||||||||||||||| Sbjct: 13831 ttgtacatacataataatacat 13810
>emb|AJ851728.1| Gallus gallus mRNA for hypothetical protein, clone 22e2 Length = 4163 Score = 44.1 bits (22), Expect = 0.39 Identities = 25/26 (96%) Strand = Plus / Minus Query: 300 ctggctgtatttctttcttcttcttc 325 |||||| ||||||||||||||||||| Sbjct: 1421 ctggctttatttctttcttcttcttc 1396
>emb|AJ621737.1| Gallus gallus partial KIF3A gene for kinesin-like protein KIF3A, exons 10-12, BAC bW075D23 clone, contig 3 Length = 1950 Score = 44.1 bits (22), Expect = 0.39 Identities = 25/26 (96%) Strand = Plus / Plus Query: 300 ctggctgtatttctttcttcttcttc 325 |||||| ||||||||||||||||||| Sbjct: 1507 ctggctttatttctttcttcttcttc 1532
>emb|CR354750.1| Mus musculus chromosome 6, clone tr151 strain 129/Sv, complete sequence Length = 167508 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Plus Query: 304 ctgtatttctttcttcttcttc 325 |||||||||||||||||||||| Sbjct: 72367 ctgtatttctttcttcttcttc 72388
>gb|DQ099567.1| Taenia pisiformis isolate KAP701 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence Length = 404 Score = 44.1 bits (22), Expect = 0.39 Identities = 25/26 (96%) Strand = Plus / Minus Query: 281 tcactgacttgctggctggctggctg 306 ||||||||| |||||||||||||||| Sbjct: 89 tcactgactggctggctggctggctg 64
>gb|AC007853.4|AC007853 Drosophila melanogaster, chromosome 3R, region 96B-96C, BAC clone BACR03L02, complete sequence Length = 162921 Score = 44.1 bits (22), Expect = 0.39 Identities = 31/34 (91%) Strand = Plus / Plus Query: 273 gaactgactcactgacttgctggctggctggctg 306 ||||||||| |||| || |||||||||||||||| Sbjct: 41258 gaactgactgactggctggctggctggctggctg 41291
>gb|AC008206.10|AC008206 Drosophila melanogaster, chromosome 3R, region 96B-96B, BAC clone BACR03I15, complete sequence Length = 181132 Score = 44.1 bits (22), Expect = 0.39 Identities = 31/34 (91%) Strand = Plus / Plus Query: 273 gaactgactcactgacttgctggctggctggctg 306 ||||||||| |||| || |||||||||||||||| Sbjct: 104590 gaactgactgactggctggctggctggctggctg 104623
>gb|AE003750.2| Drosophila melanogaster chromosome 3R, section 88 of 118 of the complete sequence Length = 227219 Score = 44.1 bits (22), Expect = 0.39 Identities = 31/34 (91%) Strand = Plus / Plus Query: 273 gaactgactcactgacttgctggctggctggctg 306 ||||||||| |||| || |||||||||||||||| Sbjct: 63777 gaactgactgactggctggctggctggctggctg 63810
>gb|AC171917.14| Mus musculus chromosome 8, clone RP23-390K13, complete sequence Length = 217234 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Minus Query: 292 ctggctggctggctgtatttct 313 |||||||||||||||||||||| Sbjct: 183118 ctggctggctggctgtatttct 183097
>gb|AC171678.8| Mus musculus chromosome 8, clone RP24-104E12, complete sequence Length = 175681 Score = 44.1 bits (22), Expect = 0.39 Identities = 22/22 (100%) Strand = Plus / Minus Query: 292 ctggctggctggctgtatttct 313 |||||||||||||||||||||| Sbjct: 92049 ctggctggctggctgtatttct 92028
>gb|AC159985.2| Gallus gallus BAC clone CH261-18F10 from chromosome unknown, complete sequence Length = 211288 Score = 44.1 bits (22), Expect = 0.39 Identities = 25/26 (96%) Strand = Plus / Minus Query: 300 ctggctgtatttctttcttcttcttc 325 |||||| ||||||||||||||||||| Sbjct: 107749 ctggctttatttctttcttcttcttc 107724
>gb|AF380987.1| Musca domestica microsatellite MdCA224 sequence Length = 284 Score = 42.1 bits (21), Expect = 1.6 Identities = 24/25 (96%) Strand = Plus / Plus Query: 286 gacttgctggctggctggctgtatt 310 |||| |||||||||||||||||||| Sbjct: 260 gactggctggctggctggctgtatt 284
>gb|AC002565.1|HUAC002565 Human Chromosome 16 BAC clone CIT987SK-A-598D4, complete sequence Length = 103911 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 35 gataaataatgtgcagcttcc 55 ||||||||||||||||||||| Sbjct: 487 gataaataatgtgcagcttcc 467
>emb|Z81311.1|HSU244G10 Human DNA sequence from clone LL0XNC01-244G10 on chromosome Xq26-27.1 Contains a melanoma antigen, family A, 11 (MAGEA11) pseudogene and a tau tubulin kinase pseudogene, complete sequence Length = 43927 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 305 tgtatttctttcttcttcttc 325 ||||||||||||||||||||| Sbjct: 12128 tgtatttctttcttcttcttc 12148
>emb|AL365364.19| Human DNA sequence from clone RP11-624L12 on chromosome 10 Contains a ribosomal protein L17 (RPL17) pseudogene and the 3'end of the FER1L3 gene for fer-1-like 3, myoferlin (C. elegans), complete sequence Length = 173864 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 305 tgtatttctttcttcttcttc 325 ||||||||||||||||||||| Sbjct: 153643 tgtatttctttcttcttcttc 153663
>gb|AC171138.2| Helobdella robusta clone CH306-1A9, complete sequence Length = 97729 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 278 gactcactgacttgctggctggctggctg 306 |||| ||||||| |||||||||||||||| Sbjct: 20061 gactgactgactggctggctggctggctg 20089 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| |||| || |||||||||||||||| Sbjct: 20062 actgactgactggctggctggctggctggctg 20093
>emb|BX004828.21| Zebrafish DNA sequence from clone DKEY-185M8, complete sequence Length = 161870 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 305 tgtatttctttcttcttcttc 325 ||||||||||||||||||||| Sbjct: 117680 tgtatttctttcttcttcttc 117700
>gb|AC008731.8| Homo sapiens chromosome 16 clone CTD-2515A14, complete sequence Length = 219013 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 35 gataaataatgtgcagcttcc 55 ||||||||||||||||||||| Sbjct: 188859 gataaataatgtgcagcttcc 188839
>gb|AC008331.7|AC008331 Drosophila melanogaster, chromosome 2L, region 29D-29E, BAC clone BACR02B16, complete sequence Length = 186938 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 274 aactgactcactgacttgctggctggctg 302 |||||||| ||||||| |||||||||||| Sbjct: 139925 aactgactgactgactggctggctggctg 139897
>gb|AC007330.6|AC007330 Drosophila melanogaster, chromosome 2R, region 46C-46D, BAC clone BACR30G11, complete sequence Length = 166854 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Minus Query: 274 aactgactcactgacttgctggctggctggctg 306 |||||||| | ||||| |||||||||||||||| Sbjct: 139290 aactgactgattgactggctggctggctggctg 139258
>gb|AC007413.5|AC007413 Drosophila melanogaster, chromosome 2R, region 46C-46D, BAC clone BACR01L01, complete sequence Length = 160301 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Minus Query: 274 aactgactcactgacttgctggctggctggctg 306 |||||||| | ||||| |||||||||||||||| Sbjct: 94372 aactgactgattgactggctggctggctggctg 94340
>gb|AC008939.8| Homo sapiens chromosome 5 clone CTD-2316B1, complete sequence Length = 112755 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 335 ctgcacagaggtgaaggggtt 355 ||||||||||||||||||||| Sbjct: 72266 ctgcacagaggtgaaggggtt 72286
>emb|AL928824.13| Zebrafish DNA sequence from clone CH211-105D18 in linkage group 6, complete sequence Length = 189742 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 305 tgtatttctttcttcttcttc 325 ||||||||||||||||||||| Sbjct: 18694 tgtatttctttcttcttcttc 18674
>dbj|AK101178.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033029A22, full insert sequence Length = 2325 Score = 42.1 bits (21), Expect = 1.6 Identities = 60/71 (84%), Gaps = 4/71 (5%) Strand = Plus / Minus Query: 352 ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 411 ||||| ||||||||||||| ||| ||| | ||||| ||||||||| ||||||| ||| Sbjct: 2271 ggttgtcgcagcctcccgtttgctcaa---tattgcagatatgaggctgagctacc-acc 2216 Query: 412 atggaacaaaa 422 ||||||||||| Sbjct: 2215 atggaacaaaa 2205
>gb|AE003622.4| Drosophila melanogaster chromosome 2L, section 31 of 83 of the complete sequence Length = 262557 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Minus Query: 274 aactgactcactgacttgctggctggctg 302 |||||||| ||||||| |||||||||||| Sbjct: 51603 aactgactgactgactggctggctggctg 51575
>gb|AE003831.3| Drosophila melanogaster chromosome 2R, section 19 of 73 of the complete sequence Length = 275390 Score = 42.1 bits (21), Expect = 1.6 Identities = 30/33 (90%) Strand = Plus / Minus Query: 274 aactgactcactgacttgctggctggctggctg 306 |||||||| | ||||| |||||||||||||||| Sbjct: 80218 aactgactgattgactggctggctggctggctg 80186
>emb|AJ418551.1|SAU418551 Sparus aurata satellite DNA, clone SAgenomic-IMBB09 Length = 597 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 427 taacttaacacttgttgcatg 447 ||||||||||||||||||||| Sbjct: 395 taacttaacacttgttgcatg 375
>emb|AL607066.23| Mouse DNA sequence from clone RP23-406N5 on chromosome 4, complete sequence Length = 194837 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 298 ggctggctgtatttctttctt 318 ||||||||||||||||||||| Sbjct: 87547 ggctggctgtatttctttctt 87567
>gb|AC110195.14| Mus musculus chromosome 3, clone RP24-291L17, complete sequence Length = 171669 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 118 tttgtacatacataataata 137 |||||||||||||||||||| Sbjct: 66014 tttgtacatacataataata 66033
>gb|AC152953.1| Mus musculus 10 BAC RP23-403E19 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 211343 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 302 ggctgtatttctttcttcttcttc 325 |||| ||||||||||||||||||| Sbjct: 35518 ggctttatttctttcttcttcttc 35541
>gb|AC167466.6| Mus musculus chromosome 7, clone RP24-220N8, complete sequence Length = 163721 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 294 ggctggctggctgtatttctttct 317 |||||||||||||| ||||||||| Sbjct: 3005 ggctggctggctgtctttctttct 2982
>gb|AC132347.4| Mus musculus BAC clone RP24-186F6 from chromosome 13, complete sequence Length = 155751 Score = 40.1 bits (20), Expect = 6.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctg 302 ||||||| ||||||| |||||||||||| Sbjct: 36591 actgactgactgactggctggctggctg 36564
>gb|CP000068.1| Trypanosoma brucei chromosome 5, complete sequence Length = 1608198 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 308 atttctttcttcttcttcgt 327 |||||||||||||||||||| Sbjct: 275051 atttctttcttcttcttcgt 275070
>gb|AC159441.1| Trypanosoma brucei chromosome 5 clone RPCI93-30F7, complete sequence Length = 101712 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 308 atttctttcttcttcttcgt 327 |||||||||||||||||||| Sbjct: 15092 atttctttcttcttcttcgt 15073
>gb|AC159432.1| Trypanosoma brucei chromosome 5 clone RPCI93-28F8, complete sequence Length = 140539 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 308 atttctttcttcttcttcgt 327 |||||||||||||||||||| Sbjct: 118475 atttctttcttcttcttcgt 118456
>gb|AC007818.8| Drosophila melanogaster clone BACR02M05, complete sequence Length = 188549 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 283 actgacttgctggctggctggctg 306 ||||||| |||||||||||||||| Sbjct: 87679 actgactggctggctggctggctg 87656
>gb|AC008097.5| Drosophila melanogaster clone BACR20D06, complete sequence Length = 185670 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 275 actgactcactgacttgctggctg 298 ||||||| |||||||||||||||| Sbjct: 1216 actgactgactgacttgctggctg 1239
>gb|AC133874.10| Mus musculus chromosome 19, clone RP23-81N16, complete sequence Length = 215113 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 294 ggctggctggctgtatttct 313 |||||||||||||||||||| Sbjct: 183391 ggctggctggctgtatttct 183372
>gb|AC008346.6| Drosophila melanogaster clone BACR45K04, complete sequence Length = 181142 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctg 298 ||||||| |||||||||||||||| Sbjct: 94605 actgactgactgacttgctggctg 94582
>gb|AY560661.1| Aspergillus fumigatus protein O-D-mannosyltransferase mRNA, complete cds Length = 2346 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 287 acttgctggctggctggctg 306 |||||||||||||||||||| Sbjct: 345 acttgctggctggctggctg 364
>ref|NM_001006386.2| Gallus gallus lipin 2 (LPIN2), mRNA Length = 2812 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 305 tgtatttctttcttcttctt 324 |||||||||||||||||||| Sbjct: 599 tgtatttctttcttcttctt 580
>ref|NM_017712.2| Homo sapiens pyroglutamyl-peptidase I (PGPEP1), mRNA Length = 7084 Score = 40.1 bits (20), Expect = 6.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 291 gctggctggctggctgtatttctttctt 318 ||||||||||||||| | |||||||||| Sbjct: 1202 gctggctggctggctttctttctttctt 1229
>ref|NM_006836.1| Homo sapiens GCN1 general control of amino-acid synthesis 1-like 1 (yeast) (GCN1L1), mRNA Length = 8699 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 346 tgaaggggttgccgcagcct 365 |||||||||||||||||||| Sbjct: 1474 tgaaggggttgccgcagcct 1493
>gb|AC122753.11| Mus musculus chromosome 5, clone RP24-492O4, complete sequence Length = 183819 Score = 40.1 bits (20), Expect = 6.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 291 gctggctggctggctgtatttctttctt 318 ||||||||||||||| | |||||||||| Sbjct: 64570 gctggctggctggctttctttctttctt 64597 Score = 40.1 bits (20), Expect = 6.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 291 gctggctggctggctgtatttctttctt 318 |||||||||||||||| |||||||||| Sbjct: 64566 gctggctggctggctggctttctttctt 64593
>gb|AC073258.9| Homo sapiens BAC clone RP11-221B19 from 7, complete sequence Length = 156127 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 16 atttaccaaaaacaagctag 35 |||||||||||||||||||| Sbjct: 65793 atttaccaaaaacaagctag 65812
>gb|AC011738.4| Homo sapiens BAC clone RP11-36H20 from 7, complete sequence Length = 141777 Score = 40.1 bits (20), Expect = 6.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 291 gctggctggctggctgtatttctttctt 318 ||||||||||||||| | |||||||||| Sbjct: 100730 gctggctggctggctttctttctttctt 100757 Score = 40.1 bits (20), Expect = 6.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 291 gctggctggctggctgtatttctttctt 318 |||||||||||||||| |||||||||| Sbjct: 100726 gctggctggctggctggctttctttctt 100753
>ref|XM_749868.1| Aspergillus fumigatus Af293 protein mannosyltransferase 1 (Afu3g06450) partial mRNA Length = 2841 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 287 acttgctggctggctggctg 306 |||||||||||||||||||| Sbjct: 345 acttgctggctggctggctg 364
>emb|CR318600.13| Zebrafish DNA sequence from clone DKEY-37F13 in linkage group 7, complete sequence Length = 257374 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 192 acatacatttttatcctctc 211 |||||||||||||||||||| Sbjct: 118 acatacatttttatcctctc 99
>gb|AC131792.4| Mus musculus BAC clone RP24-468O15 from chromosome 19, complete sequence Length = 162238 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 308 atttctttcttcttcttcgt 327 |||||||||||||||||||| Sbjct: 84527 atttctttcttcttcttcgt 84508
>emb|CR536619.20| Zebrafish DNA sequence from clone CH211-194H19 in linkage group 16, complete sequence Length = 179375 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 305 tgtatttctttcttcttctt 324 |||||||||||||||||||| Sbjct: 65060 tgtatttctttcttcttctt 65079
>gb|AC102432.9| Mus musculus chromosome 19, clone RP24-114A21, complete sequence Length = 199240 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 294 ggctggctggctgtatttctttct 317 |||||||||||||| ||||||||| Sbjct: 110624 ggctggctggctgtctttctttct 110647
>ref|XM_661721.1| Cryptosporidium hominis TU502 hypothetical protein (Chro.80109) partial mRNA Length = 2910 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 3 tctccaaatcagaatttacc 22 |||||||||||||||||||| Sbjct: 1648 tctccaaatcagaatttacc 1667
>gb|AC161413.5| Mus musculus chromosome 19, clone RP23-106D17, complete sequence Length = 215356 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 294 ggctggctggctgtatttctttct 317 |||||||||||||| ||||||||| Sbjct: 20438 ggctggctggctgtctttctttct 20415
>gb|AC142312.1| Pan troglodytes BAC clone RP43-47K13 from 7, complete sequence Length = 144713 Score = 40.1 bits (20), Expect = 6.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 291 gctggctggctggctgtatttctttctt 318 ||||||||||||||| | |||||||||| Sbjct: 46831 gctggctggctggctttctttctttctt 46858 Score = 40.1 bits (20), Expect = 6.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 291 gctggctggctggctgtatttctttctt 318 |||||||||||||||| |||||||||| Sbjct: 46827 gctggctggctggctggctttctttctt 46854
>gb|AC118728.12| Mus musculus chromosome 1, clone RP24-168F13, complete sequence Length = 176970 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 283 actgacttgctggctggctggctg 306 ||||||| |||||||||||||||| Sbjct: 155621 actgactggctggctggctggctg 155644
>emb|BX548003.29| Zebrafish DNA sequence from clone DKEY-97I5 in linkage group 9, complete sequence Length = 145468 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| |||| ||||||||||| Sbjct: 93124 actgactgactgactggctgactggctggctg 93093 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| |||| ||||||||||| Sbjct: 92935 actgactgactgactggctgactggctggctg 92904
>emb|AL445473.7| Human DNA sequence from clone RP11-214M7 on chromosome 1 Contains part of the RYR2 gene for ryanodine receptor 2 (cardiac), complete sequence Length = 183549 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 279 actcactgacttgctggctggctg 302 ||||||| |||||||||||||||| Sbjct: 1588 actcactcacttgctggctggctg 1611
>emb|AL356773.12| Human DNA sequence from clone RP11-44E24 on chromosome 1 Contains part of the RYR2 gene for ryanodine receptor 2 (cardiac), complete sequence Length = 108625 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 279 actcactgacttgctggctggctg 302 ||||||| |||||||||||||||| Sbjct: 108213 actcactcacttgctggctggctg 108236
>emb|AL356578.22| Human DNA sequence from clone RP11-14G9 on chromosome Xq22.3-24, complete sequence Length = 33432 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||| ||||||||||||||||||| Sbjct: 23299 actgactggctggcttgctggctggctggctg 23330
>gb|AC161506.4| Mus musculus chromosome 3, clone RP24-210J6, complete sequence Length = 175241 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 118 tttgtacatacataataata 137 |||||||||||||||||||| Sbjct: 7500 tttgtacatacataataata 7481
>emb|AL713958.11| Mouse DNA sequence from clone RP23-370F7 on chromosome 11 Contains the 5' end of a novel gene, the 3' end of the Cyfip2 gene for cytoplasmic FMR1 interacting protein 2 and a CpG island, complete sequence Length = 105696 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| |||| ||||||||||| Sbjct: 73464 actgactgactgactggctgactggctggctg 73495
>emb|AL121806.2|DMBR42I17 Drosophila melanogaster BAC clone BACR42I17 Length = 155168 Score = 40.1 bits (20), Expect = 6.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 275 actgactcactgacttgctggctggctg 302 ||||||| ||||||| |||||||||||| Sbjct: 142046 actgactgactgactggctggctggctg 142073
>emb|AL672084.10| Mouse DNA sequence from clone RP23-223D13 on chromosome 11 Contains the 3' end of the Spred2 gene for sprouty protein with EVH-1 domain 2, related sequence and a CpG island, complete sequence Length = 122090 Score = 40.1 bits (20), Expect = 6.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 291 gctggctggctggctgtatttctttctt 318 ||||||||||||||| | |||||||||| Sbjct: 87945 gctggctggctggctttgtttctttctt 87918
>gb|AC148098.3| Medicago truncatula clone mth2-15b16, complete sequence Length = 97953 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 430 cttaacacttgttgcatgtt 449 |||||||||||||||||||| Sbjct: 25650 cttaacacttgttgcatgtt 25631
>gb|AC104410.3| Drosophila melanogaster X BAC RP98-10H22 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 179869 Score = 40.1 bits (20), Expect = 6.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 275 actgactcactgacttgctggctggctg 302 ||||||| ||||||| |||||||||||| Sbjct: 156885 actgactgactgactggctggctggctg 156912
>gb|AC150207.2| Medicago truncatula chromosome 2 BAC clone mte1-29a5, complete sequence Length = 124676 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 430 cttaacacttgttgcatgtt 449 |||||||||||||||||||| Sbjct: 36943 cttaacacttgttgcatgtt 36924
>gb|AE017340.1| Idiomarina loihiensis L2TR, complete genome Length = 2839318 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 114 cgagtttgtacatacataat 133 |||||||||||||||||||| Sbjct: 2174052 cgagtttgtacatacataat 2174071
>emb|BX663518.10| Zebrafish DNA sequence from clone CH211-214O7 in linkage group 7, complete sequence Length = 200579 Score = 40.1 bits (20), Expect = 6.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 275 actgactcactgacttgctggctggctg 302 ||||||| ||||||| |||||||||||| Sbjct: 108477 actgactgactgactggctggctggctg 108504 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| ||||||||||||||| Sbjct: 108473 actgactgactgactgactggctggctggctg 108504
>ref|XM_626998.1| Cryptosporidium parvum Iowa II Ydr449cp/Utp6p; small (ribosomal) subunit (SSU) processosome (contains U3 snoRNA). HAT repeats (cgd8_900), partial mRNA Length = 2913 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 3 tctccaaatcagaatttacc 22 |||||||||||||||||||| Sbjct: 1651 tctccaaatcagaatttacc 1670
>gb|AY171066.1|AY171065S2 Dictyostelium discoideum extrachromosomal palindromic ribosomal RNA gene sequence, central segment Length = 79318 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 283 actgacttgctggctggctggctg 306 ||||||| |||||||||||||||| Sbjct: 61872 actgactggctggctggctggctg 61849 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 283 actgacttgctggctggctggctg 306 ||||||| |||||||||||||||| Sbjct: 17447 actgactggctggctggctggctg 17470
>gb|AC159620.2| Mus musculus BAC clone RP24-354K18 from chromosome 12, complete sequence Length = 155161 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 283 actgacttgctggctggctggctg 306 ||||||| |||||||||||||||| Sbjct: 71063 actgactggctggctggctggctg 71086
>emb|BX539341.8| Zebrafish DNA sequence from clone DKEY-3P4 in linkage group 22, complete sequence Length = 236484 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 305 tgtatttctttcttcttctt 324 |||||||||||||||||||| Sbjct: 188518 tgtatttctttcttcttctt 188537
>gb|AC073528.26|AC073528 Homo sapiens 12 BAC RP11-8P16 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 167041 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 306 gtatttctttcttcttcttc 325 |||||||||||||||||||| Sbjct: 156224 gtatttctttcttcttcttc 156243
>gb|AC009257.3|AC009257 Drosophila melanogaster, chromosome 2R, region 59D-59E, BAC clone BACR25I01, complete sequence Length = 218565 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| ||||||||||||||| Sbjct: 216904 actgactgactgactgactggctggctggctg 216873
>gb|AC008217.5|AC008217 Drosophila melanogaster, chromosome 3R, region 98B-98B, BAC clone BACR10J03, complete sequence Length = 193245 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 283 actgacttgctggctggctggctg 306 ||||||| |||||||||||||||| Sbjct: 30402 actgactggctggctggctggctg 30379
>gb|AC005639.2|AC005639 Drosophila melanogaster, chromosome 2R, region 59E3-59F4, BAC clone BACR48M01, complete sequence Length = 188272 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| ||||||||||||||| Sbjct: 72210 actgactgactgactgactggctggctggctg 72179
>gb|AC105915.5| Homo sapiens BAC clone RP11-69D13 from 4, complete sequence Length = 178734 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 288 cttgctggctggctggctgt 307 |||||||||||||||||||| Sbjct: 38615 cttgctggctggctggctgt 38634
>gb|AC110296.3| Homo sapiens BAC clone RP11-120A1 from 4, complete sequence Length = 132626 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 305 tgtatttctttcttcttctt 324 |||||||||||||||||||| Sbjct: 80203 tgtatttctttcttcttctt 80222
>gb|AC008397.7|AC008397 Homo sapiens chromosome 19 clone CTC-251H24, complete sequence Length = 209519 Score = 40.1 bits (20), Expect = 6.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 291 gctggctggctggctgtatttctttctt 318 ||||||||||||||| | |||||||||| Sbjct: 133375 gctggctggctggctttctttctttctt 133402
>gb|AC007009.2|AC007009 Homo sapiens BAC clone RP11-560C1 from 7p22-p21, complete sequence Length = 152523 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 287 acttgctggctggctggctg 306 |||||||||||||||||||| Sbjct: 1540 acttgctggctggctggctg 1521
>gb|AC073907.25| Homo sapiens 12 BAC RP11-202G24 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 135245 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 306 gtatttctttcttcttcttc 325 |||||||||||||||||||| Sbjct: 78811 gtatttctttcttcttcttc 78792
>dbj|AK000215.1| Homo sapiens cDNA FLJ20208 fis, clone COLF1623 Length = 2239 Score = 40.1 bits (20), Expect = 6.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 291 gctggctggctggctgtatttctttctt 318 ||||||||||||||| | |||||||||| Sbjct: 1164 gctggctggctggctttctttctttctt 1191 Score = 40.1 bits (20), Expect = 6.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 291 gctggctggctggctgtatttctttctt 318 |||||||||||||||| |||||||||| Sbjct: 1160 gctggctggctggctggctttctttctt 1187
>emb|CR847530.19| Zebrafish DNA sequence from clone DKEY-14I17 in linkage group 20, complete sequence Length = 144640 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 304 ctgtatttctttcttcttcttcgt 327 |||| ||||||||||||||||||| Sbjct: 50604 ctgtttttctttcttcttcttcgt 50581
>gb|AC091266.8| Mus musculus chromosome 1, clone RP23-366C1, complete sequence Length = 177529 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 283 actgacttgctggctggctggctg 306 ||||||| |||||||||||||||| Sbjct: 66996 actgactggctggctggctggctg 67019
>gb|AE003762.4| Drosophila melanogaster chromosome 3R, section 100 of 118 of the complete sequence Length = 231486 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 283 actgacttgctggctggctggctg 306 ||||||| |||||||||||||||| Sbjct: 60080 actgactggctggctggctggctg 60057
>gb|AE003794.4| Drosophila melanogaster chromosome 2R, section 56 of 73 of the complete sequence Length = 281805 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 275 actgactcactgacttgctggctg 298 ||||||| |||||||||||||||| Sbjct: 225454 actgactgactgacttgctggctg 225477
>gb|AE003461.3| Drosophila melanogaster chromosome 2R, section 69 of 73 of the complete sequence Length = 598988 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| ||||||| ||||||||||||||| Sbjct: 105750 actgactgactgactgactggctggctggctg 105719
>gb|AE003420.2| Drosophila melanogaster chromosome X, section 4 of 74 of the complete sequence Length = 308311 Score = 40.1 bits (20), Expect = 6.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 275 actgactcactgacttgctggctggctg 302 ||||||| ||||||| |||||||||||| Sbjct: 98128 actgactgactgactggctggctggctg 98155
>emb|BX465834.20| Zebrafish DNA sequence from clone CH211-202E12 in linkage group 5, complete sequence Length = 176520 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 290 tgctggctggctggctgtat 309 |||||||||||||||||||| Sbjct: 38839 tgctggctggctggctgtat 38858
>gb|AC004812.1|AC004812 Homo sapiens PAC clone 267D11 from 12, complete sequence Length = 138532 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 346 tgaaggggttgccgcagcct 365 |||||||||||||||||||| Sbjct: 116279 tgaaggggttgccgcagcct 116260
>emb|AL805972.11| Mouse DNA sequence from clone RP23-211P15 on chromosome 4, complete sequence Length = 223059 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 243 gctggctggctggacaatga 262 |||||||||||||||||||| Sbjct: 152991 gctggctggctggacaatga 152972
>emb|AL928975.10| Zebrafish DNA sequence from clone CH211-133N4, complete sequence Length = 174480 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 283 actgacttgctggctggctggctg 306 ||||||| |||||||||||||||| Sbjct: 155279 actgactggctggctggctggctg 155302
>emb|AL928573.14| Zebrafish DNA sequence from clone DKEY-11F5, complete sequence Length = 244471 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 305 tgtatttctttcttcttctt 324 |||||||||||||||||||| Sbjct: 69149 tgtatttctttcttcttctt 69130
>emb|AL935285.6| Zebrafish DNA sequence from clone DKEY-37A1, complete sequence Length = 230323 Score = 40.1 bits (20), Expect = 6.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 275 actgactcactgacttgctggctggctggctg 306 ||||||| |||||| |||||||||||||||| Sbjct: 14834 actgactggctgactggctggctggctggctg 14865
>emb|AL929275.8| Mouse DNA sequence from clone RP23-65P13 on chromosome 2, complete sequence Length = 197356 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 290 tgctggctggctggctgtatttct 313 |||||||||||||| ||||||||| Sbjct: 174867 tgctggctggctgggtgtatttct 174844
>gb|AC148014.3| Mus musculus BAC clone RP23-118N15 from 19, complete sequence Length = 222061 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 308 atttctttcttcttcttcgt 327 |||||||||||||||||||| Sbjct: 170898 atttctttcttcttcttcgt 170917
>gb|U20162.1|YSCL9931 Saccharomyces cerevisiae chromosome XII cosmid 9931 Length = 28149 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 219 atcaaggtcaacaaataaagaatt 242 ||||||||||||||||| |||||| Sbjct: 22442 atcaaggtcaacaaatatagaatt 22419
>gb|L32025.1|MUSSYNI Mouse synapsin I gene, exon 1 Length = 2120 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 283 actgacttgctggctggctggctg 306 ||||||| |||||||||||||||| Sbjct: 36 actgactggctggctggctggctg 59
>emb|AL671853.7| Mouse DNA sequence from clone RP23-275N2 on chromosome X, complete sequence Length = 200224 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 283 actgacttgctggctggctggctg 306 ||||||| |||||||||||||||| Sbjct: 11014 actgactggctggctggctggctg 10991
>emb|AL671190.10| Mouse DNA sequence from clone RP23-464L12 on chromosome 4, complete sequence Length = 180239 Score = 40.1 bits (20), Expect = 6.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 291 gctggctggctggctgtatttctttctt 318 ||||||||||||||| | |||||||||| Sbjct: 118933 gctggctggctggctttctttctttctt 118906 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 6,878,379 Number of Sequences: 3902068 Number of extensions: 6878379 Number of successful extensions: 164410 Number of sequences better than 10.0: 149 Number of HSP's better than 10.0 without gapping: 148 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 163493 Number of HSP's gapped (non-prelim): 861 length of query: 457 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 435 effective length of database: 17,147,199,772 effective search space: 7459031900820 effective search space used: 7459031900820 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)