ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbastl05d09 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AP003098.2| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-141D23, complete sequence Length = 183853 Score = 46.1 bits (23), Expect = 0.072 Identities = 23/23 (100%) Strand = Plus / Plus Query: 309 atatttcttataggcattatttc 331 ||||||||||||||||||||||| Sbjct: 130074 atatttcttataggcattatttc 130096
>ref|XM_720720.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY00626) partial mRNA Length = 5760 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 294 gaaatttgctctctaatattt 314 ||||||||||||||||||||| Sbjct: 4523 gaaatttgctctctaatattt 4503
>emb|CR522870.1| Desulfotalea psychrophila LSv54 chromosome Length = 3523383 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 307 taatatttcttataggcatta 327 ||||||||||||||||||||| Sbjct: 2560840 taatatttcttataggcatta 2560860
>dbj|AP005205.3| Homo sapiens genomic DNA, chromosome 18 clone:RP11-91I8, complete sequence Length = 134463 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 312 tttcttataggcattatttca 332 ||||||||||||||||||||| Sbjct: 122724 tttcttataggcattatttca 122744
>gb|AC079290.12| Mus musculus chromosome 18, clone RP23-330E13, complete sequence Length = 202255 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 293 ggaaatttgctctctaatat 312 |||||||||||||||||||| Sbjct: 57231 ggaaatttgctctctaatat 57212
>gb|AY340700.1| Simian immunodeficiency virus SIVmus-01CM1085, complete genome Length = 9420 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 102 aatgatactacaactataca 121 |||||||||||||||||||| Sbjct: 8064 aatgatactacaactataca 8083
>ref|XM_652345.1| Entamoeba histolytica HM-1:IMSS BspA-related protein (2.t00034) partial mRNA Length = 3318 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 269 actttgtaatgatgtacaat 288 |||||||||||||||||||| Sbjct: 678 actttgtaatgatgtacaat 659
>gb|AC125480.33| Medicago truncatula clone mth2-8c24, complete sequence Length = 119718 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 278 tgatgtacaattttgggaaa 297 |||||||||||||||||||| Sbjct: 93458 tgatgtacaattttgggaaa 93477
>emb|AL845433.4| Human DNA sequence from clone RP11-674N8 on chromosome X Contains a chromobox homolog 5 (HP1 alpha homolog, Drosophila) (CBX5) pseudogene, the 5' end of the NHS gene for Nance-Horan syndrome (congenital cataracts and dental anomalies) and two CpG islands, complete sequence Length = 200476 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 113 aactatacaaggtcagaaaa 132 |||||||||||||||||||| Sbjct: 70259 aactatacaaggtcagaaaa 70278
>emb|AL445463.8| Human DNA sequence from clone RP11-264H19 on chromosome 10 Contains part of the BTRC gene for beta-transducin repeat containing, complete sequence Length = 143078 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 289 tttgggaaatttgctctcta 308 |||||||||||||||||||| Sbjct: 2372 tttgggaaatttgctctcta 2391
>dbj|BA000032.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromosome 2, complete sequence Length = 1877212 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 286 aattttgggaaatttgctct 305 |||||||||||||||||||| Sbjct: 279136 aattttgggaaatttgctct 279155
>gb|AC151458.27| Medicago truncatula clone mth2-105a19, complete sequence Length = 109617 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 278 tgatgtacaattttgggaaa 297 |||||||||||||||||||| Sbjct: 109073 tgatgtacaattttgggaaa 109054
>emb|BX510325.3| Zebrafish DNA sequence from clone CH211-149A22 in linkage group 19, complete sequence Length = 147275 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 98 attgaatgatactacaacta 117 |||||||||||||||||||| Sbjct: 68105 attgaatgatactacaacta 68124 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,419,896 Number of Sequences: 3902068 Number of extensions: 3419896 Number of successful extensions: 63155 Number of sequences better than 10.0: 13 Number of HSP's better than 10.0 without gapping: 13 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 63118 Number of HSP's gapped (non-prelim): 37 length of query: 338 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 316 effective length of database: 17,147,199,772 effective search space: 5418515127952 effective search space used: 5418515127952 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
