>gb|AC164981.2| Mus musculus BAC clone RP23-121F5 from chromosome 17, complete sequence
          Length = 243701

 Score = 44.1 bits (22), Expect = 0.22
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 98     ccatcaggaaacaggaaaaacaatat 123
              ||||||||||||||||||| ||||||
Sbjct: 167992 ccatcaggaaacaggaaaaccaatat 168017

>gb|AC161258.2| Mus musculus BAC clone RP23-457H24 from chromosome 17, complete
             sequence
          Length = 201842

 Score = 44.1 bits (22), Expect = 0.22
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 93    ttcatccatcaggaaacaggaa 114
             ||||||||||||||||||||||
Sbjct: 18685 ttcatccatcaggaaacaggaa 18664

>gb|AC154796.2| Mus musculus BAC clone RP24-490B17 from chromosome 17, complete
            sequence
          Length = 161075

 Score = 44.1 bits (22), Expect = 0.22
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 93   ttcatccatcaggaaacaggaa 114
            ||||||||||||||||||||||
Sbjct: 3450 ttcatccatcaggaaacaggaa 3471

>gb|AC010715.6| Drosophila melanogaster 3L BAC RP98-9G21 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 174551

 Score = 42.1 bits (21), Expect = 0.86
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 34     aatacatgcatgtatgtataa 54
              |||||||||||||||||||||
Sbjct: 122166 aatacatgcatgtatgtataa 122186

>emb|AL670413.19| Mouse DNA sequence from clone RP23-298E4 on chromosome 4, complete
              sequence
          Length = 243792

 Score = 42.1 bits (21), Expect = 0.86
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 35     atacatgcatgtatgtataag 55
              |||||||||||||||||||||
Sbjct: 106219 atacatgcatgtatgtataag 106199

>gb|AE003563.4| Drosophila melanogaster chromosome 3L, section 22 of 83 of the complete
             sequence
          Length = 264966

 Score = 42.1 bits (21), Expect = 0.86
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 34    aatacatgcatgtatgtataa 54
             |||||||||||||||||||||
Sbjct: 70746 aatacatgcatgtatgtataa 70766

>gb|AC004767.1|AC004767 Drosophila melanogaster DNA sequence (P1s DS01986 (D261), DS01814 (D252),
              and DS08881 (D260)), complete sequence
          Length = 196672

 Score = 42.1 bits (21), Expect = 0.86
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 34     aatacatgcatgtatgtataa 54
              |||||||||||||||||||||
Sbjct: 118388 aatacatgcatgtatgtataa 118368

>emb|AL139287.24| Human DNA sequence from clone RP5-890O3 on chromosome 1 Contains the
             AKIP gene for aurora-A kinase interacting protein, a novel
             gene (FLJ90811) a NADH dehydrogenase (ubiquinone) 1 beta
             subcomplex 4 15kDa (NDUFB4) pseudogene, a novel gene
             (MGC3047), the DVL1 gene for dishevelled dsh homolog 1
             (Drosophila), the TAS1R3 gene for taste receptor type 1
             member 3, a novel gene (MGC10334), a novel gene
             (FLJ20542), a novel gene and five CpG islands, complete
             sequence
          Length = 84445

 Score = 42.1 bits (21), Expect = 0.86
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 96    atccatcaggaaacaggaaaaacaa 120
             |||||||||||||||||||| ||||
Sbjct: 17449 atccatcaggaaacaggaaagacaa 17473

>gb|AC138109.3| Mus musculus BAC clone RP24-444I15 from chromosome 1, complete sequence
          Length = 209820

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 38     catgcatgtatgtataagtt 57
              ||||||||||||||||||||
Sbjct: 122103 catgcatgtatgtataagtt 122084

>gb|AC130539.3| Mus musculus BAC clone RP23-455J15 from chromosome 9, complete
            sequence
          Length = 179156

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gaatacatgcatgtatgtat 52
            ||||||||||||||||||||
Sbjct: 6249 gaatacatgcatgtatgtat 6230

>gb|AC132097.3| Mus musculus BAC clone RP24-395K4 from chromosome 12, complete sequence
          Length = 149176

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    aatacatgcatgtatgtata 53
             ||||||||||||||||||||
Sbjct: 54160 aatacatgcatgtatgtata 54179

>gb|AC135413.43| Medicago truncatula clone mth2-16n19, complete sequence
          Length = 92216

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 100   atcaggaaacaggaaaaaca 119
             ||||||||||||||||||||
Sbjct: 41196 atcaggaaacaggaaaaaca 41215

>emb|AL161626.20| Human DNA sequence from clone RP11-214N16 on chromosome 9 Contains the
             3' end of the GCNT1 gene for glucosaminyl (N-acetyl)
             transferase 1 core 2
             (beta-1,6-N-acetylglucosaminyltransferase), a
             peptidylprolyl isomerase A (cyclophilin A) (PPIA)
             pseudogene and the 3' end of the KIAA0376 gene, complete
             sequence
          Length = 183858

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 51    ataagttttcaccccaaaca 70
             ||||||||||||||||||||
Sbjct: 83449 ataagttttcaccccaaaca 83468

>emb|AL160059.7| Human DNA sequence from clone RP11-94G15 on chromosome 1 Contains the
            5' end of the CACNA1E gene for calcium channel
            voltage-dependent alpha 1E subunit, complete sequence
          Length = 153926

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 103  aggaaacaggaaaaacaata 122
            ||||||||||||||||||||
Sbjct: 5083 aggaaacaggaaaaacaata 5064

>emb|AL606691.4|OSJN00081 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0060N03,
             complete sequence
          Length = 179798

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 12    tgatctttgtttccttctgc 31
             ||||||||||||||||||||
Sbjct: 30591 tgatctttgtttccttctgc 30610

>gb|AC097369.2| Homo sapiens chromosome 3 clone RP11-328N12, complete sequence
          Length = 203773

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 10    cctgatctttgtttccttct 29
             ||||||||||||||||||||
Sbjct: 61453 cctgatctttgtttccttct 61472

>gb|AC175193.2| Sporobolomyces roseus clone JGIBAIF-13I18, complete sequence
          Length = 33112

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 212  agccatctcgtattcgctcg 231
            ||||||||||||||||||||
Sbjct: 9934 agccatctcgtattcgctcg 9915

>dbj|AK143363.1| Mus musculus 2 days pregnant adult female ovary cDNA, RIKEN
            full-length enriched library, clone:E330015O06
            product:hypothetical protein, full insert sequence
          Length = 2644

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 38   catgcatgtatgtataagtt 57
            ||||||||||||||||||||
Sbjct: 1356 catgcatgtatgtataagtt 1375

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 12       tgatctttgtttccttctgc 31
                ||||||||||||||||||||
Sbjct: 30763169 tgatctttgtttccttctgc 30763188

>dbj|AP006878.1| Thermococcus kodakarensis KOD1 DNA, complete genome
          Length = 2088737

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 226    cgctcgacggcttcctgctc 245
              ||||||||||||||||||||
Sbjct: 234804 cgctcgacggcttcctgctc 234785

>emb|BX545907.3| Mouse DNA sequence from clone RP23-300J4 on chromosome X, complete
             sequence
          Length = 49351

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 35    atacatgcatgtatgtataa 54
             ||||||||||||||||||||
Sbjct: 11004 atacatgcatgtatgtataa 11023

>gb|AC133192.3| Mus musculus BAC clone RP23-396C4 from 9, complete sequence
          Length = 197959

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 33    gaatacatgcatgtatgtat 52
             ||||||||||||||||||||
Sbjct: 47877 gaatacatgcatgtatgtat 47896


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,753,136
Number of Sequences: 3902068
Number of extensions: 2753136
Number of successful extensions: 67961
Number of sequences better than 10.0: 22
Number of HSP's better than 10.0 without gapping: 22
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 67889
Number of HSP's gapped (non-prelim): 72
length of query: 262
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 240
effective length of database: 17,147,199,772
effective search space: 4115327945280
effective search space used: 4115327945280
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)