>emb|Z30243.1|SCCLHSP S.cereale (Halo) chloroplast mRNA for heat-shock protein
          Length = 2654

 Score =  145 bits (73), Expect = 2e-32
 Identities = 82/85 (96%)
 Strand = Plus / Minus

                                                                        
Query: 5    ggatgcctacagaactaactaatctctccatgggtcattctcgttctcagtcctgacttc 64
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2465 ggatgcctacagaactaactaatctctccatgggtcattctcgttctcagtcctgacttc 2406

                                     
Query: 65   ggatggctcaacaacctccgttaca 89
            |||||||||||  ||||||| ||||
Sbjct: 2405 ggatggctcaatgacctccggtaca 2381

>gb|AY324231.1| Rana catesbeiana androgen receptor mRNA, complete cds
          Length = 3391

 Score = 38.2 bits (19), Expect = 3.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 31   tccatgggtcattctcgttctca 53
            ||||||||||||||||| |||||
Sbjct: 1700 tccatgggtcattctcggtctca 1678

>emb|AL645764.15| Mouse DNA sequence from clone RP23-290B5 on chromosome 11 Contains the
             5' end of the gene for a novel protein (9330163N21Rik), a
             ribosomal protein S2 (Rps2) pseudogene, the gene for a
             novel protein (E130018012Rik), the gene for a novel
             protein (6820428D13Rik), the Mrpl27 gene for mitochondrial
             ribosomal protein L27, the Xylt2 gene for
             xylosyltransferase II, a novel gene (5330426M11Rik), the
             gene for a novel protein (C230057C09Rik), the gene for a
             novel protein similar to Cdc34 and two pseudogenes similar
             to hypothetical protein Tr:Q8C517, complete sequence
          Length = 203262

 Score = 38.2 bits (19), Expect = 3.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 1     aaagggatgcctacagaactaac 23
             ||||||| |||||||||||||||
Sbjct: 80701 aaagggaagcctacagaactaac 80723


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 524,857
Number of Sequences: 3902068
Number of extensions: 524857
Number of successful extensions: 47430
Number of sequences better than 10.0: 3
Number of HSP's better than 10.0 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 47427
Number of HSP's gapped (non-prelim): 3
length of query: 89
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 68
effective length of database: 17,151,101,840
effective search space: 1166274925120
effective search space used: 1166274925120
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)