>gb|AC147027.4| Pan troglodytes BAC clone RP43-92F2 from 7, complete sequence
          Length = 162023

 Score = 42.1 bits (21), Expect = 0.76
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 110    ttttttaattttatgtacaga 130
              |||||||||||||||||||||
Sbjct: 147857 ttttttaattttatgtacaga 147877

>gb|AC161472.4| Pan troglodytes BAC clone CH251-584L3 from chromosome 7, complete
             sequence
          Length = 189756

 Score = 42.1 bits (21), Expect = 0.76
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 110   ttttttaattttatgtacaga 130
             |||||||||||||||||||||
Sbjct: 53678 ttttttaattttatgtacaga 53698

>gb|AC000056.1| Homo sapiens BAC clone CTB-5F13 from 7, complete sequence
          Length = 84838

 Score = 42.1 bits (21), Expect = 0.76
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 110   ttttttaattttatgtacaga 130
             |||||||||||||||||||||
Sbjct: 10252 ttttttaattttatgtacaga 10272

>gb|AC142291.1| Pan troglodytes BAC clone RP43-184P18 from 7, complete sequence
          Length = 152668

 Score = 42.1 bits (21), Expect = 0.76
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 97    ttatgcacatgggttttttaa 117
             |||||||||||||||||||||
Sbjct: 40034 ttatgcacatgggttttttaa 40054

>gb|AC091485.8| Homo sapiens BAC clone RP11-434N4 from 2, complete sequence
          Length = 112063

 Score = 42.1 bits (21), Expect = 0.76
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 110   ttttttaattttatgtacaga 130
             |||||||||||||||||||||
Sbjct: 22705 ttttttaattttatgtacaga 22725

>emb|AL607088.26| Mouse DNA sequence from clone RP23-13A13 on chromosome 4, complete
             sequence
          Length = 103925

 Score = 42.1 bits (21), Expect = 0.76
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 194   cttgtgattgggcaggatcca 214
             |||||||||||||||||||||
Sbjct: 39000 cttgtgattgggcaggatcca 39020

>emb|CT025527.7| Mouse DNA sequence from clone RP23-279J20 on chromosome 16, complete
             sequence
          Length = 202976

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 190   agtccttgtgattgggcaggatcc 213
             |||||| |||||||||||||||||
Sbjct: 95486 agtcctggtgattgggcaggatcc 95509

>emb|AL845509.6| Human DNA sequence from clone DAQB-282H15 on chromosome 6 Contains the
             5' end of the Notch4 gene for Notch homolog 4
             (Drosophila), the 3' end of the C6orf10 gene for
             chromosome 6 open reading frame 10 and one CpG island,
             complete sequence
          Length = 126404

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 110   ttttttaattttatgtacagagaa 133
             |||| |||||||||||||||||||
Sbjct: 99413 ttttataattttatgtacagagaa 99390

>emb|BX284927.5| Human DNA sequence from clone DASS-105C4 on chromosome 6, complete
             sequence
          Length = 108760

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 110   ttttttaattttatgtacagagaa 133
             |||| |||||||||||||||||||
Sbjct: 85725 ttttataattttatgtacagagaa 85702

>emb|AL845557.1| Human DNA sequence from clone XXbac-556A18 on chromosome 6 contains the
             gene for chromosome 6 open reading frame 10 and a
             heterogeneous nuclear ribonucleoprotein A1 (HNRPA1)
             pseudogene, complete sequence
          Length = 49278

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 110   ttttttaattttatgtacagagaa 133
             |||| |||||||||||||||||||
Sbjct: 16614 ttttataattttatgtacagagaa 16591

>emb|AL671511.4| Human DNA sequence from clone XXbac-154L12 on chromosome 6 contains the
             3' end of the C6ORF10 gene for chromosome 6 open reading
             frame 10 and a heterogeneous nuclear ribonucleoprotein A1
             (HNRPA1) pseudogene, complete sequence
          Length = 87294

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 110   ttttttaattttatgtacagagaa 133
             |||| |||||||||||||||||||
Sbjct: 54867 ttttataattttatgtacagagaa 54844

>emb|AL161613.23| Human DNA sequence from clone RP11-22J15 on chromosome 13 Contains the
             5' end of the LATS2 gene for LATS, large tumor suppressor,
             homolog 2 (LATS (large tumor suppressor, Drosophila)
             homolog 2), a ribosomal protein S12 (40S ribosomal protein
             S12) (RPS12) pseudogene, a chromosome 9 open reading frame
             12 (C9orf12) (INSP5K2, FLJ13161)pseudogene and two CpG
             islands, complete sequence
          Length = 113372

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   acatgggttttttaatttta 122
             ||||||||||||||||||||
Sbjct: 38500 acatgggttttttaatttta 38481

>emb|AL035445.4|HS372B18 Human DNA sequence from clone RP3-372B18 on chromosome 6p21.2-22.1
             Contains an HNRPA1 (Heterogenous Nuclear Ribonucleoprotein
             A1 (Helix Destabilizing protein, HDP, HNRNP core protein
             A1)) pseudogene and the 3' end of the C6orf10 gene for
             TSBP (Testis Specific Basic Protein). Contains ESTs and
             GSSs, complete sequence
          Length = 38216

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 110   ttttttaattttatgtacagagaa 133
             |||| |||||||||||||||||||
Sbjct: 34218 ttttataattttatgtacagagaa 34241

>emb|BX927180.8| Human DNA sequence from clone DAMA-391O5 on chromosome 6, complete
             sequence
          Length = 69474

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 110   ttttttaattttatgtacagagaa 133
             |||| |||||||||||||||||||
Sbjct: 38680 ttttataattttatgtacagagaa 38703

>emb|CR759737.4| Human DNA sequence from clone DADB-285H20 on chromosome 6, complete
             sequence
          Length = 83525

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 110   ttttttaattttatgtacagagaa 133
             |||| |||||||||||||||||||
Sbjct: 59923 ttttataattttatgtacagagaa 59900

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 99       atgcacatgggttttttaat 118
                ||||||||||||||||||||
Sbjct: 11161734 atgcacatgggttttttaat 11161753

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 169      tggtactggaatttgttggt 188
                ||||||||||||||||||||
Sbjct: 31942663 tggtactggaatttgttggt 31942682

>dbj|AP003409.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
              clone:B1131G08
          Length = 158241

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 169    tggtactggaatttgttggt 188
              ||||||||||||||||||||
Sbjct: 128741 tggtactggaatttgttggt 128760

>gb|AC154631.2| Mus musculus BAC clone RP23-264F8 from 16, complete sequence
          Length = 201820

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 190 agtccttgtgattgggcaggatcc 213
           |||||| |||||||||||||||||
Sbjct: 890 agtcctggtgattgggcaggatcc 867

>emb|CT009591.8| Human DNA sequence from clone DAAP-263O12 on chromosome 6, complete
             sequence
          Length = 80114

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 110   ttttttaattttatgtacagagaa 133
             |||| |||||||||||||||||||
Sbjct: 60738 ttttataattttatgtacagagaa 60715

>emb|AL731637.2|OSJN00278 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0115I09,
             complete sequence
          Length = 141580

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 99    atgcacatgggttttttaat 118
             ||||||||||||||||||||
Sbjct: 30358 atgcacatgggttttttaat 30377

>dbj|AB011968.1| Oryza sativa OsPK7 gene, complete cds
          Length = 5816

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 169  tggtactggaatttgttggt 188
            ||||||||||||||||||||
Sbjct: 1269 tggtactggaatttgttggt 1250

>dbj|AP003256.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0460E08
          Length = 170021

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 169   tggtactggaatttgttggt 188
             ||||||||||||||||||||
Sbjct: 39390 tggtactggaatttgttggt 39409


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,602,115
Number of Sequences: 3902068
Number of extensions: 2602115
Number of successful extensions: 57545
Number of sequences better than 10.0: 23
Number of HSP's better than 10.0 without gapping: 23
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 57489
Number of HSP's gapped (non-prelim): 56
length of query: 233
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 211
effective length of database: 17,147,199,772
effective search space: 3618059151892
effective search space used: 3618059151892
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)