Clone Name | rbastl04e12 |
---|---|
Clone Library Name | barley_pub |
>emb|CT009519.4| Mouse DNA sequence from clone RP23-145L1 on chromosome 14, complete sequence Length = 216678 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 213 tgatgaaccaccatttttacc 233 ||||||||||||||||||||| Sbjct: 96669 tgatgaaccaccatttttacc 96649
>dbj|AP007159.1| Aspergillus oryzae RIB40 genomic DNA, SC026 Length = 2324132 Score = 42.1 bits (21), Expect = 1.1 Identities = 24/25 (96%) Strand = Plus / Minus Query: 72 ctggcaagagatatattcctttgaa 96 |||||||||||| |||||||||||| Sbjct: 1511287 ctggcaagagatgtattcctttgaa 1511263
>gb|AC093353.11| Mus musculus chromosome 10, clone RP23-19C22, complete sequence Length = 188921 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 14 gtgaagtcacaatacaatct 33 |||||||||||||||||||| Sbjct: 81116 gtgaagtcacaatacaatct 81097
>gb|AC124585.3| Mus musculus BAC clone RP23-130P17 from chromosome 10, complete sequence Length = 198030 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 14 gtgaagtcacaatacaatct 33 |||||||||||||||||||| Sbjct: 193926 gtgaagtcacaatacaatct 193907
>gb|AC013483.7|ATAC013483 Arabidopsis thaliana chromosome III BAC F17A17 genomic sequence, complete sequence Length = 121054 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 144 aatacaatctaacaaactca 163 |||||||||||||||||||| Sbjct: 55138 aatacaatctaacaaactca 55119
>emb|AL450427.11| Human DNA sequence from clone RP11-372H19 on chromosome 6, complete sequence Length = 68843 Score = 40.1 bits (20), Expect = 4.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 71 tctggcaagagatatattcctttg 94 ||||||| |||||||||||||||| Sbjct: 26060 tctggcaggagatatattcctttg 26083
>gb|AC007849.24| Homo sapiens 3 BAC RP11-3K16 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 199835 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 90 ctttgaattgtctttgtggc 109 |||||||||||||||||||| Sbjct: 59910 ctttgaattgtctttgtggc 59929
>gb|AC117792.6| Mus musculus chromosome 8, clone RP24-549A13, complete sequence Length = 174210 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 230 tacctgggcagttctaccat 249 |||||||||||||||||||| Sbjct: 100742 tacctgggcagttctaccat 100761
>dbj|AB016876.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MKM21 Length = 44499 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 140 tgacaatacaatctaacaaa 159 |||||||||||||||||||| Sbjct: 42295 tgacaatacaatctaacaaa 42314
>gb|CP000009.1| Gluconobacter oxydans 621H, complete genome Length = 2702173 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 210 ccctgatgaaccaccatttt 229 |||||||||||||||||||| Sbjct: 1799036 ccctgatgaaccaccatttt 1799017 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,714,606 Number of Sequences: 3902068 Number of extensions: 2714606 Number of successful extensions: 46855 Number of sequences better than 10.0: 10 Number of HSP's better than 10.0 without gapping: 10 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 46828 Number of HSP's gapped (non-prelim): 27 length of query: 342 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 320 effective length of database: 17,147,199,772 effective search space: 5487103927040 effective search space used: 5487103927040 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)