>ref|XM_467482.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 4672

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                        
Query: 307  tttctatgccttctgcttcgacttctgcttcttcagctccaatgacgcacctaatcctac 366
            |||||||| ||||||||| || ||||||||||||| |||||| || |  |||||||||||
Sbjct: 4408 tttctatgacttctgctttgatttctgcttcttcaactccaaggaagtccctaatcctac 4349

               
Query: 367  tgg 369
            |||
Sbjct: 4348 tgg 4346

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 55/63 (87%)
 Strand = Plus / Plus

                                                                            
Query: 307      tttctatgccttctgcttcgacttctgcttcttcagctccaatgacgcacctaatcctac 366
                |||||||| ||||||||| || ||||||||||||| |||||| || |  |||||||||||
Sbjct: 29782379 tttctatgacttctgctttgatttctgcttcttcaactccaaggaagtccctaatcctac 29782438

                   
Query: 367      tgg 369
                |||
Sbjct: 29782439 tgg 29782441

>dbj|AP004098.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ2056_H01
          Length = 123428

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 55/63 (87%)
 Strand = Plus / Plus

                                                                         
Query: 307   tttctatgccttctgcttcgacttctgcttcttcagctccaatgacgcacctaatcctac 366
             |||||||| ||||||||| || ||||||||||||| |||||| || |  |||||||||||
Sbjct: 38724 tttctatgacttctgctttgatttctgcttcttcaactccaaggaagtccctaatcctac 38783

                
Query: 367   tgg 369
             |||
Sbjct: 38784 tgg 38786

>dbj|AP004047.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OJ1191_G08
          Length = 172832

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 55/63 (87%)
 Strand = Plus / Plus

                                                                          
Query: 307    tttctatgccttctgcttcgacttctgcttcttcagctccaatgacgcacctaatcctac 366
              |||||||| ||||||||| || ||||||||||||| |||||| || |  |||||||||||
Sbjct: 151358 tttctatgacttctgctttgatttctgcttcttcaactccaaggaagtccctaatcctac 151417

                 
Query: 367    tgg 369
              |||
Sbjct: 151418 tgg 151420

>dbj|AK121612.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033043J17, full
            insert sequence
          Length = 4673

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                        
Query: 307  tttctatgccttctgcttcgacttctgcttcttcagctccaatgacgcacctaatcctac 366
            |||||||| ||||||||| || ||||||||||||| |||||| || |  |||||||||||
Sbjct: 4409 tttctatgacttctgctttgatttctgcttcttcaactccaaggaagtccctaatcctac 4350

               
Query: 367  tgg 369
            |||
Sbjct: 4349 tgg 4347

>ref|XM_719537.1| Plasmodium yoelii yoelii str. 17XNL splicing factor 1 (PY04347)
           partial mRNA
          Length = 930

 Score = 46.1 bits (23), Expect = 0.085
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 316 cttctgcttcgacttctgcttct 338
           |||||||||||||||||||||||
Sbjct: 707 cttctgcttcgacttctgcttct 685

>gb|U40412.1| Caenorhabditis elegans cosmid F46G11, complete sequence
          Length = 21731

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 156 tattatttttattgcactcattctac 181
           ||||||||||| ||||||||||||||
Sbjct: 549 tattatttttaatgcactcattctac 574

>gb|CP000016.1| Candidatus Blochmannia pennsylvanicus str. BPEN, complete genome
          Length = 791654

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 35     aaacaaattggtgtagccagtttaca 60
              |||||||||||||||| |||||||||
Sbjct: 430558 aaacaaattggtgtagtcagtttaca 430583

>gb|AC160248.6| Pan troglodytes BAC clone CH251-541A22 from chromosome unknown, complete
              sequence
          Length = 182426

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 300    aaattcatttctatgccttct 320
              |||||||||||||||||||||
Sbjct: 154173 aaattcatttctatgccttct 154193

>gb|AC124450.3| Mus musculus BAC clone RP24-215C4 from chromosome 13, complete sequence
          Length = 157531

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 184   acccccaccccaccacaaataaaat 208
             |||||||||||||| ||||||||||
Sbjct: 75543 acccccaccccaccccaaataaaat 75519

>gb|AC008883.6| Homo sapiens chromosome 5 clone CTD-2215E18, complete sequence
          Length = 127144

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 300   aaattcatttctatgccttct 320
             |||||||||||||||||||||
Sbjct: 24397 aaattcatttctatgccttct 24377

>gb|AC009232.3| Homo sapiens BAC clone RP11-352J11 from 2, complete sequence
          Length = 139885

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 282    ggagaaaacagccattgcaaa 302
              |||||||||||||||||||||
Sbjct: 136563 ggagaaaacagccattgcaaa 136583

>emb|AL805937.11| Mouse DNA sequence from clone RP23-139B4 on chromosome X, complete
              sequence
          Length = 178671

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 316    cttctgcttcgacttctgcttcttc 340
              |||||||||| ||||||||||||||
Sbjct: 110719 cttctgcttctacttctgcttcttc 110695

>gb|AC183673.2| Pan troglodytes BAC clone CH251-540O10 from chromosome 1, complete
              sequence
          Length = 185717

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 294    cattgcaaattcatttctat 313
              ||||||||||||||||||||
Sbjct: 132269 cattgcaaattcatttctat 132250

>gb|M98552.2| Caenorhabditis elegans cosmid ZK370, complete sequence
          Length = 38725

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 327   acttctgcttcttcagctcc 346
             ||||||||||||||||||||
Sbjct: 26479 acttctgcttcttcagctcc 26498

>gb|AC073958.4| Homo sapiens BAC clone RP11-533L22 from 7, complete sequence
          Length = 168991

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 151   gttgctattatttttattgc 170
             ||||||||||||||||||||
Sbjct: 57850 gttgctattatttttattgc 57869

>gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome
          Length = 3059876

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 319    ctgcttcgacttctgcttcttcag 342
              ||||||||||||||||||| ||||
Sbjct: 157575 ctgcttcgacttctgcttcgtcag 157598

>emb|AL627143.13| Human DNA sequence from clone RP11-14O9 on chromosome X Contains the 3'
             end of the RP2 gene for retinitis pigmentosa 2 (X-linked
             recessive), a novel gene, the 5' end of a novel gene
             (KIAA0215) and a CpG island, complete sequence
          Length = 81195

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 151   gttgctattatttttattgc 170
             ||||||||||||||||||||
Sbjct: 19804 gttgctattatttttattgc 19785

>emb|AL139188.14| Human DNA sequence from clone RP11-90M5 on chromosome 13q12.11-12.3
              Contains 2 novel genes, a translocase of inner
              mitochondrial membrane 8 (yeast) homolog B (TIMM8B)
              pseudogene, the 5' end of the UBL3 gene for ubiquitin-like
              3 and a CpG island, complete sequence
          Length = 161538

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 301    aattcatttctatgccttct 320
              ||||||||||||||||||||
Sbjct: 126376 aattcatttctatgccttct 126395

>emb|AL137789.11| Human DNA sequence from clone RP11-57I17 on chromosome 1q32.1-32.3
             Contains the 3' end of the CR1 gene for complement
             component (3b/4b) receptor 1, including Knops blood group
             system, a membrane cofactor protein (CD46,
             trophoblast-lymphocyte cross-reactive antigen) (MCP)
             pseudogene and the 5' end of the CR1L gene for complement
             component (3b/4b) receptor 1-like, complete sequence
          Length = 145325

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 294   cattgcaaattcatttctat 313
             ||||||||||||||||||||
Sbjct: 60309 cattgcaaattcatttctat 60290

>emb|AL590445.1|CNS07EGC chromosome V of strain GB-M1 of Encephalitozoon cuniculi (Microspora)
          Length = 211018

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 139   caccccattctcgttgctat 158
             ||||||||||||||||||||
Sbjct: 20081 caccccattctcgttgctat 20062

>gb|AC016644.9| Homo sapiens chromosome 5 clone RP11-52M14, complete sequence
          Length = 157751

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 262   ctagaggttcaaaattgcaa 281
             ||||||||||||||||||||
Sbjct: 41334 ctagaggttcaaaattgcaa 41315

>gb|AC008937.7| Homo sapiens chromosome 5 clone CTD-2310F14, complete sequence
          Length = 171480

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 262 ctagaggttcaaaattgcaa 281
           ||||||||||||||||||||
Sbjct: 277 ctagaggttcaaaattgcaa 258

>gb|AC161621.5| Pan troglodytes BAC clone CH251-164P18 from chromosome unknown, complete
              sequence
          Length = 172032

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 262    ctagaggttcaaaattgcaa 281
              ||||||||||||||||||||
Sbjct: 121151 ctagaggttcaaaattgcaa 121132

>gb|AC010364.6| Homo sapiens chromosome 5 clone CTD-2042D5, complete sequence
          Length = 163400

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 294  cattgcaaattcatttctat 313
            ||||||||||||||||||||
Sbjct: 4638 cattgcaaattcatttctat 4619

>gb|AC007822.4|AC007822 Drosophila melanogaster, chromosome 3R, region 86C-86C, BAC clone
             BACR02E04, complete sequence
          Length = 157607

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 319   ctgcttcgacttctgcttcttcagctcc 346
             |||| ||| |||||||||||||||||||
Sbjct: 35376 ctgcatcggcttctgcttcttcagctcc 35349

>gb|AC007770.5|AC007770 Drosophila melanogaster, chromosome 3R, region 86C-86C, BAC clone
              BACR03J13, complete sequence
          Length = 179260

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 319    ctgcttcgacttctgcttcttcagctcc 346
              |||| ||| |||||||||||||||||||
Sbjct: 163160 ctgcatcggcttctgcttcttcagctcc 163133

>gb|AC008235.4|AC008235 Drosophila melanogaster, chromosome 3R, region 94F-95A, BAC clone
             BACR15B19, complete sequence
          Length = 175669

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 296   ttgcaaattcatttctatgc 315
             ||||||||||||||||||||
Sbjct: 65130 ttgcaaattcatttctatgc 65111

>gb|AC009507.3| Homo sapiens BAC clone RP11-543L11 from 2, complete sequence
          Length = 122213

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 185   cccccaccccaccacaaata 204
             ||||||||||||||||||||
Sbjct: 26226 cccccaccccaccacaaata 26207

>gb|AC010450.6|AC010450 Homo sapiens chromosome 5 clone CTD-2242D16, complete sequence
          Length = 108916

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 294   cattgcaaattcatttctat 313
             ||||||||||||||||||||
Sbjct: 67858 cattgcaaattcatttctat 67839

>gb|AC092623.2| Homo sapiens BAC clone RP11-260E12 from 2, complete sequence
          Length = 172344

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 183   aacccccaccccaccacaaa 202
             ||||||||||||||||||||
Sbjct: 16323 aacccccaccccaccacaaa 16304

>gb|AY103753.1| Zea mays PCO143558 mRNA sequence
          Length = 2771

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                        
Query: 307  tttctatgccttctgcttcgacttctgcttcttcagctccaatg 350
            |||||| | ||| ||||| || ||||||||||||| ||||||||
Sbjct: 2436 tttctacgacttttgctttgatttctgcttcttcaactccaatg 2393

>gb|AE003743.3| Drosophila melanogaster chromosome 3R, section 81 of 118 of the
             complete sequence
          Length = 210258

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 296   ttgcaaattcatttctatgc 315
             ||||||||||||||||||||
Sbjct: 73436 ttgcaaattcatttctatgc 73417

>gb|AE003687.3| Drosophila melanogaster chromosome 3R, section 25 of 118 of the complete
              sequence
          Length = 260168

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 319    ctgcttcgacttctgcttcttcagctcc 346
              |||| ||| |||||||||||||||||||
Sbjct: 216336 ctgcatcggcttctgcttcttcagctcc 216309

>gb|AC006406.1|AC006406 Homo sapiens, clone hRPK.25_A_1, complete sequence
          Length = 159115

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 294    cattgcaaattcatttctat 313
              ||||||||||||||||||||
Sbjct: 158193 cattgcaaattcatttctat 158212

>gb|AC163725.4| Pan troglodytes BAC clone CH251-612A20 from chromosome unknown,
            complete sequence
          Length = 179999

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 262  ctagaggttcaaaattgcaa 281
            ||||||||||||||||||||
Sbjct: 4802 ctagaggttcaaaattgcaa 4783

>emb|AL671891.12| Mouse DNA sequence from clone RP23-405E21 on chromosome X, complete
              sequence
          Length = 195749

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 161    tttttattgcactcattcta 180
              ||||||||||||||||||||
Sbjct: 188535 tttttattgcactcattcta 188516


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,271,963
Number of Sequences: 3902068
Number of extensions: 5271963
Number of successful extensions: 124625
Number of sequences better than 10.0: 37
Number of HSP's better than 10.0 without gapping: 37
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 124501
Number of HSP's gapped (non-prelim): 124
length of query: 393
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 371
effective length of database: 17,147,199,772
effective search space: 6361611115412
effective search space used: 6361611115412
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)