ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl04c05
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|AL355984.11| Human DNA sequence from clone RP11-501K3 on chr... 46 0.055
2emb|CR382398.1| Plasmodium falciparum chromosome 6, complete seq... 46 0.055
3gb|AC114589.30| Mus musculus chromosome 8, clone RP23-365O13, co... 44 0.22
4gb|AC112898.5| Rattus norvegicus 2 BAC CH230-157M2 (Children's H... 42 0.86
5gb|AC161355.3| Mus musculus chromosome 1, clone RP24-149A24, com... 42 0.86
6gb|AY318871.1| Canarypox virus strain ATCC VR-111, complete genome 42 0.86
7gb|AC125161.3| Mus musculus BAC clone RP24-410I2 from chromosome... 42 0.86
8emb|CR847496.7| Zebrafish DNA sequence from clone CH211-203D1 in... 42 0.86
9gb|AC114553.6| Mus musculus chromosome 5, clone RP23-408M16, com... 42 0.86
10gb|AC163496.4| Mus musculus chromosome 1, clone RP24-325M15, com... 42 0.86
11emb|AL713998.7| Human DNA sequence from clone RP11-301G19 on chr... 42 0.86
12gb|AC158753.8| Mus musculus chromosome 5, clone RP23-301E24, com... 42 0.86
13gb|AC023904.10| Homo sapiens chromosome 10 clone RP11-369L1, com... 42 0.86
14gb|AC131005.3| Homo sapiens 3 BAC RP11-88K11 (Roswell Park Cance... 42 0.86
15emb|AL954143.9| Zebrafish DNA sequence from clone CH211-206A7 in... 42 0.86
16emb|CR759813.6| Zebrafish DNA sequence from clone DKEY-150H10 in... 42 0.86
17ref|NM_012674.1| Rattus norvegicus serine protease inhibitor, Ka... 40 3.4
18gb|AC150162.1| Solanum demissum chromosome 5 clone PGEC160O2 map... 40 3.4
19gb|AC009394.5| Drosophila melanogaster clone BACR03J17, complete... 40 3.4
20gb|AC009462.7| Drosophila melanogaster clone BACR27G04, complete... 40 3.4
21gb|AC138330.4| Mus musculus BAC clone RP23-19L20 from chromosome... 40 3.4
22gb|AC132270.3| Mus musculus BAC clone RP24-338C23 from chromosom... 40 3.4
23gb|AC123840.4| Mus musculus BAC clone RP23-399K5 from chromosome... 40 3.4
24gb|AC122016.4| Mus musculus BAC clone RP24-359J23 from chromosom... 40 3.4
25gb|AC157800.9| Mus musculus chromosome 1, clone RP24-286C21, com... 40 3.4
26gb|AC069504.7| Homo sapiens 3 BAC RP11-263A24 (Roswell Park Canc... 40 3.4
27gb|AC090671.5| Homo sapiens 12 BAC RP11-755O11 (Roswell Park Can... 40 3.4
28emb|CR382137.1| Debaryomyces hansenii chromosome E of strain CBS... 40 3.4
29gb|AC090506.7| Homo sapiens chromosome 18, clone RP11-675P14, co... 40 3.4
30emb|AL805942.5| Mouse DNA sequence from clone RP24-71G5 on chrom... 40 3.4
31gb|AY040765.1| Mus musculus histidine triad protein 3 gene, comp... 40 3.4
32gb|AY998454.1| Solanum pectinatum voucher Peeke 8512 IND tRNA-Se... 40 3.4
33gb|AC009709.7|AC009709 Homo sapiens chromosome 18, clone RP11-31... 40 3.4
34gb|AC018878.8| Homo sapiens BAC clone RP11-297N12 from 2, comple... 40 3.4
35gb|AC007274.3|AC007274 Homo sapiens BAC clone RP11-105L10 from Y... 40 3.4
36gb|AC006195.1|AC006195 Homo sapiens clone RP11-350H1 from 7p14-1... 40 3.4
37dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome 40 3.4
38gb|AC007911.8|AC007911 Homo sapiens chromosome 18, clone RP11-52... 40 3.4
39gb|AE003721.3| Drosophila melanogaster chromosome 3R, section 59... 40 3.4
40emb|AL732626.8| Mouse DNA sequence from clone RP23-191F22 on chr... 40 3.4
41gb|M35299.1|RATPSTIAA Rat pancreatic secretory trypsin inhibitor... 40 3.4 
>emb|AL355984.11| Human DNA sequence from clone RP11-501K3 on chromosome 13 Contains the
             GJB6 gene for gap junction protein, beta 6 (connexin 30)
             and 2 CpG islands, complete sequence
          Length = 160536

 Score = 46.1 bits (23), Expect = 0.055
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 123   aaaatatatgaaataggtacagaaaag 149
             ||||||||||||||| |||||||||||
Sbjct: 74740 aaaatatatgaaatatgtacagaaaag 74714
to top
>emb|CR382398.1| Plasmodium falciparum chromosome 6, complete sequence; segment 1/5
          Length = 349418

 Score = 46.1 bits (23), Expect = 0.055
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 117    ataataaaaatatatgaaatagg 139
              |||||||||||||||||||||||
Sbjct: 197399 ataataaaaatatatgaaatagg 197421
to top
>gb|AC114589.30| Mus musculus chromosome 8, clone RP23-365O13, complete sequence
          Length = 213866

 Score = 44.1 bits (22), Expect = 0.22
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 33     atccagaaactgcaaacaaagt 54
              ||||||||||||||||||||||
Sbjct: 143066 atccagaaactgcaaacaaagt 143045
to top
>gb|AC112898.5| Rattus norvegicus 2 BAC CH230-157M2 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 213379

 Score = 42.1 bits (21), Expect = 0.86
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 31     atatccagaaactgcaaacaaagta 55
              |||||||||||||| ||||||||||
Sbjct: 175783 atatccagaaactggaaacaaagta 175759
to top
>gb|AC161355.3| Mus musculus chromosome 1, clone RP24-149A24, complete sequence
          Length = 179242

 Score = 42.1 bits (21), Expect = 0.86
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 31    atatccagaaactgcaaacaa 51
             |||||||||||||||||||||
Sbjct: 52179 atatccagaaactgcaaacaa 52159
to top
>gb|AY318871.1| Canarypox virus strain ATCC VR-111, complete genome
          Length = 359853

 Score = 42.1 bits (21), Expect = 0.86
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 118   taataaaaatatatgaaataggtacagaa 146
             |||||||| || |||||||||||||||||
Sbjct: 28886 taataaaagtagatgaaataggtacagaa 28858
to top
>gb|AC125161.3| Mus musculus BAC clone RP24-410I2 from chromosome 1, complete sequence
          Length = 142794

 Score = 42.1 bits (21), Expect = 0.86
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 31    atatccagaaactgcaaacaa 51
             |||||||||||||||||||||
Sbjct: 64065 atatccagaaactgcaaacaa 64085
to top
>emb|CR847496.7| Zebrafish DNA sequence from clone CH211-203D1 in linkage group 14,
             complete sequence
          Length = 157741

 Score = 42.1 bits (21), Expect = 0.86
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 117   ataataaaaatatatgaaata 137
             |||||||||||||||||||||
Sbjct: 81427 ataataaaaatatatgaaata 81447
to top
>gb|AC114553.6| Mus musculus chromosome 5, clone RP23-408M16, complete sequence
          Length = 198281

 Score = 42.1 bits (21), Expect = 0.86
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                               
Query: 106    gcttctacaggataataaaaatatatgaaatag 138
              ||||||||||||||||||||  | |||||||||
Sbjct: 181059 gcttctacaggataataaaataaaatgaaatag 181027
to top
>gb|AC163496.4| Mus musculus chromosome 1, clone RP24-325M15, complete sequence
          Length = 165387

 Score = 42.1 bits (21), Expect = 0.86
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 31    atatccagaaactgcaaacaa 51
             |||||||||||||||||||||
Sbjct: 25417 atatccagaaactgcaaacaa 25437
to top
>emb|AL713998.7| Human DNA sequence from clone RP11-301G19 on chromosome 6, complete
             sequence
          Length = 184887

 Score = 42.1 bits (21), Expect = 0.86
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 110   ctacaggataataaaaatata 130
             |||||||||||||||||||||
Sbjct: 88035 ctacaggataataaaaatata 88015
to top
>gb|AC158753.8| Mus musculus chromosome 5, clone RP23-301E24, complete sequence
          Length = 190368

 Score = 42.1 bits (21), Expect = 0.86
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                              
Query: 106   gcttctacaggataataaaaatatatgaaatag 138
             ||||||||||||||||||||  | |||||||||
Sbjct: 18421 gcttctacaggataataaaataaaatgaaatag 18389
to top
>gb|AC023904.10| Homo sapiens chromosome 10 clone RP11-369L1, complete sequence
          Length = 190712

 Score = 42.1 bits (21), Expect = 0.86
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 117    ataataaaaatatatgaaata 137
              |||||||||||||||||||||
Sbjct: 107659 ataataaaaatatatgaaata 107679
to top
>gb|AC131005.3| Homo sapiens 3 BAC RP11-88K11 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 191231

 Score = 42.1 bits (21), Expect = 0.86
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 104    ttgcttctacaggataataaaaatatatg 132
              ||||||||||| || ||||||||||||||
Sbjct: 109828 ttgcttctacatgagaataaaaatatatg 109800
to top
>emb|AL954143.9| Zebrafish DNA sequence from clone CH211-206A7 in linkage group 19,
             complete sequence
          Length = 168515

 Score = 42.1 bits (21), Expect = 0.86
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 117   ataataaaaatatatgaaata 137
             |||||||||||||||||||||
Sbjct: 66230 ataataaaaatatatgaaata 66250
to top
>emb|CR759813.6| Zebrafish DNA sequence from clone DKEY-150H10 in linkage group 18,
             complete sequence
          Length = 152902

 Score = 42.1 bits (21), Expect = 0.86
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 117   ataataaaaatatatgaaata 137
             |||||||||||||||||||||
Sbjct: 47337 ataataaaaatatatgaaata 47317
to top
>ref|NM_012674.1| Rattus norvegicus serine protease inhibitor, Kazal type 1 (Spink1),
            mRNA
          Length = 2338

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 117  ataataaaaatatatgaaat 136
            ||||||||||||||||||||
Sbjct: 2301 ataataaaaatatatgaaat 2320
to top
>gb|AC150162.1| Solanum demissum chromosome 5 clone PGEC160O2 map MAP_LOC, complete
             sequence
          Length = 125813

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 118   taataaaaatatatgaaata 137
             ||||||||||||||||||||
Sbjct: 65736 taataaaaatatatgaaata 65717
to top
>gb|AC009394.5| Drosophila melanogaster clone BACR03J17, complete sequence
          Length = 199043

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 120   ataaaaatatatgaaatagg 139
             ||||||||||||||||||||
Sbjct: 26393 ataaaaatatatgaaatagg 26412
to top
>gb|AC009462.7| Drosophila melanogaster clone BACR27G04, complete sequence
          Length = 151609

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 120    ataaaaatatatgaaatagg 139
              ||||||||||||||||||||
Sbjct: 106463 ataaaaatatatgaaatagg 106482
to top
>gb|AC138330.4| Mus musculus BAC clone RP23-19L20 from chromosome 13, complete sequence
          Length = 190901

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 116    gataataaaaatatatgaaa 135
              ||||||||||||||||||||
Sbjct: 173690 gataataaaaatatatgaaa 173671
to top
>gb|AC132270.3| Mus musculus BAC clone RP24-338C23 from chromosome 5, complete sequence
          Length = 145471

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 117   ataataaaaatatatgaaat 136
             ||||||||||||||||||||
Sbjct: 15740 ataataaaaatatatgaaat 15721
to top
>gb|AC123840.4| Mus musculus BAC clone RP23-399K5 from chromosome 13, complete sequence
          Length = 191185

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 116   gataataaaaatatatgaaa 135
             ||||||||||||||||||||
Sbjct: 30797 gataataaaaatatatgaaa 30778
to top
>gb|AC122016.4| Mus musculus BAC clone RP24-359J23 from chromosome 16, complete
             sequence
          Length = 163943

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 112   acaggataataaaaatatat 131
             ||||||||||||||||||||
Sbjct: 88449 acaggataataaaaatatat 88430
to top
>gb|AC157800.9| Mus musculus chromosome 1, clone RP24-286C21, complete sequence
          Length = 164708

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 117   ataataaaaatatatgaaat 136
             ||||||||||||||||||||
Sbjct: 29776 ataataaaaatatatgaaat 29795
to top
>gb|AC069504.7| Homo sapiens 3 BAC RP11-263A24 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 39624

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 120   ataaaaatatatgaaatagg 139
             ||||||||||||||||||||
Sbjct: 30433 ataaaaatatatgaaatagg 30452
to top
>gb|AC090671.5| Homo sapiens 12 BAC RP11-755O11 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 186298

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 122   aaaaatatatgaaataggta 141
             ||||||||||||||||||||
Sbjct: 16813 aaaaatatatgaaataggta 16832
to top
>emb|CR382137.1| Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces
               hansenii
          Length = 2037969

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 118     taataaaaatatatgaaata 137
               ||||||||||||||||||||
Sbjct: 1475497 taataaaaatatatgaaata 1475478
to top
>gb|AC090506.7| Homo sapiens chromosome 18, clone RP11-675P14, complete sequence
          Length = 188609

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 106   gcttctacaggataataaaaatat 129
             ||||||||||||||||| ||||||
Sbjct: 82368 gcttctacaggataatacaaatat 82345
to top
>emb|AL805942.5| Mouse DNA sequence from clone RP24-71G5 on chromosome 2, complete
             sequence
          Length = 81209

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 118   taataaaaatatatgaaata 137
             ||||||||||||||||||||
Sbjct: 79111 taataaaaatatatgaaata 79130
to top
>gb|AY040765.1| Mus musculus histidine triad protein 3 gene, complete cds
          Length = 2916

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 120  ataaaaatatatgaaatagg 139
            ||||||||||||||||||||
Sbjct: 2901 ataaaaatatatgaaatagg 2882
to top
>gb|AY998454.1| Solanum pectinatum voucher Peeke 8512 IND tRNA-Ser (trnS) gene,
           partial sequence; trnS-trnG intergenic spacer, complete
           sequence; and tRNA-Gly (trnG) gene, partial sequence;
           chloroplast
          Length = 688

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 119 aataaaaatatatgaaatag 138
           ||||||||||||||||||||
Sbjct: 431 aataaaaatatatgaaatag 450
to top
>gb|AC009709.7|AC009709 Homo sapiens chromosome 18, clone RP11-319O9, complete sequence
          Length = 187615

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 102   tattgcttctacaggataataaaa 125
             ||||||||| ||||||||||||||
Sbjct: 66177 tattgcttccacaggataataaaa 66200
to top
>gb|AC018878.8| Homo sapiens BAC clone RP11-297N12 from 2, complete sequence
          Length = 170801

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 118    taataaaaatatatgaaata 137
              ||||||||||||||||||||
Sbjct: 127695 taataaaaatatatgaaata 127714
to top
>gb|AC007274.3|AC007274 Homo sapiens BAC clone RP11-105L10 from Y, complete sequence
          Length = 117309

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 194   gtcatctattgaattacactatatccta 221
             ||||| ||||||||||||||||| ||||
Sbjct: 55997 gtcatttattgaattacactataaccta 55970
to top
>gb|AC006195.1|AC006195 Homo sapiens clone RP11-350H1 from 7p14-15, complete sequence
          Length = 150242

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 120    ataaaaatatatgaaatagg 139
              ||||||||||||||||||||
Sbjct: 140438 ataaaaatatatgaaatagg 140457
to top
>dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome
          Length = 6413771

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 108    ttctacaggataataaaaat 127
              ||||||||||||||||||||
Sbjct: 281695 ttctacaggataataaaaat 281714
to top
>gb|AC007911.8|AC007911 Homo sapiens chromosome 18, clone RP11-520K18, complete sequence
          Length = 160299

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 102   tattgcttctacaggataataaaa 125
             ||||||||| ||||||||||||||
Sbjct: 59912 tattgcttccacaggataataaaa 59935
to top
>gb|AE003721.3| Drosophila melanogaster chromosome 3R, section 59 of 118 of the
             complete sequence
          Length = 224889

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 120   ataaaaatatatgaaatagg 139
             ||||||||||||||||||||
Sbjct: 46887 ataaaaatatatgaaatagg 46906
to top
>emb|AL732626.8| Mouse DNA sequence from clone RP23-191F22 on chromosome 4, complete
             sequence
          Length = 151688

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 120   ataaaaatatatgaaatagg 139
             ||||||||||||||||||||
Sbjct: 91473 ataaaaatatatgaaatagg 91492
to top
>gb|M35299.1|RATPSTIAA Rat pancreatic secretory trypsin inhibitor-like protein (PSTI) mRNA,
            complete cds
          Length = 2338

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 117  ataataaaaatatatgaaat 136
            ||||||||||||||||||||
Sbjct: 2301 ataataaaaatatatgaaat 2320


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,910,139
Number of Sequences: 3902068
Number of extensions: 2910139
Number of successful extensions: 68825
Number of sequences better than 10.0: 41
Number of HSP's better than 10.0 without gapping: 41
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 68716
Number of HSP's gapped (non-prelim): 109
length of query: 263
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 241
effective length of database: 17,147,199,772
effective search space: 4132475145052
effective search space used: 4132475145052
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top