>gb|AC004521.3| Arabidopsis thaliana chromosome 2 clone F4I1 map m336, complete sequence
          Length = 118327

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 91     caaacatgacaagccagaaac 111
              |||||||||||||||||||||
Sbjct: 104319 caaacatgacaagccagaaac 104299

>gb|AC134859.4| Mus musculus BAC clone RP23-363G20 from chromosome 9, complete sequence
          Length = 182883

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 157    taaaagccaattaagtgtacatga 180
              ||||||||||| ||||||||||||
Sbjct: 127420 taaaagccaataaagtgtacatga 127397

>gb|AC137901.7| Mus musculus chromosome 6, clone RP23-81E17, complete sequence
          Length = 158419

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 212   cactccttttgccttagtct 231
             ||||||||||||||||||||
Sbjct: 56614 cactccttttgccttagtct 56633

>gb|AC144822.2| Danio rerio clone CH211-13O4, complete sequence
          Length = 164460

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 175   acatgacctggatgtttcag 194
             ||||||||||||||||||||
Sbjct: 79875 acatgacctggatgtttcag 79894

>gb|AC164563.4| Mus musculus BAC clone RP23-130D15 from chromosome 6, complete sequence
          Length = 202948

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 212   cactccttttgccttagtct 231
             ||||||||||||||||||||
Sbjct: 69814 cactccttttgccttagtct 69795

>emb|AL138712.19| Human DNA sequence from clone RP11-502P18 on chromosome 13 Contains 3'
              end of novel gene similar to Drosophila CG11486,  and the
              3' end of the FLT1 gene for fms-related tyrosine kinase 1
              (vascular endothelial growth factor/vascular permeability
              factor receptor), complete sequence
          Length = 164519

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 221    tgccttagtctaacatagct 240
              ||||||||||||||||||||
Sbjct: 111815 tgccttagtctaacatagct 111834

>emb|BX571665.6| Zebrafish DNA sequence from clone CH211-276E8 in linkage group 20
             Contains the 5' end of the gene for a novel protein
             similar to vertebrate ring finger protein 144 (RNF144),
             the gene for a novel radical SAM superfamily protein, the
             gene for a novel protein similar to mouse thymidylate
             kinase family LPS-inducible member (Tyki) and a CpG
             island, complete sequence
          Length = 166885

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 91    caaacatgacaagccagaaa 110
             ||||||||||||||||||||
Sbjct: 65190 caaacatgacaagccagaaa 65171

>gb|AC117530.2| Homo sapiens chromosome 5 clone RP11-294P1, complete sequence
          Length = 172442

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 150   caccatataaaagccaattaagtg 173
             ||||||||||||| ||||||||||
Sbjct: 55425 caccatataaaagtcaattaagtg 55402

>gb|AC010411.7| Homo sapiens chromosome 5 clone CTD-2165P17, complete sequence
          Length = 177807

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 150   caccatataaaagccaattaagtg 173
             ||||||||||||| ||||||||||
Sbjct: 48565 caccatataaaagtcaattaagtg 48588

>gb|AC008856.6|AC008856 Homo sapiens chromosome 5 clone CTD-2178N20, complete sequence
          Length = 154229

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 150   caccatataaaagccaattaagtg 173
             ||||||||||||| ||||||||||
Sbjct: 66119 caccatataaaagtcaattaagtg 66142

>gb|AC175394.3| Gallus gallus BAC clone TAM31-49F22 from chromosome w, complete
             sequence
          Length = 123919

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 309   tgcatgatagggcaaccttt 328
             ||||||||||||||||||||
Sbjct: 21645 tgcatgatagggcaaccttt 21664

>emb|BX005454.5| Zebrafish DNA sequence from clone CH211-177N13 in linkage group 14,
             complete sequence
          Length = 63109

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 153   catataaaagccaattaagt 172
             ||||||||||||||||||||
Sbjct: 40187 catataaaagccaattaagt 40206

>gb|AF088189.1|AF088189 Mus musculus CD4 antigen (Cd4) gene, partial sequence
          Length = 23108

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 212  cactccttttgccttagtct 231
            ||||||||||||||||||||
Sbjct: 9229 cactccttttgccttagtct 9248

>gb|AC169087.3| Gallus gallus BAC clone CH261-119D18 from chromosome ul, complete
             sequence
          Length = 225652

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 337   ggatatggcattgctggtat 356
             ||||||||||||||||||||
Sbjct: 42820 ggatatggcattgctggtat 42839

>gb|AC126806.3| Mus musculus BAC clone RP23-158J3 from chromosome 9, complete
            sequence
          Length = 202590

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 157  taaaagccaattaagtgtacatga 180
            ||||||||||| ||||||||||||
Sbjct: 8240 taaaagccaataaagtgtacatga 8217

>gb|AC002397.1|AC002397 Mouse chromosome 6 BAC-284H12 (Research Genetics mouse BAC library)
            complete sequence
          Length = 227538

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 212  cactccttttgccttagtct 231
            ||||||||||||||||||||
Sbjct: 3318 cactccttttgccttagtct 3337

>gb|AC142254.4| Mus musculus BAC clone RP24-545G7 from 6, complete sequence
          Length = 159818

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 212   cactccttttgccttagtct 231
             ||||||||||||||||||||
Sbjct: 40493 cactccttttgccttagtct 40512

>emb|AL845513.9| Zebrafish DNA sequence from clone CH211-13O4 in linkage group 16,
             complete sequence
          Length = 164117

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 175   acatgacctggatgtttcag 194
             ||||||||||||||||||||
Sbjct: 84565 acatgacctggatgtttcag 84546


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,477,621
Number of Sequences: 3902068
Number of extensions: 3477621
Number of successful extensions: 65696
Number of sequences better than 10.0: 18
Number of HSP's better than 10.0 without gapping: 18
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 65643
Number of HSP's gapped (non-prelim): 53
length of query: 440
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 418
effective length of database: 17,147,199,772
effective search space: 7167529504696
effective search space used: 7167529504696
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)