>emb|AL161722.9| Human DNA sequence from clone RP11-497J7 on chromosome X Contains a
             melanoma antigen family B 4 pseudogene and a nuclear
             transcription factor Y, gamma (NFYC) pseudogene, complete
             sequence
          Length = 154594

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 90    agatgttacaaaatgtaaattgttg 114
             |||||||||||||||| ||||||||
Sbjct: 54116 agatgttacaaaatgttaattgttg 54092

>gb|AC101970.11| Mus musculus chromosome 1, clone RP24-267G24, complete sequence
          Length = 167090

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 90     agatgttacaaaatgtaaat 109
              ||||||||||||||||||||
Sbjct: 100903 agatgttacaaaatgtaaat 100922

>gb|AE017130.1| Yersinia pestis biovar Medievalis str. 91001 section 4 of 16 of the
             complete genome
          Length = 290510

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 91    gatgttacaaaatgtaaatt 110
             ||||||||||||||||||||
Sbjct: 58945 gatgttacaaaatgtaaatt 58926

>ref|XM_420365.1| PREDICTED: Gallus gallus similar to tripartite motif-containing 2;
            tripartite motif protein TRIM2; tripartite motif protein
            2 (LOC422399), mRNA
          Length = 3830

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 218  actgggatgcacagccactc 237
            ||||||||||||||||||||
Sbjct: 2000 actgggatgcacagccactc 1981

>gb|AE009952.1| Yersinia pestis KIM, complete genome
          Length = 4600755

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 91      gatgttacaaaatgtaaatt 110
               ||||||||||||||||||||
Sbjct: 1251768 gatgttacaaaatgtaaatt 1251749

>gb|AC166549.2| Nectria haematococca clone JGIAYWI-9F5, complete sequence
          Length = 40816

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 35   caagacaaccaacggacgct 54
            ||||||||||||||||||||
Sbjct: 9668 caagacaaccaacggacgct 9687

>gb|AC009327.8|ATAC009327 Arabidopsis thaliana chromosome III BAC T12J13 genomic sequence,
             complete sequence
          Length = 89934

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 319   gttcaaggcttcaagctagt 338
             ||||||||||||||||||||
Sbjct: 33007 gttcaaggcttcaagctagt 32988

>gb|AC133618.3| Rattus norvegicus 18 BAC CH230-71N8 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 234684

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 153    atgtagcatggaattcaaat 172
              ||||||||||||||||||||
Sbjct: 219211 atgtagcatggaattcaaat 219230

>emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, complete sequence
          Length = 4744671

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 91      gatgttacaaaatgtaaatt 110
               ||||||||||||||||||||
Sbjct: 1247572 gatgttacaaaatgtaaatt 1247553

>emb|AJ414153.1| Yersinia pestis strain CO92 complete genome; segment 13/20
          Length = 258050

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 91     gatgttacaaaatgtaaatt 110
              ||||||||||||||||||||
Sbjct: 236390 gatgttacaaaatgtaaatt 236409

>ref|NM_001017688.1| Danio rerio zgc:112459 (zgc:112459), mRNA
          Length = 1635

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 308 gtgctgatggagttcaaggcttca 331
           |||||| |||||||||||||||||
Sbjct: 23  gtgctgctggagttcaaggcttca 46

>gb|BC093321.1| Danio rerio zgc:112459, mRNA (cDNA clone MGC:112459 IMAGE:7406704),
           complete cds
          Length = 1635

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 308 gtgctgatggagttcaaggcttca 331
           |||||| |||||||||||||||||
Sbjct: 23  gtgctgctggagttcaaggcttca 46


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,922,078
Number of Sequences: 3902068
Number of extensions: 2922078
Number of successful extensions: 51185
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 51149
Number of HSP's gapped (non-prelim): 36
length of query: 358
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 336
effective length of database: 17,147,199,772
effective search space: 5761459123392
effective search space used: 5761459123392
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)