ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbastl03g02 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_550272.1| Oryza sativa (japonica cultivar-group), mRNA Length = 3354 Score = 60.0 bits (30), Expect = 6e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 348 ctacacgctcccggttgttgagtaggccagcgagctgg 385 |||||| ||||||||||||||||||||||| ||||||| Sbjct: 3354 ctacacactcccggttgttgagtaggccagtgagctgg 3317
>gb|AC124561.3| Mus musculus BAC clone RP23-169G13 from chromosome 15, complete sequence Length = 205427 Score = 60.0 bits (30), Expect = 6e-06 Identities = 33/34 (97%) Strand = Plus / Minus Query: 387 gtgtgtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||||||| |||||| Sbjct: 14530 gtgtgtctgggtctgggtctgggtctgggtctgg 14497 Score = 60.0 bits (30), Expect = 6e-06 Identities = 33/34 (97%) Strand = Plus / Minus Query: 387 gtgtgtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||||||| |||||| Sbjct: 14379 gtgtgtctgggtctgggtctgggtctgggtctgg 14346 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 14520 gtctgggtctgggtctgggtctgggtctgg 14491 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 14514 gtctgggtctgggtctgggtctgggtctgg 14485 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 14369 gtctgggtctgggtctgggtctgggtctgg 14340 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 14363 gtctgggtctgggtctgggtctgggtctgg 14334 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 14357 gtctgggtctgggtctgggtctgggtctgg 14328 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 14351 gtctgggtctgggtctgggtctgggtctgg 14322 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 14345 gtctgggtctgggtctgggtctgggtctgg 14316 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 14339 gtctgggtctgggtctgggtctgggtctgg 14310 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Minus Query: 387 gtgtgtctgggtctgggtctgggtctgcgtctg 419 ||||||||||||||||||||| ||||| ||||| Sbjct: 14768 gtgtgtctgggtctgggtctgtgtctgtgtctg 14736 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctg 419 ||||||||||||||||||||||| ||||| Sbjct: 14508 gtctgggtctgggtctgggtctgggtctg 14480 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctg 419 ||||||||||||||||||||||| ||||| Sbjct: 14502 gtctgggtctgggtctgggtctgtgtctg 14474 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctg 419 ||||||||||||||||| ||||| ||||| Sbjct: 14496 gtctgggtctgggtctgtgtctgtgtctg 14468
>gb|AC164113.3| Mus musculus BAC clone RP24-228K9 from chromosome 15, complete sequence Length = 147934 Score = 60.0 bits (30), Expect = 6e-06 Identities = 33/34 (97%) Strand = Plus / Minus Query: 387 gtgtgtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||||||| |||||| Sbjct: 136864 gtgtgtctgggtctgggtctgggtctgggtctgg 136831 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 136854 gtctgggtctgggtctgggtctgggtctgg 136825 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 136848 gtctgggtctgggtctgggtctgggtctgg 136819 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 136842 gtctgggtctgggtctgggtctgggtctgg 136813 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 136836 gtctgggtctgggtctgggtctgggtctgg 136807 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 136830 gtctgggtctgggtctgggtctgggtctgg 136801 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 136824 gtctgggtctgggtctgggtctgggtctgg 136795
>gb|AC153514.8| Mus musculus 10 BAC RP23-406O24 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 189633 Score = 60.0 bits (30), Expect = 6e-06 Identities = 33/34 (97%) Strand = Plus / Plus Query: 387 gtgtgtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||||||| |||||| Sbjct: 59206 gtgtgtctgggtctgggtctgggtctgggtctgg 59239
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 60.0 bits (30), Expect = 6e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 348 ctacacgctcccggttgttgagtaggccagcgagctgg 385 |||||| ||||||||||||||||||||||| ||||||| Sbjct: 3623996 ctacacactcccggttgttgagtaggccagtgagctgg 3623959 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 229 gccggcgacagcgccaccacc 249 ||||||||||||||||||||| Sbjct: 21990026 gccggcgacagcgccaccacc 21990006 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 389 gtgtctgggtctgggtctgggtct 412 ||||| |||||||||||||||||| Sbjct: 11938089 gtgtcggggtctgggtctgggtct 11938112
>dbj|AP003282.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0583G08 Length = 135295 Score = 60.0 bits (30), Expect = 6e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 348 ctacacgctcccggttgttgagtaggccagcgagctgg 385 |||||| ||||||||||||||||||||||| ||||||| Sbjct: 32476 ctacacactcccggttgttgagtaggccagtgagctgg 32439
>gb|AC122328.4| Mus musculus BAC clone RP23-341A4 from 15, complete sequence Length = 201815 Score = 60.0 bits (30), Expect = 6e-06 Identities = 33/34 (97%) Strand = Plus / Plus Query: 387 gtgtgtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||||||| |||||| Sbjct: 159219 gtgtgtctgggtctgggtctgggtctgggtctgg 159252 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 159259 gtctgggtctgggtctgggtctgggtctgg 159288 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 159253 gtctgggtctgggtctgggtctgggtctgg 159282 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 159247 gtctgggtctgggtctgggtctgggtctgg 159276 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 159241 gtctgggtctgggtctgggtctgggtctgg 159270 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 159235 gtctgggtctgggtctgggtctgggtctgg 159264 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 159229 gtctgggtctgggtctgggtctgggtctgg 159258
>gb|AC165971.3| Mus musculus BAC clone RP23-94L17 from chromosome 14, complete sequence Length = 211607 Score = 58.0 bits (29), Expect = 2e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||||||||||||||||||||| |||||| Sbjct: 50881 tgtgtctgggtctgggtctgggtctgtgtctgg 50849 Score = 48.1 bits (24), Expect = 0.024 Identities = 30/32 (93%) Strand = Plus / Minus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctg 419 |||||||| ||||||||||||||||| ||||| Sbjct: 50887 tgtgtctgtgtctgggtctgggtctgggtctg 50856 Score = 42.1 bits (21), Expect = 1.5 Identities = 30/33 (90%) Strand = Plus / Minus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||| ||||| ||||||||||| |||||| Sbjct: 50893 tgtgtctgtgtctgtgtctgggtctgggtctgg 50861 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctg 419 ||||||||||||||||| ||||| ||||| Sbjct: 50872 gtctgggtctgggtctgtgtctgggtctg 50844 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctg 419 ||||||||||| ||||||||||| ||||| Sbjct: 50866 gtctgggtctgtgtctgggtctgtgtctg 50838 Score = 40.1 bits (20), Expect = 5.8 Identities = 29/32 (90%) Strand = Plus / Minus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctg 419 |||||||||||||| ||||| ||||| ||||| Sbjct: 50857 tgtgtctgggtctgtgtctgtgtctgtgtctg 50826
>gb|AC125117.4| Mus musculus BAC clone RP24-261P10 from chromosome 14, complete sequence Length = 165313 Score = 58.0 bits (29), Expect = 2e-05 Identities = 32/33 (96%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||||||||||||||||||||| |||||| Sbjct: 69134 tgtgtctgggtctgggtctgggtctgggtctgg 69166 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 69173 gtctgggtctgggtctgggtctgggtctgg 69202 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 69167 gtctgggtctgggtctgggtctgggtctgg 69196 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 69161 gtctgggtctgggtctgggtctgggtctgg 69190 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 69155 gtctgggtctgggtctgggtctgggtctgg 69184 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 69149 gtctgggtctgggtctgggtctgggtctgg 69178 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 69143 gtctgggtctgggtctgggtctgggtctgg 69172 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctg 419 ||||||||||||||||||||||| ||||| Sbjct: 69179 gtctgggtctgggtctgggtctgggtctg 69207 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||| ||||||||||||||||| |||||| Sbjct: 69128 tgtgtctgtgtctgggtctgggtctgggtctgg 69160 Score = 42.1 bits (21), Expect = 1.5 Identities = 30/33 (90%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||| ||||| ||||||||||| |||||| Sbjct: 69122 tgtgtctgtgtctgtgtctgggtctgggtctgg 69154 Score = 40.1 bits (20), Expect = 5.8 Identities = 29/32 (90%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctg 419 |||||||||||||| ||||| ||||| ||||| Sbjct: 69104 tgtgtctgggtctgtgtctgtgtctgtgtctg 69135
>gb|AC156021.2| Mus musculus BAC clone RP23-256A5 from chromosome 5, complete sequence Length = 217987 Score = 58.0 bits (29), Expect = 2e-05 Identities = 32/33 (96%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||||||||||||||||||||| |||||| Sbjct: 16594 tgtgtctgggtctgggtctgggtctgggtctgg 16626 Score = 58.0 bits (29), Expect = 2e-05 Identities = 32/33 (96%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||||||||||||||||||||| |||||| Sbjct: 16100 tgtgtctgggtctgggtctgggtctgggtctgg 16132 Score = 58.0 bits (29), Expect = 2e-05 Identities = 32/33 (96%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||||||||||||||||||||| |||||| Sbjct: 15842 tgtgtctgggtctgggtctgggtctgggtctgg 15874 Score = 58.0 bits (29), Expect = 2e-05 Identities = 32/33 (96%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||||||||||||||||||||| |||||| Sbjct: 15509 tgtgtctgggtctgggtctgggtctgggtctgg 15541 Score = 58.0 bits (29), Expect = 2e-05 Identities = 32/33 (96%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||||||||||||||||||||| |||||| Sbjct: 15401 tgtgtctgggtctgggtctgggtctgggtctgg 15433 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctg 419 |||||||||||||||||||||||||| ||||| Sbjct: 16253 tgtgtctgggtctgggtctgggtctgggtctg 16284 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 16621 gtctgggtctgggtctgggtctgggtctgg 16650 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 16615 gtctgggtctgggtctgggtctgggtctgg 16644 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 16609 gtctgggtctgggtctgggtctgggtctgg 16638 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 16603 gtctgggtctgggtctgggtctgggtctgg 16632 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 15701 gtctgggtctgggtctgggtctgggtctgg 15730 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 15695 gtctgggtctgggtctgggtctgggtctgg 15724 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 15689 gtctgggtctgggtctgggtctgggtctgg 15718 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 15683 gtctgggtctgggtctgggtctgggtctgg 15712 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 15677 gtctgggtctgggtctgggtctgggtctgg 15706 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 15671 gtctgggtctgggtctgggtctgggtctgg 15700 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 15665 gtctgggtctgggtctgggtctgggtctgg 15694 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 15659 gtctgggtctgggtctgggtctgggtctgg 15688 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 15653 gtctgggtctgggtctgggtctgggtctgg 15682 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 15647 gtctgggtctgggtctgggtctgggtctgg 15676 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 15641 gtctgggtctgggtctgggtctgggtctgg 15670 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 15635 gtctgggtctgggtctgggtctgggtctgg 15664 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 15629 gtctgggtctgggtctgggtctgggtctgg 15658 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 15623 gtctgggtctgggtctgggtctgggtctgg 15652 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 15617 gtctgggtctgggtctgggtctgggtctgg 15646 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 15611 gtctgggtctgggtctgggtctgggtctgg 15640 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 15605 gtctgggtctgggtctgggtctgggtctgg 15634 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 15599 gtctgggtctgggtctgggtctgggtctgg 15628 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 15593 gtctgggtctgggtctgggtctgggtctgg 15622 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 15587 gtctgggtctgggtctgggtctgggtctgg 15616 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 15581 gtctgggtctgggtctgggtctgggtctgg 15610 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 15575 gtctgggtctgggtctgggtctgggtctgg 15604 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 15569 gtctgggtctgggtctgggtctgggtctgg 15598 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 15563 gtctgggtctgggtctgggtctgggtctgg 15592 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 15557 gtctgggtctgggtctgggtctgggtctgg 15586 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 15551 gtctgggtctgggtctgggtctgggtctgg 15580 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 15545 gtctgggtctgggtctgggtctgggtctgg 15574 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 15416 gtctgggtctgggtctgggtctgggtctgg 15445 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 15410 gtctgggtctgggtctgggtctgggtctgg 15439 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||| ||||||||||||||||| |||||| Sbjct: 16247 tgtgtctgtgtctgggtctgggtctgggtctgg 16279 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctg 419 ||||||||||||||||||||||| ||||| Sbjct: 15857 gtctgggtctgggtctgggtctgtgtctg 15885 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctg 419 ||||||||||||||||||||||| ||||| Sbjct: 15851 gtctgggtctgggtctgggtctgggtctg 15879 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||| ||||||||||||||||| |||||| Sbjct: 15836 tgtgtctgtgtctgggtctgggtctgggtctgg 15868 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||||||||| ||||||||||| |||||| Sbjct: 15497 tgtgtctgggtctgtgtctgggtctgggtctgg 15529 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||||||||| ||||||||||| |||||| Sbjct: 15485 tgtgtctgggtctgtgtctgggtctgtgtctgg 15517 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctg 419 ||||||||||||||||||||||| ||||| Sbjct: 15428 gtctgggtctgggtctgggtctgtgtctg 15456 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctg 419 ||||||||||||||||||||||| ||||| Sbjct: 15422 gtctgggtctgggtctgggtctgggtctg 15450 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||| ||||||||||||||||| |||||| Sbjct: 15395 tgtgtctgtgtctgggtctgggtctgggtctgg 15427 Score = 48.1 bits (24), Expect = 0.024 Identities = 30/32 (93%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctg 419 |||||||||||||||||||| ||||| ||||| Sbjct: 15371 tgtgtctgggtctgggtctgtgtctgtgtctg 15402 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 390 tgtctgggtctgggtctgggtctgcgtctg 419 |||||||||||||||||| ||||| ||||| Sbjct: 16171 tgtctgggtctgggtctgtgtctgtgtctg 16200 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 390 tgtctgggtctgggtctgggtctgcgtctg 419 |||||||||||||||||| ||||| ||||| Sbjct: 15796 tgtctgggtctgggtctgtgtctgtgtctg 15825 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||| ||||||||||||||||| |||||| Sbjct: 15506 gtctgtgtctgggtctgggtctgggtctgg 15535 Score = 42.1 bits (21), Expect = 1.5 Identities = 30/33 (90%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||| ||| ||||||||||||||||| |||||| Sbjct: 16588 tgtgactgtgtctgggtctgggtctgggtctgg 16620 Score = 42.1 bits (21), Expect = 1.5 Identities = 30/33 (90%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||| ||||| ||||||||||| |||||| Sbjct: 16241 tgtgtctgtgtctgtgtctgggtctgggtctgg 16273 Score = 42.1 bits (21), Expect = 1.5 Identities = 30/33 (90%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||| ||| ||||||||||||||||| |||||| Sbjct: 16094 tgtgactgtgtctgggtctgggtctgggtctgg 16126 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctg 419 ||||||||||||||||| ||||| ||||| Sbjct: 15863 gtctgggtctgggtctgtgtctgtgtctg 15891 Score = 42.1 bits (21), Expect = 1.5 Identities = 30/33 (90%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||| ||||| ||||||||||| |||||| Sbjct: 15830 tgtgtctgtgtctgtgtctgggtctgggtctgg 15862 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtc 411 ||||||||||||||||||||| Sbjct: 15713 gtctgggtctgggtctgggtc 15733 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtc 411 ||||||||||||||||||||| Sbjct: 15524 gtctgggtctgggtctgggtc 15544 Score = 42.1 bits (21), Expect = 1.5 Identities = 30/33 (90%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||| ||||| ||||||||||| |||||| Sbjct: 15473 tgtgtctgtgtctgtgtctgggtctgtgtctgg 15505 Score = 42.1 bits (21), Expect = 1.5 Identities = 30/33 (90%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||| ||||| ||||||||||| |||||| Sbjct: 15389 tgtgtctgtgtctgtgtctgggtctgggtctgg 15421 Score = 40.1 bits (20), Expect = 5.8 Identities = 29/32 (90%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctg 419 |||||||| ||||||||||| ||||| ||||| Sbjct: 15479 tgtgtctgtgtctgggtctgtgtctgggtctg 15510 Score = 40.1 bits (20), Expect = 5.8 Identities = 29/32 (90%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctg 419 |||| ||| ||||||||||||||||| ||||| Sbjct: 15365 tgtgactgtgtctgggtctgggtctgtgtctg 15396
>gb|AC129184.3| Mus musculus BAC clone RP23-358F24 from 5, complete sequence Length = 203369 Score = 58.0 bits (29), Expect = 2e-05 Identities = 32/33 (96%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||||||||||||||||||||| |||||| Sbjct: 191246 tgtgtctgggtctgggtctgggtctgggtctgg 191278 Score = 58.0 bits (29), Expect = 2e-05 Identities = 32/33 (96%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||||||||||||||||||||| |||||| Sbjct: 190752 tgtgtctgggtctgggtctgggtctgggtctgg 190784 Score = 58.0 bits (29), Expect = 2e-05 Identities = 32/33 (96%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||||||||||||||||||||| |||||| Sbjct: 190494 tgtgtctgggtctgggtctgggtctgggtctgg 190526 Score = 58.0 bits (29), Expect = 2e-05 Identities = 32/33 (96%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||||||||||||||||||||| |||||| Sbjct: 190161 tgtgtctgggtctgggtctgggtctgggtctgg 190193 Score = 58.0 bits (29), Expect = 2e-05 Identities = 32/33 (96%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||||||||||||||||||||| |||||| Sbjct: 190053 tgtgtctgggtctgggtctgggtctgggtctgg 190085 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctg 419 |||||||||||||||||||||||||| ||||| Sbjct: 190905 tgtgtctgggtctgggtctgggtctgggtctg 190936 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 191273 gtctgggtctgggtctgggtctgggtctgg 191302 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 191267 gtctgggtctgggtctgggtctgggtctgg 191296 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 191261 gtctgggtctgggtctgggtctgggtctgg 191290 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 191255 gtctgggtctgggtctgggtctgggtctgg 191284 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 190353 gtctgggtctgggtctgggtctgggtctgg 190382 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 190347 gtctgggtctgggtctgggtctgggtctgg 190376 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 190341 gtctgggtctgggtctgggtctgggtctgg 190370 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 190335 gtctgggtctgggtctgggtctgggtctgg 190364 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 190329 gtctgggtctgggtctgggtctgggtctgg 190358 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 190323 gtctgggtctgggtctgggtctgggtctgg 190352 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 190317 gtctgggtctgggtctgggtctgggtctgg 190346 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 190311 gtctgggtctgggtctgggtctgggtctgg 190340 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 190305 gtctgggtctgggtctgggtctgggtctgg 190334 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 190299 gtctgggtctgggtctgggtctgggtctgg 190328 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 190293 gtctgggtctgggtctgggtctgggtctgg 190322 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 190287 gtctgggtctgggtctgggtctgggtctgg 190316 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 190281 gtctgggtctgggtctgggtctgggtctgg 190310 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 190275 gtctgggtctgggtctgggtctgggtctgg 190304 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 190269 gtctgggtctgggtctgggtctgggtctgg 190298 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 190263 gtctgggtctgggtctgggtctgggtctgg 190292 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 190257 gtctgggtctgggtctgggtctgggtctgg 190286 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 190251 gtctgggtctgggtctgggtctgggtctgg 190280 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 190245 gtctgggtctgggtctgggtctgggtctgg 190274 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 190239 gtctgggtctgggtctgggtctgggtctgg 190268 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 190233 gtctgggtctgggtctgggtctgggtctgg 190262 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 190227 gtctgggtctgggtctgggtctgggtctgg 190256 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 190221 gtctgggtctgggtctgggtctgggtctgg 190250 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 190215 gtctgggtctgggtctgggtctgggtctgg 190244 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 190209 gtctgggtctgggtctgggtctgggtctgg 190238 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 190203 gtctgggtctgggtctgggtctgggtctgg 190232 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 190197 gtctgggtctgggtctgggtctgggtctgg 190226 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 190068 gtctgggtctgggtctgggtctgggtctgg 190097 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 190062 gtctgggtctgggtctgggtctgggtctgg 190091 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||| ||||||||||||||||| |||||| Sbjct: 190899 tgtgtctgtgtctgggtctgggtctgggtctgg 190931 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctg 419 ||||||||||||||||||||||| ||||| Sbjct: 190509 gtctgggtctgggtctgggtctgtgtctg 190537 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctg 419 ||||||||||||||||||||||| ||||| Sbjct: 190503 gtctgggtctgggtctgggtctgggtctg 190531 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||| ||||||||||||||||| |||||| Sbjct: 190488 tgtgtctgtgtctgggtctgggtctgggtctgg 190520 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||||||||| ||||||||||| |||||| Sbjct: 190149 tgtgtctgggtctgtgtctgggtctgggtctgg 190181 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||||||||| ||||||||||| |||||| Sbjct: 190137 tgtgtctgggtctgtgtctgggtctgtgtctgg 190169 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctg 419 ||||||||||||||||||||||| ||||| Sbjct: 190080 gtctgggtctgggtctgggtctgtgtctg 190108 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctg 419 ||||||||||||||||||||||| ||||| Sbjct: 190074 gtctgggtctgggtctgggtctgggtctg 190102 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||| ||||||||||||||||| |||||| Sbjct: 190047 tgtgtctgtgtctgggtctgggtctgggtctgg 190079 Score = 48.1 bits (24), Expect = 0.024 Identities = 30/32 (93%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctg 419 |||||||||||||||||||| ||||| ||||| Sbjct: 190023 tgtgtctgggtctgggtctgtgtctgtgtctg 190054 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 390 tgtctgggtctgggtctgggtctgcgtctg 419 |||||||||||||||||| ||||| ||||| Sbjct: 190823 tgtctgggtctgggtctgtgtctgtgtctg 190852 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 390 tgtctgggtctgggtctgggtctgcgtctg 419 |||||||||||||||||| ||||| ||||| Sbjct: 190448 tgtctgggtctgggtctgtgtctgtgtctg 190477 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||| ||||||||||||||||| |||||| Sbjct: 190158 gtctgtgtctgggtctgggtctgggtctgg 190187 Score = 42.1 bits (21), Expect = 1.5 Identities = 30/33 (90%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||| ||| ||||||||||||||||| |||||| Sbjct: 191240 tgtgactgtgtctgggtctgggtctgggtctgg 191272 Score = 42.1 bits (21), Expect = 1.5 Identities = 30/33 (90%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||| ||||| ||||||||||| |||||| Sbjct: 190893 tgtgtctgtgtctgtgtctgggtctgggtctgg 190925 Score = 42.1 bits (21), Expect = 1.5 Identities = 30/33 (90%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||| ||| ||||||||||||||||| |||||| Sbjct: 190746 tgtgactgtgtctgggtctgggtctgggtctgg 190778 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctg 419 ||||||||||||||||| ||||| ||||| Sbjct: 190515 gtctgggtctgggtctgtgtctgtgtctg 190543 Score = 42.1 bits (21), Expect = 1.5 Identities = 30/33 (90%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||| ||||| ||||||||||| |||||| Sbjct: 190482 tgtgtctgtgtctgtgtctgggtctgggtctgg 190514 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtc 411 ||||||||||||||||||||| Sbjct: 190365 gtctgggtctgggtctgggtc 190385 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtc 411 ||||||||||||||||||||| Sbjct: 190176 gtctgggtctgggtctgggtc 190196 Score = 42.1 bits (21), Expect = 1.5 Identities = 30/33 (90%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||| ||||| ||||||||||| |||||| Sbjct: 190125 tgtgtctgtgtctgtgtctgggtctgtgtctgg 190157 Score = 42.1 bits (21), Expect = 1.5 Identities = 30/33 (90%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||| ||||| ||||||||||| |||||| Sbjct: 190041 tgtgtctgtgtctgtgtctgggtctgggtctgg 190073 Score = 40.1 bits (20), Expect = 5.8 Identities = 29/32 (90%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctg 419 |||||||| ||||||||||| ||||| ||||| Sbjct: 190131 tgtgtctgtgtctgggtctgtgtctgggtctg 190162 Score = 40.1 bits (20), Expect = 5.8 Identities = 29/32 (90%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctg 419 |||| ||| ||||||||||||||||| ||||| Sbjct: 190017 tgtgactgtgtctgggtctgggtctgtgtctg 190048
>gb|AC147545.3| Mus musculus BAC clone RP23-355L20 from 14, complete sequence Length = 211446 Score = 58.0 bits (29), Expect = 2e-05 Identities = 32/33 (96%) Strand = Plus / Minus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||||||||||||||||||||| |||||| Sbjct: 175363 tgtgtctgggtctgggtctgggtctgggtctgg 175331 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 175354 gtctgggtctgggtctgggtctgggtctgg 175325 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 175348 gtctgggtctgggtctgggtctgggtctgg 175319 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 175342 gtctgggtctgggtctgggtctgggtctgg 175313 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 175336 gtctgggtctgggtctgggtctgggtctgg 175307 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 175330 gtctgggtctgggtctgggtctgggtctgg 175301 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 175324 gtctgggtctgggtctgggtctgggtctgg 175295 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Minus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||| ||||||||||||||||| |||||| Sbjct: 175369 tgtgtctgtgtctgggtctgggtctgggtctgg 175337 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctg 419 ||||||||||||||||||||||| ||||| Sbjct: 175318 gtctgggtctgggtctgggtctgggtctg 175290 Score = 42.1 bits (21), Expect = 1.5 Identities = 30/33 (90%) Strand = Plus / Minus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||| ||||| ||||||||||| |||||| Sbjct: 175375 tgtgtctgtgtctgtgtctgggtctgggtctgg 175343 Score = 40.1 bits (20), Expect = 5.8 Identities = 29/32 (90%) Strand = Plus / Minus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctg 419 |||||||||||||| ||||| ||||| ||||| Sbjct: 175393 tgtgtctgggtctgtgtctgtgtctgtgtctg 175362
>gb|AC120004.14| Mus musculus chromosome 5, clone RP24-150N15, complete sequence Length = 199229 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Plus Query: 382 ctggagtgtgtctgggtctgggtctgggtctg 413 |||||||| ||||||||||||||||||||||| Sbjct: 182324 ctggagtgggtctgggtctgggtctgggtctg 182355 Score = 48.1 bits (24), Expect = 0.024 Identities = 27/28 (96%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||| |||||| Sbjct: 181880 ctgggtctgggtctgggtctgggtctgg 181907 Score = 46.1 bits (23), Expect = 0.093 Identities = 26/27 (96%) Strand = Plus / Plus Query: 394 tgggtctgggtctgggtctgcgtctgg 420 |||||||||||||||||||| |||||| Sbjct: 182330 tgggtctgggtctgggtctgggtctgg 182356 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctg 413 ||||||||||||||||||||||| Sbjct: 181884 gtctgggtctgggtctgggtctg 181906 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 394 tgggtctgggtctgggtctg 413 |||||||||||||||||||| Sbjct: 182253 tgggtctgggtctgggtctg 182272 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||| ||||||||||||||| |||||| Sbjct: 181874 ctgggactgggtctgggtctgggtctgg 181901
>gb|AC122466.2| Mus musculus BAC clone RP24-304N8 from chromosome 5, complete sequence Length = 196687 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Plus Query: 382 ctggagtgtgtctgggtctgggtctgggtctg 413 |||||||| ||||||||||||||||||||||| Sbjct: 177375 ctggagtgggtctgggtctgggtctgggtctg 177406 Score = 48.1 bits (24), Expect = 0.024 Identities = 27/28 (96%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||| |||||| Sbjct: 176931 ctgggtctgggtctgggtctgggtctgg 176958 Score = 46.1 bits (23), Expect = 0.093 Identities = 26/27 (96%) Strand = Plus / Plus Query: 394 tgggtctgggtctgggtctgcgtctgg 420 |||||||||||||||||||| |||||| Sbjct: 177381 tgggtctgggtctgggtctgggtctgg 177407 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctg 413 ||||||||||||||||||||||| Sbjct: 176935 gtctgggtctgggtctgggtctg 176957 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 394 tgggtctgggtctgggtctg 413 |||||||||||||||||||| Sbjct: 177304 tgggtctgggtctgggtctg 177323 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||| ||||||||||||||| |||||| Sbjct: 176925 ctgggactgggtctgggtctgggtctgg 176952
>gb|AC113280.12| Mus musculus chromosome 1, clone RP23-391E12, complete sequence Length = 217982 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Minus Query: 389 gtgtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||||| |||||| Sbjct: 152311 gtgtctgggtctgggtctgggtctgggtctgg 152280 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 152303 gtctgggtctgggtctgggtctgggtctgg 152274 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 152297 gtctgggtctgggtctgggtctgggtctgg 152268 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 152291 gtctgggtctgggtctgggtctgggtctgg 152262 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 152285 gtctgggtctgggtctgggtctgggtctgg 152256 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 152279 gtctgggtctgggtctgggtctgggtctgg 152250 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 152273 gtctgggtctgggtctgggtctgggtctgg 152244 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 152267 gtctgggtctgggtctgggtctgggtctgg 152238 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 152261 gtctgggtctgggtctgggtctgggtctgg 152232 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 152255 gtctgggtctgggtctgggtctgggtctgg 152226 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 152249 gtctgggtctgggtctgggtctgggtctgg 152220 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctg 419 ||||||||||||||||||||||| ||||| Sbjct: 152243 gtctgggtctgggtctgggtctgggtctg 152215 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctg 419 ||||||||||||||||||||||| ||||| Sbjct: 152237 gtctgggtctgggtctgggtctgtgtctg 152209 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctg 419 ||||||||||||||||| ||||| ||||| Sbjct: 152231 gtctgggtctgggtctgtgtctgtgtctg 152203
>gb|AC111099.15| Mus musculus chromosome 1, clone RP23-177A20, complete sequence Length = 195979 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Plus Query: 389 gtgtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||||| |||||| Sbjct: 176347 gtgtctgggtctgggtctgggtctgggtctgg 176378 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 176409 gtctgggtctgggtctgggtctgggtctgg 176438 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 176403 gtctgggtctgggtctgggtctgggtctgg 176432 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 176397 gtctgggtctgggtctgggtctgggtctgg 176426 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 176391 gtctgggtctgggtctgggtctgggtctgg 176420 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 176385 gtctgggtctgggtctgggtctgggtctgg 176414 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 176379 gtctgggtctgggtctgggtctgggtctgg 176408 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 176373 gtctgggtctgggtctgggtctgggtctgg 176402 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 176367 gtctgggtctgggtctgggtctgggtctgg 176396 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 176361 gtctgggtctgggtctgggtctgggtctgg 176390 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 176355 gtctgggtctgggtctgggtctgggtctgg 176384 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctg 419 ||||||||||||||||||||||| ||||| Sbjct: 176421 gtctgggtctgggtctgggtctgtgtctg 176449 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctg 419 ||||||||||||||||||||||| ||||| Sbjct: 176415 gtctgggtctgggtctgggtctgggtctg 176443 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctg 419 ||||||||||||||||| ||||| ||||| Sbjct: 176427 gtctgggtctgggtctgtgtctgtgtctg 176455
>gb|AC149590.5| Mus musculus BAC clone RP23-348L9 from chromosome 5, complete sequence Length = 196662 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Plus Query: 382 ctggagtgtgtctgggtctgggtctgggtctg 413 |||||||| ||||||||||||||||||||||| Sbjct: 59757 ctggagtgggtctgggtctgggtctgggtctg 59788 Score = 48.1 bits (24), Expect = 0.024 Identities = 27/28 (96%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||| |||||| Sbjct: 59313 ctgggtctgggtctgggtctgggtctgg 59340 Score = 46.1 bits (23), Expect = 0.093 Identities = 26/27 (96%) Strand = Plus / Plus Query: 394 tgggtctgggtctgggtctgcgtctgg 420 |||||||||||||||||||| |||||| Sbjct: 59763 tgggtctgggtctgggtctgggtctgg 59789 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctg 413 ||||||||||||||||||||||| Sbjct: 59317 gtctgggtctgggtctgggtctg 59339 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 394 tgggtctgggtctgggtctg 413 |||||||||||||||||||| Sbjct: 59686 tgggtctgggtctgggtctg 59705 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||| ||||||||||||||| |||||| Sbjct: 59307 ctgggactgggtctgggtctgggtctgg 59334
>gb|CP000282.1| Saccharophagus degradans 2-40, complete genome Length = 5057531 Score = 54.0 bits (27), Expect = 4e-04 Identities = 30/31 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctggc 421 ||||||||||||||||||||||| ||||||| Sbjct: 3795250 gtctgggtctgggtctgggtctgggtctggc 3795280 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 3795244 gtctgggtctgggtctgggtctgggtctgg 3795273 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 3795238 gtctgggtctgggtctgggtctgggtctgg 3795267 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 3795232 gtctgggtctgggtctgggtctgggtctgg 3795261 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 3795226 gtctgggtctgggtctgggtctgggtctgg 3795255 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 3795220 gtctgggtctgggtctgggtctgggtctgg 3795249 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 3795214 gtctgggtctgggtctgggtctgggtctgg 3795243 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 3795208 gtctgggtctgggtctgggtctgggtctgg 3795237 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 3795202 gtctgggtctgggtctgggtctgggtctgg 3795231 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 3795196 gtctgggtctgggtctgggtctgggtctgg 3795225 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 3795190 gtctgggtctgggtctgggtctgggtctgg 3795219 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 3795184 gtctgggtctgggtctgggtctgggtctgg 3795213 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||| ||||||||||||||||| |||||| Sbjct: 3795178 gtctgagtctgggtctgggtctgggtctgg 3795207 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||| ||||||||||| |||||| Sbjct: 3795172 gtctgggtctgagtctgggtctgggtctgg 3795201 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 392 tctgggtctgggtctgggtctgcgtctgg 420 |||||||||||||||| ||||| |||||| Sbjct: 3795167 tctgggtctgggtctgagtctgggtctgg 3795195
>gb|AC116383.11| Mus musculus chromosome 5, clone RP23-15P21, complete sequence Length = 259299 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 166570 gtctgggtctgggtctgggtctgggtctgg 166541 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 166564 gtctgggtctgggtctgggtctgggtctgg 166535
>gb|AC103600.8| Mus musculus chromosome 1, clone RP23-247F18, complete sequence Length = 199808 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 158477 gtctgggtctgggtctgggtctgggtctgg 158506 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 158471 gtctgggtctgggtctgggtctgggtctgg 158500 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 158465 gtctgggtctgggtctgggtctgggtctgg 158494 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 158459 gtctgggtctgggtctgggtctgggtctgg 158488 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 158453 gtctgggtctgggtctgggtctgggtctgg 158482 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 158447 gtctgggtctgggtctgggtctgggtctgg 158476 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 158441 gtctgggtctgggtctgggtctgggtctgg 158470 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 158435 gtctgggtctgggtctgggtctgggtctgg 158464 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 158429 gtctgggtctgggtctgggtctgggtctgg 158458 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 158423 gtctgggtctgggtctgggtctgggtctgg 158452 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 158417 gtctgggtctgggtctgggtctgggtctgg 158446 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 158411 gtctgggtctgggtctgggtctgggtctgg 158440 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 158405 gtctgggtctgggtctgggtctgggtctgg 158434 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 158399 gtctgggtctgggtctgggtctgggtctgg 158428 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 158393 gtctgggtctgggtctgggtctgggtctgg 158422 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 158387 gtctgggtctgggtctgggtctgggtctgg 158416 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 158381 gtctgggtctgggtctgggtctgggtctgg 158410 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 158375 gtctgggtctgggtctgggtctgggtctgg 158404 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 158369 gtctgggtctgggtctgggtctgggtctgg 158398 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 158363 gtctgggtctgggtctgggtctgggtctgg 158392 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 158357 gtctgggtctgggtctgggtctgggtctgg 158386 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 158351 gtctgggtctgggtctgggtctgggtctgg 158380 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 158345 gtctgggtctgggtctgggtctgggtctgg 158374 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 158339 gtctgggtctgggtctgggtctgggtctgg 158368 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 158333 gtctgggtctgggtctgggtctgggtctgg 158362 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 158327 gtctgggtctgggtctgggtctgggtctgg 158356 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 158321 gtctgggtctgggtctgggtctgggtctgg 158350 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 158315 gtctgggtctgggtctgggtctgggtctgg 158344 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 158309 gtctgggtctgggtctgggtctgggtctgg 158338 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 158303 gtctgggtctgggtctgggtctgggtctgg 158332 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Plus Query: 395 gggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||| |||||| Sbjct: 158301 gggtctgggtctgggtctgggtctgg 158326
>emb|AL512666.6| Human DNA sequence from clone RP11-459E2 on chromosome 13 Contaisn the 3' end of a novel gene (FLJ21007), complete sequence Length = 135455 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 388 tgtgtctgggtctgggtctgggtctg 413 |||||||||||||||||||||||||| Sbjct: 130698 tgtgtctgggtctgggtctgggtctg 130673 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 387 gtgtgtctgggtctgggtctgggtctgcgtctgg 420 ||||||||| ||||||||||||||||| |||||| Sbjct: 130705 gtgtgtctgtgtctgggtctgggtctgggtctgg 130672 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 130689 gtctgggtctgggtctgggt 130670
>emb|AL360076.9| Human DNA sequence from clone RP13-469L5 on chromosome X Contains the 3' end of the STARD8 gene for START domain containing 8 and a CpG island, complete sequence Length = 62516 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 22192 gtctgggtctgggtctgggtctgggtctgg 22163 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 22186 gtctgggtctgggtctgggtctgggtctgg 22157 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 22180 gtctgggtctgggtctgggtctgggtctgg 22151 Score = 46.1 bits (23), Expect = 0.093 Identities = 26/27 (96%) Strand = Plus / Minus Query: 394 tgggtctgggtctgggtctgcgtctgg 420 |||||||||||||||||||| |||||| Sbjct: 22195 tgggtctgggtctgggtctgggtctgg 22169 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtc 411 ||||||||||||||||||||| Sbjct: 22168 gtctgggtctgggtctgggtc 22148
>emb|AL672236.18| Mouse DNA sequence from clone RP23-206L21 on chromosome 11 Contains a ribosomal protein S6 (Rps6) pseudogene, a novel gene, the gene for a novel immunoglobulin domain containing protein and two CpG islands, complete sequence Length = 219893 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 122060 gtctgggtctgggtctgggtctgggtctgg 122031 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 122054 gtctgggtctgggtctgggtctgggtctgg 122025 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 122048 gtctgggtctgggtctgggtctgggtctgg 122019 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 122042 gtctgggtctgggtctgggtctgggtctgg 122013 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 122036 gtctgggtctgggtctgggtctgggtctgg 122007 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 122030 gtctgggtctgggtctgggtctgggtctgg 122001 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 122024 gtctgggtctgggtctgggtctgggtctgg 121995 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 122018 gtctgggtctgggtctgggtctgggtctgg 121989 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 122012 gtctgggtctgggtctgggtctgggtctgg 121983 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 122006 gtctgggtctgggtctgggtctgggtctgg 121977 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 122000 gtctgggtctgggtctgggtctgggtctgg 121971 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 121994 gtctgggtctgggtctgggtctgggtctgg 121965 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 121988 gtctgggtctgggtctgggtctgggtctgg 121959 Score = 48.1 bits (24), Expect = 0.024 Identities = 27/28 (96%) Strand = Plus / Minus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||| |||||| Sbjct: 122064 ctgggtctgggtctgggtctgggtctgg 122037 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||| | |||||| Sbjct: 121976 gtctgggtctgggtctgggtcagggtctgg 121947 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtc 411 ||||||||||||||||||||| Sbjct: 121908 gtctgggtctgggtctgggtc 121888
>gb|DQ396619.1| Alexandrium tamarense microsatellite ATB1 sequence Length = 282 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 184 gtctgggtctgggtctgggtctgggtctgg 213 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 178 gtctgggtctgggtctgggtctgggtctgg 207 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 172 gtctgggtctgggtctgggtctgggtctgg 201 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 166 gtctgggtctgggtctgggtctgggtctgg 195 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 160 gtctgggtctgggtctgggtctgggtctgg 189 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 154 gtctgggtctgggtctgggtctgggtctgg 183 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 148 gtctgggtctgggtctgggtctgggtctgg 177 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 142 gtctgggtctgggtctgggtctgggtctgg 171 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 136 gtctgggtctgggtctgggtctgggtctgg 165 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Plus Query: 387 gtgtgtctgggtctgggtctgggtctgcgtctgg 420 ||||| ||||||||||||||||||||| |||||| Sbjct: 126 gtgtgcctgggtctgggtctgggtctgggtctgg 159 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctg 419 ||||||||||||||||||||||| ||||| Sbjct: 190 gtctgggtctgggtctgggtctgggtctg 218
>gb|AC093925.5| Genomic sequence for Mus musculus, clone RP23-304H5, complete sequence Length = 227242 Score = 52.0 bits (26), Expect = 0.002 Identities = 32/34 (94%) Strand = Plus / Minus Query: 387 gtgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||| |||||||||||||||||||| |||||| Sbjct: 161606 gtgtgtgtgggtctgggtctgggtctgggtctgg 161573 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 |||||||||||||||||||| || |||||| Sbjct: 161590 gtctgggtctgggtctgggtgtgtgtctgg 161561
>gb|DQ314492.1| Uncultured prokaryote 2B07 sequence Length = 27890 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 24321 gtctgggtctgggtctgggtctgggtctgg 24350 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 24315 gtctgggtctgggtctgggtctgggtctgg 24344 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctg 419 ||||||||||||||||||||||| ||||| Sbjct: 24327 gtctgggtctgggtctgggtctgggtctg 24355 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||| ||||||||||||||||| |||||| Sbjct: 24309 gtctgagtctgggtctgggtctgggtctgg 24338
>ref|XM_231042.3| PREDICTED: Rattus norvegicus NADPH oxidase activator 1 (predicted) (Noxa1_predicted), mRNA Length = 3814 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 1307 gtctgggtctgggtctgggtctgggtctgg 1278 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 1253 gtctgggtctgggtctgggtctgggtctgg 1224 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 1247 gtctgggtctgggtctgggtctgggtctgg 1218 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 1151 gtctgggtctgggtctgggtctgggtctgg 1122 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 1091 gtctgggtctgggtctgggtctgggtctgg 1062 Score = 48.1 bits (24), Expect = 0.024 Identities = 27/28 (96%) Strand = Plus / Minus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||| |||||| Sbjct: 1311 ctgggtctgggtctgggtctgggtctgg 1284 Score = 48.1 bits (24), Expect = 0.024 Identities = 27/28 (96%) Strand = Plus / Minus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||| |||||| Sbjct: 1257 ctgggtctgggtctgggtctgggtctgg 1230 Score = 48.1 bits (24), Expect = 0.024 Identities = 27/28 (96%) Strand = Plus / Minus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||| |||||| Sbjct: 1155 ctgggtctgggtctgggtctgggtctgg 1128 Score = 48.1 bits (24), Expect = 0.024 Identities = 27/28 (96%) Strand = Plus / Minus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||| |||||| Sbjct: 1095 ctgggtctgggtctgggtctgggtctgg 1068 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||| ||| |||||| Sbjct: 1295 gtctgggtctgggtctgggactgggtctgg 1266 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 393 ctgggtctgggtctgggtctgcgtct 418 ||||||||||||||||||||| |||| Sbjct: 1197 ctgggtctgggtctgggtctgggtct 1172 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtct 412 |||||||||||||||||||||| Sbjct: 1193 gtctgggtctgggtctgggtct 1172 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||| ||||||||| |||||| Sbjct: 1109 gtctgggtctgggactgggtctgggtctgg 1080 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||| ||||||||||||||| |||||| Sbjct: 1103 gtctgggactgggtctgggtctgggtctgg 1074 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||| ||||||||||||||| |||||| Sbjct: 1317 ctgggactgggtctgggtctgggtctgg 1290 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||| ||||||||||||||| |||||| Sbjct: 1203 ctgggactgggtctgggtctgggtctgg 1176 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||| ||||||||||||||| |||||| Sbjct: 1161 ctgggactgggtctgggtctgggtctgg 1134 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||| ||| |||||| Sbjct: 1113 ctgggtctgggtctgggactgggtctgg 1086
>gb|AC104098.5| Mus musculus BAC clone RP24-372H3 from 5, complete sequence Length = 180886 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 164634 gtctgggtctgggtctgggtctgggtctgg 164663 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 164628 gtctgggtctgggtctgggtctgggtctgg 164657 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 164622 gtctgggtctgggtctgggtctgggtctgg 164651 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 164616 gtctgggtctgggtctgggtctgggtctgg 164645 Score = 48.1 bits (24), Expect = 0.024 Identities = 27/28 (96%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||| |||||| Sbjct: 164612 ctgggtctgggtctgggtctgggtctgg 164639 Score = 48.1 bits (24), Expect = 0.024 Identities = 27/28 (96%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||| |||||| Sbjct: 164493 ctgggtctgggtctgggtctgagtctgg 164520 Score = 48.1 bits (24), Expect = 0.024 Identities = 27/28 (96%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||| |||||| Sbjct: 164398 ctgggtctgggtctgggtctgggtctgg 164425 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctg 413 ||||||||||||||||||||||| Sbjct: 164546 gtctgggtctgggtctgggtctg 164568 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctg 413 ||||||||||||||||||||||| Sbjct: 164402 gtctgggtctgggtctgggtctg 164424 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||| ||||||||| |||||| Sbjct: 164670 gtctgggtctgggactgggtctgggtctgg 164699 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 |||||||||||| |||||||||| |||||| Sbjct: 164652 gtctgggtctggatctgggtctgggtctgg 164681 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 |||||||||||||||||| |||| |||||| Sbjct: 164646 gtctgggtctgggtctggatctgggtctgg 164675 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Plus Query: 395 gggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||| |||||| Sbjct: 164544 gggtctgggtctgggtctgggtctgg 164569 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||| ||||||||||||||| |||||| Sbjct: 164390 gtctgggcctgggtctgggtctgggtctgg 164419 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||| ||||||||| |||||| Sbjct: 164384 gtctgggtctgggcctgggtctgggtctgg 164413 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||| ||| |||||| Sbjct: 164378 gtctgggtctgggtctgggcctgggtctgg 164407 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||| ||||||||| |||||| Sbjct: 163368 gtctgggtctgggcctgggtctgggtctgg 163397 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||| ||| |||||| Sbjct: 163362 gtctgggtctgggtctgggcctgggtctgg 163391 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 392 tctgggtctgggtctgggtctgcgtctgg 420 |||||||||||||||||| ||| |||||| Sbjct: 164665 tctgggtctgggtctgggactgggtctgg 164693 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtc 411 ||||||||||||||||||||| Sbjct: 163115 gtctgggtctgggtctgggtc 163135 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 163712 gtctgggtctgggtctgggt 163731 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 162934 gtctgggtctgggtctgggt 162953
>emb|AL591478.19| Mouse DNA sequence from clone RP23-140D14 on chromosome 2, complete sequence Length = 236979 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 390 tgtctgggtctgggtctgggtctgcgtctg 419 |||||||||||||||||||||||| ||||| Sbjct: 162256 tgtctgggtctgggtctgggtctgggtctg 162227 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 397 gtctgggtctgggtctgcgtctgg 420 ||||||||||||||||| |||||| Sbjct: 162255 gtctgggtctgggtctgggtctgg 162232
>emb|AL731851.13| Mouse DNA sequence from clone RP23-362N19 on chromosome 2, complete sequence Length = 207372 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 36685 gtctgggtctgggtctgggtctgggtctgg 36714 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||||| |||||| Sbjct: 36463 gtctgggtctgggtctgggtctgggtctgg 36492 Score = 48.1 bits (24), Expect = 0.024 Identities = 27/28 (96%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||| |||||||||||||||||||||| Sbjct: 36993 ctggggctgggtctgggtctgcgtctgg 37020 Score = 48.1 bits (24), Expect = 0.024 Identities = 27/28 (96%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||| |||||| Sbjct: 36681 ctgggtctgggtctgggtctgggtctgg 36708 Score = 48.1 bits (24), Expect = 0.024 Identities = 27/28 (96%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||| |||||| Sbjct: 36459 ctgggtctgggtctgggtctgggtctgg 36486 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctg 413 ||||||||||||||||||||||| Sbjct: 36391 gtctgggtctgggtctgggtctg 36413 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||| ||||||||| |||||| Sbjct: 36853 gtctgggtctggggctgggtctgggtctgg 36882 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||| ||| |||||| Sbjct: 36787 gtctgggtctgggtctggggctgggtctgg 36816 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||| ||||||||||||||| |||||| Sbjct: 36775 gtctggggctgggtctgggtctgggtctgg 36804 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||| ||||||||| |||||| Sbjct: 36769 gtctgggtctggggctgggtctgggtctgg 36798 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||| ||| |||||| Sbjct: 36763 gtctgggtctgggtctggggctgggtctgg 36792 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||| ||||||||||||||| |||||| Sbjct: 36751 gtctggggctgggtctgggtctgggtctgg 36780 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||| ||| |||||| Sbjct: 36697 gtctgggtctgggtctggggctgggtctgg 36726 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||| ||||||||||||||| |||||| Sbjct: 36409 gtctgggcctgggtctgggtctgggtctgg 36438 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||| ||||||||| |||||| Sbjct: 36403 gtctgggtctgggcctgggtctgggtctgg 36432 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||| ||| |||||| Sbjct: 36397 gtctgggtctgggtctgggcctgggtctgg 36426 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctg 413 ||||||||||||||||||||| Sbjct: 36963 ctgggtctgggtctgggtctg 36983 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 392 tctgggtctgggtctgggtctgcgtctgg 420 |||| ||||||||||||||||| |||||| Sbjct: 36386 tctgcgtctgggtctgggtctgggtctgg 36414 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||| ||||||||||||||| |||||| Sbjct: 36957 ctggggctgggtctgggtctgggtctgg 36984 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||| ||| |||||| Sbjct: 36867 ctgggtctgggtctggggctgggtctgg 36894 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||| ||| |||||| Sbjct: 36849 ctgggtctgggtctggggctgggtctgg 36876 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||||||||| ||||||||| |||||| Sbjct: 36837 ctgggtctggggctgggtctgggtctgg 36864 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||| ||| |||||| Sbjct: 36819 ctgggtctgggtctggggctgggtctgg 36846 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||||||||| ||||||||| |||||| Sbjct: 36807 ctgggtctggggctgggtctgggtctgg 36834 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||||||||| ||||||||| |||||| Sbjct: 36747 ctgggtctggggctgggtctgggtctgg 36774 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||| ||| |||||| Sbjct: 36729 ctgggtctgggtctggggctgggtctgg 36756 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||||||||| ||||||||| |||||| Sbjct: 36717 ctgggtctggggctgggtctgggtctgg 36744 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||| ||||||||||||||| |||||| Sbjct: 36675 ctggggctgggtctgggtctgggtctgg 36702 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||| ||||||||||||||| |||||| Sbjct: 36453 ctgggcctgggtctgggtctgggtctgg 36480
>gb|AC157802.8| Mus musculus chromosome 1, clone RP24-297D18, complete sequence Length = 154309 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctg 419 ||||||||||||||||||||||| ||||| Sbjct: 45507 gtctgggtctgggtctgggtctgggtctg 45479 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 395 gggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||| |||||| Sbjct: 45509 gggtctgggtctgggtctgggtctgg 45484
>emb|BX511198.8| Mouse DNA sequence from clone RP23-390P10 on chromosome 4, complete sequence Length = 183261 Score = 50.1 bits (25), Expect = 0.006 Identities = 31/33 (93%) Strand = Plus / Minus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||| ||||||||||||||||| |||||| Sbjct: 133367 tgtgtctgtgtctgggtctgggtctgagtctgg 133335 Score = 48.1 bits (24), Expect = 0.024 Identities = 30/32 (93%) Strand = Plus / Minus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctg 419 |||||||||||||||||||| ||||| ||||| Sbjct: 133361 tgtgtctgggtctgggtctgagtctgggtctg 133330 Score = 40.1 bits (20), Expect = 5.8 Identities = 29/32 (90%) Strand = Plus / Minus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctg 419 |||||||| ||||| ||||||||||| ||||| Sbjct: 133373 tgtgtctgtgtctgtgtctgggtctgggtctg 133342
>gb|AC120370.9| Mus musculus chromosome 1, clone RP24-441N3, complete sequence Length = 163929 Score = 50.1 bits (25), Expect = 0.006 Identities = 28/29 (96%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctg 419 ||||||||||||||||||||||| ||||| Sbjct: 156066 gtctgggtctgggtctgggtctgggtctg 156094 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Plus Query: 395 gggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||| |||||| Sbjct: 156064 gggtctgggtctgggtctgggtctgg 156089
>gb|AC129332.6| Mus musculus BAC clone RP23-91I19 from chromosome 9, complete sequence Length = 219117 Score = 48.1 bits (24), Expect = 0.024 Identities = 27/28 (96%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||| |||||| Sbjct: 44383 ctgggtctgggtctgggtctgggtctgg 44410 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctg 413 ||||||||||||||||||||||| Sbjct: 44387 gtctgggtctgggtctgggtctg 44409 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||| ||||||||||||||| |||||| Sbjct: 44377 ctgggcctgggtctgggtctgggtctgg 44404
>ref|XM_989881.1| PREDICTED: Mus musculus BAT2 domain containing 1 (Bat2d), mRNA Length = 10205 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgc 414 |||||||||||||||||||||||| Sbjct: 5949 gtctgggtctgggtctgggtctgc 5926 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 394 tgggtctgggtctgggtctgcgtctg 419 |||||||||||||||||||| ||||| Sbjct: 5952 tgggtctgggtctgggtctgggtctg 5927
>ref|XM_976536.1| PREDICTED: Mus musculus BAT2 domain containing 1, transcript variant 6 (Bat2d), mRNA Length = 7213 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgc 414 |||||||||||||||||||||||| Sbjct: 5949 gtctgggtctgggtctgggtctgc 5926 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 394 tgggtctgggtctgggtctgcgtctg 419 |||||||||||||||||||| ||||| Sbjct: 5952 tgggtctgggtctgggtctgggtctg 5927
>ref|XM_896654.2| PREDICTED: Mus musculus BAT2 domain containing 1, transcript variant 5 (Bat2d), mRNA Length = 7408 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgc 414 |||||||||||||||||||||||| Sbjct: 5949 gtctgggtctgggtctgggtctgc 5926 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 394 tgggtctgggtctgggtctgcgtctg 419 |||||||||||||||||||| ||||| Sbjct: 5952 tgggtctgggtctgggtctgggtctg 5927
>ref|XM_896646.2| PREDICTED: Mus musculus BAT2 domain containing 1, transcript variant 4 (Bat2d), mRNA Length = 11322 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgc 414 |||||||||||||||||||||||| Sbjct: 5949 gtctgggtctgggtctgggtctgc 5926 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 394 tgggtctgggtctgggtctgcgtctg 419 |||||||||||||||||||| ||||| Sbjct: 5952 tgggtctgggtctgggtctgggtctg 5927
>ref|XM_976724.1| PREDICTED: Mus musculus BAT2 domain containing 1, transcript variant 7 (Bat2d), mRNA Length = 10207 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgc 414 |||||||||||||||||||||||| Sbjct: 5949 gtctgggtctgggtctgggtctgc 5926 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 394 tgggtctgggtctgggtctgcgtctg 419 |||||||||||||||||||| ||||| Sbjct: 5952 tgggtctgggtctgggtctgggtctg 5927
>ref|XM_148990.7| PREDICTED: Mus musculus BAT2 domain containing 1, transcript variant 1 (Bat2d), mRNA Length = 10497 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgc 414 |||||||||||||||||||||||| Sbjct: 5949 gtctgggtctgggtctgggtctgc 5926 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 394 tgggtctgggtctgggtctgcgtctg 419 |||||||||||||||||||| ||||| Sbjct: 5952 tgggtctgggtctgggtctgggtctg 5927
>ref|XM_886288.2| PREDICTED: Mus musculus BAT2 domain containing 1, transcript variant 2 (Bat2d), mRNA Length = 10444 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgc 414 |||||||||||||||||||||||| Sbjct: 5949 gtctgggtctgggtctgggtctgc 5926 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 394 tgggtctgggtctgggtctgcgtctg 419 |||||||||||||||||||| ||||| Sbjct: 5952 tgggtctgggtctgggtctgggtctg 5927
>ref|XM_924908.2| PREDICTED: Mus musculus BAT2 domain containing 1, transcript variant 11 (Bat2d), mRNA Length = 7408 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgc 414 |||||||||||||||||||||||| Sbjct: 5949 gtctgggtctgggtctgggtctgc 5926 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 394 tgggtctgggtctgggtctgcgtctg 419 |||||||||||||||||||| ||||| Sbjct: 5952 tgggtctgggtctgggtctgggtctg 5927
>ref|XM_917352.2| PREDICTED: Mus musculus BAT2 domain containing 1, transcript variant 9 (Bat2d), mRNA Length = 11321 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgc 414 |||||||||||||||||||||||| Sbjct: 5949 gtctgggtctgggtctgggtctgc 5926 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 394 tgggtctgggtctgggtctgcgtctg 419 |||||||||||||||||||| ||||| Sbjct: 5952 tgggtctgggtctgggtctgggtctg 5927
>ref|XM_001002638.1| PREDICTED: Mus musculus BAT2 domain containing 1, transcript variant 12 (Bat2d), mRNA Length = 10206 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgc 414 |||||||||||||||||||||||| Sbjct: 5949 gtctgggtctgggtctgggtctgc 5926 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 394 tgggtctgggtctgggtctgcgtctg 419 |||||||||||||||||||| ||||| Sbjct: 5952 tgggtctgggtctgggtctgggtctg 5927
>gb|AC137845.9| Mus musculus chromosome 1, clone RP23-430H22, complete sequence Length = 213882 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 387 gtgtgtctgggtctgggtctgggt 410 |||||||||||||||||||||||| Sbjct: 194474 gtgtgtctgggtctgggtctgggt 194451
>dbj|AK079353.1| Mus musculus 16 days neonate cerebellum cDNA, RIKEN full-length enriched library, clone:9630039I18 product:MAMMA1003150 PROTEIN (FRAGMENT) homolog [Homo sapiens], full insert sequence Length = 3783 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgc 414 |||||||||||||||||||||||| Sbjct: 621 gtctgggtctgggtctgggtctgc 598 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 394 tgggtctgggtctgggtctgcgtctg 419 |||||||||||||||||||| ||||| Sbjct: 624 tgggtctgggtctgggtctgggtctg 599
>dbj|AK041391.1| Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A630006J20 product:similar to KIAA1096 PROTEIN (FRAGMENT) [Homo sapiens], full insert sequence Length = 1960 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgc 414 |||||||||||||||||||||||| Sbjct: 1402 gtctgggtctgggtctgggtctgc 1379 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 394 tgggtctgggtctgggtctgcgtctg 419 |||||||||||||||||||| ||||| Sbjct: 1405 tgggtctgggtctgggtctgggtctg 1380
>gb|AC008313.3|AC008313 Drosophila melanogaster, chromosome 3R, region 84D-84E, BAC clone BACR11D12, complete sequence Length = 189596 Score = 48.1 bits (24), Expect = 0.024 Identities = 27/28 (96%) Strand = Plus / Minus Query: 394 tgggtctgggtctgggtctgcgtctggc 421 |||||||||||||||||||| ||||||| Sbjct: 151940 tgggtctgggtctgggtctgggtctggc 151913 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctg 413 ||||||||||||||||||||||| Sbjct: 151937 gtctgggtctgggtctgggtctg 151915
>gb|AC123690.19| Mus musculus chromosome 1, clone RP23-322M7, complete sequence Length = 191990 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 387 gtgtgtctgggtctgggtctgggt 410 |||||||||||||||||||||||| Sbjct: 45247 gtgtgtctgggtctgggtctgggt 45224
>gb|BC050871.1| Mus musculus BAT2 domain containing 1, mRNA (cDNA clone IMAGE:6392804), partial cds Length = 6171 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgc 414 |||||||||||||||||||||||| Sbjct: 1573 gtctgggtctgggtctgggtctgc 1550 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 394 tgggtctgggtctgggtctgcgtctg 419 |||||||||||||||||||| ||||| Sbjct: 1576 tgggtctgggtctgggtctgggtctg 1551
>gb|AC132867.6| Mus musculus chromosome 1, clone RP24-388I23, complete sequence Length = 209151 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgc 414 |||||||||||||||||||||||| Sbjct: 203129 gtctgggtctgggtctgggtctgc 203152 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Plus Query: 394 tgggtctgggtctgggtctgcgtctg 419 |||||||||||||||||||| ||||| Sbjct: 203126 tgggtctgggtctgggtctgggtctg 203151
>emb|AL442108.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0124E07, complete sequence Length = 127181 Score = 48.1 bits (24), Expect = 0.024 Identities = 27/28 (96%) Strand = Plus / Plus Query: 228 ggccggcgacagcgccaccaccgctcga 255 |||||||||||| ||||||||||||||| Sbjct: 89274 ggccggcgacagtgccaccaccgctcga 89301
>gb|AE003676.4| Drosophila melanogaster chromosome 3R, section 14 of 118 of the complete sequence Length = 267607 Score = 48.1 bits (24), Expect = 0.024 Identities = 27/28 (96%) Strand = Plus / Minus Query: 394 tgggtctgggtctgggtctgcgtctggc 421 |||||||||||||||||||| ||||||| Sbjct: 228479 tgggtctgggtctgggtctgggtctggc 228452 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctg 413 ||||||||||||||||||||||| Sbjct: 228476 gtctgggtctgggtctgggtctg 228454
>gb|AC118643.6| Mus musculus chromosome 1, clone RP24-113H21, complete sequence Length = 184206 Score = 48.1 bits (24), Expect = 0.024 Identities = 24/24 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgc 414 |||||||||||||||||||||||| Sbjct: 147016 gtctgggtctgggtctgggtctgc 146993 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 394 tgggtctgggtctgggtctgcgtctg 419 |||||||||||||||||||| ||||| Sbjct: 147019 tgggtctgggtctgggtctgggtctg 146994
>emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB122 of Yarrowia lipolytica Length = 3272609 Score = 48.1 bits (24), Expect = 0.024 Identities = 27/28 (96%) Strand = Plus / Minus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||| |||||| Sbjct: 116828 ctgggtctgggtctgggtctgggtctgg 116801 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctg 413 ||||||||||||||||||||||| Sbjct: 116824 gtctgggtctgggtctgggtctg 116802 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtc 411 ||||||||||||||||||||| Sbjct: 116818 gtctgggtctgggtctgggtc 116798
>gb|AC161528.14| Mus musculus chromosome 8, clone RP23-369H18, complete sequence Length = 206302 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 390 tgtctgggtctgggtctgggtct 412 ||||||||||||||||||||||| Sbjct: 24551 tgtctgggtctgggtctgggtct 24573 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Plus Query: 392 tctgggtctgggtctgggtctg 413 |||||||||||||||||||||| Sbjct: 24723 tctgggtctgggtctgggtctg 24744 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 |||||||||||||||| |||||| |||||| Sbjct: 24558 gtctgggtctgggtctaggtctgggtctgg 24587
>gb|AC124749.5| Mus musculus BAC clone RP23-262G23 from chromosome 5, complete sequence Length = 209986 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctg 413 ||||||||||||||||||||||| Sbjct: 186837 gtctgggtctgggtctgggtctg 186859 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Plus Query: 395 gggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||| |||||| Sbjct: 186835 gggtctgggtctgggtctgggtctgg 186860 Score = 40.1 bits (20), Expect = 5.8 Identities = 32/36 (88%) Strand = Plus / Minus Query: 384 ggagtgtgtctgggtctgggtctgggtctgcgtctg 419 |||||||||||| ||||| ||||| ||||| ||||| Sbjct: 203484 ggagtgtgtctgtgtctgtgtctgtgtctgtgtctg 203449
>gb|AC137154.2| Mus musculus BAC clone RP24-572L22 from chromosome 5, complete sequence Length = 173460 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctg 413 ||||||||||||||||||||||| Sbjct: 8502 gtctgggtctgggtctgggtctg 8524 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Plus Query: 395 gggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||| |||||| Sbjct: 8500 gggtctgggtctgggtctgggtctgg 8525 Score = 40.1 bits (20), Expect = 5.8 Identities = 32/36 (88%) Strand = Plus / Minus Query: 384 ggagtgtgtctgggtctgggtctgggtctgcgtctg 419 |||||||||||| ||||| ||||| ||||| ||||| Sbjct: 25149 ggagtgtgtctgtgtctgtgtctgtgtctgtgtctg 25114
>gb|AC124176.3| Mus musculus BAC clone RP23-184D18 from 7, complete sequence Length = 180922 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 390 tgtctgggtctgggtctgggtct 412 ||||||||||||||||||||||| Sbjct: 144726 tgtctgggtctgggtctgggtct 144748
>emb|AL591491.5| Human DNA sequence from clone RP11-435K1 on chromosome Xp15.3-15.5 Contains the 5' end of a novel gene (FLJ14103 FLJ37558) and the 5' end of a novel gene, complete sequence Length = 121720 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctg 413 ||||||||||||||||||||||| Sbjct: 87796 gtctgggtctgggtctgggtctg 87818 Score = 46.1 bits (23), Expect = 0.093 Identities = 26/27 (96%) Strand = Plus / Plus Query: 394 tgggtctgggtctgggtctgcgtctgg 420 |||||||||||||||||||| |||||| Sbjct: 87793 tgggtctgggtctgggtctgggtctgg 87819
>emb|AL359704.9| Human DNA sequence from clone RP11-118H4 on chromosome 1 Contains the 5' end of the ADPRT gene for ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase), a ribosomal protein S3A (RPS3A) pseudogene, a novel pseudogene, the 5' end of a novel gene (DKFZp761P211) and a CpG island, complete sequence Length = 171501 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctg 413 ||||||||||||||||||||||| Sbjct: 149361 gtctgggtctgggtctgggtctg 149339 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 395 gggtctgggtctgggtctgcgtctg 419 ||||||||||||||||||| ||||| Sbjct: 149363 gggtctgggtctgggtctgggtctg 149339
>gb|AC093454.3| Drosophila melanogaster 3L BAC RP98-23K2 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 168479 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctg 413 ||||||||||||||||||||||| Sbjct: 8116 gtctgggtctgggtctgggtctg 8138 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 396 ggtctgggtctgggtctgcgtctgg 420 |||||||||||||||||| |||||| Sbjct: 8115 ggtctgggtctgggtctgggtctgg 8139
>gb|AF524947.1| Homo sapiens ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase) (ADPRT) gene, complete cds Length = 47770 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctg 413 ||||||||||||||||||||||| Sbjct: 2958 gtctgggtctgggtctgggtctg 2936 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 395 gggtctgggtctgggtctgcgtctg 419 ||||||||||||||||||| ||||| Sbjct: 2960 gggtctgggtctgggtctgggtctg 2936
>gb|AC010660.6| Drosophila melanogaster 3L BAC RP98-9I16 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 186795 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctg 413 ||||||||||||||||||||||| Sbjct: 29896 gtctgggtctgggtctgggtctg 29874 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 396 ggtctgggtctgggtctgcgtctgg 420 |||||||||||||||||| |||||| Sbjct: 29897 ggtctgggtctgggtctgggtctgg 29873
>ref|NM_140602.1| Drosophila melanogaster CG13050-RA (CG13050), mRNA Length = 432 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctg 413 ||||||||||||||||||||||| Sbjct: 371 gtctgggtctgggtctgggtctg 393 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 396 ggtctgggtctgggtctgcgtctgg 420 |||||||||||||||||| |||||| Sbjct: 370 ggtctgggtctgggtctgggtctgg 394
>gb|L41144.1|BNACLPPA Brassica oleracea ClpP (clpP) mRNA, partial cds Length = 971 Score = 46.1 bits (23), Expect = 0.093 Identities = 26/27 (96%) Strand = Plus / Minus Query: 385 gagtgtgtctgggtctgggtctgggtc 411 |||| |||||||||||||||||||||| Sbjct: 81 gagtttgtctgggtctgggtctgggtc 55
>gb|AC154562.2| Mus musculus BAC clone RP23-400N5 from chromosome 14, complete sequence Length = 180365 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Minus Query: 390 tgtctgggtctgggtctgggtct 412 ||||||||||||||||||||||| Sbjct: 17439 tgtctgggtctgggtctgggtct 17417
>gb|AC136489.3| Homo sapiens chromosome X clone RP13-749I18 map Xp11.3 complete sequence Length = 164468 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctg 413 ||||||||||||||||||||||| Sbjct: 164441 gtctgggtctgggtctgggtctg 164463 Score = 46.1 bits (23), Expect = 0.093 Identities = 26/27 (96%) Strand = Plus / Plus Query: 394 tgggtctgggtctgggtctgcgtctgg 420 |||||||||||||||||||| |||||| Sbjct: 164438 tgggtctgggtctgggtctgggtctgg 164464
>emb|AL929215.18| Mouse DNA sequence from clone RP23-8L8 on chromosome 2, complete sequence Length = 159804 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctg 413 ||||||||||||||||||||||| Sbjct: 80731 gtctgggtctgggtctgggtctg 80709 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 396 ggtctgggtctgggtctgcgtctgg 420 |||||||||||||||||| |||||| Sbjct: 80732 ggtctgggtctgggtctgggtctgg 80708
>gb|AE003528.3| Drosophila melanogaster chromosome 3L, section 57 of 83 of the complete sequence Length = 283815 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctg 413 ||||||||||||||||||||||| Sbjct: 258275 gtctgggtctgggtctgggtctg 258253 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 396 ggtctgggtctgggtctgcgtctgg 420 |||||||||||||||||| |||||| Sbjct: 258276 ggtctgggtctgggtctgggtctgg 258252
>gb|AC164107.3| Mus musculus BAC clone RP23-461D6 from chromosome 14, complete sequence Length = 181095 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Minus Query: 390 tgtctgggtctgggtctgggtct 412 ||||||||||||||||||||||| Sbjct: 180099 tgtctgggtctgggtctgggtct 180077
>emb|AL929110.10| Mouse DNA sequence from clone RP23-275P20 on chromosome 2, complete sequence Length = 186386 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Minus Query: 390 tgtctgggtctgggtctgggtct 412 ||||||||||||||||||||||| Sbjct: 75881 tgtctgggtctgggtctgggtct 75859
>emb|X01801.1|MMNGFA2 Mouse gene for nerve growth factor alpha-subunit exons 2-5 and 3' flanking region Length = 2508 Score = 46.1 bits (23), Expect = 0.093 Identities = 23/23 (100%) Strand = Plus / Plus Query: 390 tgtctgggtctgggtctgggtct 412 ||||||||||||||||||||||| Sbjct: 686 tgtctgggtctgggtctgggtct 708
>gb|AY714813.1| Cercopithecine herpesvirus 2, complete genome Length = 150715 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Plus Query: 395 gggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||| |||| Sbjct: 119751 gggtctgggtctgggtctgcgcctgg 119776 Score = 44.1 bits (22), Expect = 0.37 Identities = 29/30 (96%), Gaps = 1/30 (3%) Strand = Plus / Plus Query: 399 ctgggtctgggtctgcgtctg-gcccgggc 427 ||||||||||||||||||||| |||||||| Sbjct: 119581 ctgggtctgggtctgcgtctgagcccgggc 119610 Score = 44.1 bits (22), Expect = 0.37 Identities = 29/30 (96%), Gaps = 1/30 (3%) Strand = Plus / Minus Query: 399 ctgggtctgggtctgcgtctg-gcccgggc 427 ||||||||||||||||||||| |||||||| Sbjct: 3949 ctgggtctgggtctgcgtctgagcccgggc 3920 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 395 gggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||||| |||| Sbjct: 3779 gggtctgggtctgggtctgcgcctgg 3754
>gb|AC163612.3| Mus musculus BAC clone RP23-89N5 from chromosome 16, complete sequence Length = 207953 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtct 412 |||||||||||||||||||||| Sbjct: 73959 gtctgggtctgggtctgggtct 73980 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 394 tgggtctgggtctgggtctgcgtct 418 |||||||||||||||||||| |||| Sbjct: 73956 tgggtctgggtctgggtctgggtct 73980
>ref|NM_001030903.1| Gallus gallus palmitoyl-protein thioesterase 1 (ceroid-lipofuscinosis, neuronal 1, infantile) (PPT1), mRNA Length = 1602 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctg 413 |||| ||||||||||||||||||||| Sbjct: 49 tgtggctgggtctgggtctgggtctg 74 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 58 gtctgggtctgggtctgggt 77
>gb|AC111129.12| Mus musculus chromosome 5, clone RP23-339H11, complete sequence Length = 196458 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 |||||||||||||| |||||||| |||||| Sbjct: 28332 gtctgggtctgggtttgggtctgagtctgg 28361 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 28136 gtctgggtctgggtctgggt 28155
>ref|XM_361561.1| Magnaporthe grisea 70-15 predicted protein (MG04035.4) partial mRNA Length = 381 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Plus Query: 392 tctgggtctgggtctgggtctg 413 |||||||||||||||||||||| Sbjct: 307 tctgggtctgggtctgggtctg 328
>ref|XM_366106.1| Magnaporthe grisea 70-15 hypothetical protein (MG10326.4) partial mRNA Length = 324 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctgcgtctggcc 422 ||||||||||||||||||||| | |||||| Sbjct: 59 ctgggtctgggtctgggtctgggcctggcc 88 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 392 tctgggtctgggtctgggtctgcgtctgg 420 |||||| ||||||||||||||| |||||| Sbjct: 52 tctggggctgggtctgggtctgggtctgg 80
>emb|CR762181.2| Xenopus tropicalis finished cDNA, clone TGas054b08 Length = 2478 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Minus Query: 392 tctgggtctgggtctgggtctgcgtctggc 421 ||||||||||| |||||||||| ||||||| Sbjct: 1051 tctgggtctggctctgggtctgggtctggc 1022
>gb|AC110238.10| Mus musculus chromosome 5, clone RP23-106D12, complete sequence Length = 197964 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 |||||||||||||| |||||||| |||||| Sbjct: 155303 gtctgggtctgggtttgggtctgagtctgg 155332 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 155107 gtctgggtctgggtctgggt 155126
>gb|AF433663.1| Homo sapiens unknown mRNA Length = 1262 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Minus Query: 392 tctgggtctgggtctgggtctg 413 |||||||||||||||||||||| Sbjct: 250 tctgggtctgggtctgggtctg 229 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtc 411 ||||||||||||||||||||| Sbjct: 245 gtctgggtctgggtctgggtc 225
>gb|AC154601.3| Mus musculus BAC clone RP23-342J18 from chromosome 16, complete sequence Length = 189457 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 |||||||||||||||||| |||| |||||| Sbjct: 14511 gtctgggtctgggtctggttctgggtctgg 14482 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 |||||||||||| |||||||||| |||||| Sbjct: 14505 gtctgggtctggttctgggtctgggtctgg 14476 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 392 tctgggtctgggtctgggtct 412 ||||||||||||||||||||| Sbjct: 14492 tctgggtctgggtctgggtct 14472 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 394 tgggtctgggtctgggtctg 413 |||||||||||||||||||| Sbjct: 14514 tgggtctgggtctgggtctg 14495 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtct 418 |||||| |||||||||||||||| |||| Sbjct: 14499 gtctggttctgggtctgggtctgggtct 14472
>ref|NM_001016091.2| Xenopus tropicalis ring finger protein 12 (rnf12), mRNA Length = 2478 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Minus Query: 392 tctgggtctgggtctgggtctgcgtctggc 421 ||||||||||| |||||||||| ||||||| Sbjct: 1051 tctgggtctggctctgggtctgggtctggc 1022
>emb|AJ720351.1| Gallus gallus mRNA for hypothetical protein, clone 15o4 Length = 1602 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctg 413 |||| ||||||||||||||||||||| Sbjct: 49 tgtggctgggtctgggtctgggtctg 74 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 58 gtctgggtctgggtctgggt 77
>emb|CR523238.1| Gallus gallus finished cDNA, clone ChEST620p4 Length = 1019 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctg 413 |||| ||||||||||||||||||||| Sbjct: 26 tgtggctgggtctgggtctgggtctg 51 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 35 gtctgggtctgggtctgggt 54
>emb|BX537155.6| Mouse DNA sequence from clone RP24-118I4 on chromosome 2, complete sequence Length = 52020 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 388 tgtgtctgggtctgggtctgggtctg 413 |||||||||||||| ||||||||||| Sbjct: 5601 tgtgtctgggtctgtgtctgggtctg 5576 Score = 42.1 bits (21), Expect = 1.5 Identities = 30/33 (90%) Strand = Plus / Minus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||||||||| ||||| ||||| |||||| Sbjct: 5625 tgtgtctgggtctgtgtctgtgtctgtgtctgg 5593 Score = 42.1 bits (21), Expect = 1.5 Identities = 30/33 (90%) Strand = Plus / Minus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||| ||||| ||||||||||| |||||| Sbjct: 5613 tgtgtctgtgtctgtgtctgggtctgtgtctgg 5581 Score = 42.1 bits (21), Expect = 1.5 Identities = 30/33 (90%) Strand = Plus / Minus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||||||| ||||||||||| ||||| |||||| Sbjct: 5607 tgtgtctgtgtctgggtctgtgtctgggtctgg 5575 Score = 40.1 bits (20), Expect = 5.8 Identities = 29/32 (90%) Strand = Plus / Minus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctg 419 |||||||| ||||| ||||||||||| ||||| Sbjct: 5637 tgtgtctgtgtctgtgtctgggtctgtgtctg 5606 Score = 40.1 bits (20), Expect = 5.8 Identities = 29/32 (90%) Strand = Plus / Minus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctg 419 |||||||| ||||||||||| ||||| ||||| Sbjct: 5631 tgtgtctgtgtctgggtctgtgtctgtgtctg 5600
>gb|AC008105.32| Homo sapiens chromosome 17, clone CTD-2020K17, complete sequence Length = 96875 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Plus Query: 392 tctgggtctgggtctgggtctg 413 |||||||||||||||||||||| Sbjct: 87780 tctgggtctgggtctgggtctg 87801 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtc 411 ||||||||||||||||||||| Sbjct: 87785 gtctgggtctgggtctgggtc 87805
>gb|AC153587.2| Mus musculus 6 BAC RP23-361L1 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 232002 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 |||||||||||||| |||||||| |||||| Sbjct: 180957 gtctgggtctgggtgtgggtctgggtctgg 180928 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 |||||||| |||||||||||||| |||||| Sbjct: 180951 gtctgggtgtgggtctgggtctgggtctgg 180922 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtc 411 ||||||||||||||||||||| Sbjct: 180922 gtctgggtctgggtctgggtc 180902
>gb|AC006247.12|AC006247 Drosophila melanogaster, chromosome 2R, region 49E6-49F8, BAC clone BACR48I10, complete sequence Length = 163162 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Plus Query: 386 agtgtgtctgggtctgggtctgggtc 411 |||||||||||||| ||||||||||| Sbjct: 45233 agtgtgtctgggtcagggtctgggtc 45258
>gb|AC154312.2| Mus musculus BAC clone RP23-354D20 from chromosome 16, complete sequence Length = 197884 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtct 412 |||||||||||||||||||||| Sbjct: 141011 gtctgggtctgggtctgggtct 141032 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 394 tgggtctgggtctgggtctgcgtct 418 |||||||||||||||||||| |||| Sbjct: 141008 tgggtctgggtctgggtctgggtct 141032
>gb|AC154436.2| Mus musculus BAC clone RP24-192B24 from chromosome 14, complete sequence Length = 180476 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 387 gtgtgtctgggtctgggtctgggtct 412 |||||| ||||||||||||||||||| Sbjct: 159166 gtgtgtgtgggtctgggtctgggtct 159141
>gb|AF065165.1|AF065165 Sciaenops ocellatus growth hormone precursor, mRNA, complete cds Length = 879 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Minus Query: 392 tctgggtctgggtctgggtctg 413 |||||||||||||||||||||| Sbjct: 43 tctgggtctgggtctgggtctg 22 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 |||||| |||||||||||||||| |||||| Sbjct: 50 gtctggttctgggtctgggtctgggtctgg 21
>dbj|AK058143.1| Homo sapiens cDNA FLJ25414 fis, clone TST03428 Length = 1284 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Minus Query: 392 tctgggtctgggtctgggtctg 413 |||||||||||||||||||||| Sbjct: 284 tctgggtctgggtctgggtctg 263 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtc 411 ||||||||||||||||||||| Sbjct: 279 gtctgggtctgggtctgggtc 259
>gb|AE003819.3| Drosophila melanogaster chromosome 2R, section 31 of 73 of the complete sequence Length = 221945 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 386 agtgtgtctgggtctgggtctgggtc 411 |||||||||||||| ||||||||||| Sbjct: 77214 agtgtgtctgggtcagggtctgggtc 77189
>gb|AC005471.1|AC005471 Drosophila melanogaster, chromosome 2R, region 49F11-49F13, P1 clone DS01087, complete sequence Length = 50714 Score = 44.1 bits (22), Expect = 0.37 Identities = 25/26 (96%) Strand = Plus / Minus Query: 386 agtgtgtctgggtctgggtctgggtc 411 |||||||||||||| ||||||||||| Sbjct: 16216 agtgtgtctgggtcagggtctgggtc 16191
>gb|BC028124.1| Homo sapiens chromosome 17 open reading frame 46, mRNA (cDNA clone MGC:40175 IMAGE:5166606), complete cds Length = 1315 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Minus Query: 392 tctgggtctgggtctgggtctg 413 |||||||||||||||||||||| Sbjct: 239 tctgggtctgggtctgggtctg 218 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtc 411 ||||||||||||||||||||| Sbjct: 234 gtctgggtctgggtctgggtc 214
>ref|NM_152343.1| Homo sapiens chromosome 17 open reading frame 46 (C17orf46), mRNA Length = 1284 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Minus Query: 392 tctgggtctgggtctgggtctg 413 |||||||||||||||||||||| Sbjct: 284 tctgggtctgggtctgggtctg 263 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtc 411 ||||||||||||||||||||| Sbjct: 279 gtctgggtctgggtctgggtc 259
>gb|AC127263.4| Mus musculus BAC clone RP24-328P2 from 6, complete sequence Length = 149105 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||| ||| |||||| Sbjct: 81857 gtctgggtctgggtctgggactgggtctgg 81886 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctg 413 ||||||||||||||||||||| Sbjct: 81853 ctgggtctgggtctgggtctg 81873 Score = 42.1 bits (21), Expect = 1.5 Identities = 30/33 (90%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||| ||||| ||||||||||||||| |||||| Sbjct: 81842 tgtgactgggactgggtctgggtctgggtctgg 81874
>gb|AC166825.3| Mus musculus BAC clone RP23-368D12 from chromosome 6, complete sequence Length = 182232 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||||| ||| |||||| Sbjct: 165253 gtctgggtctgggtctgggactgggtctgg 165224 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 393 ctgggtctgggtctgggtctg 413 ||||||||||||||||||||| Sbjct: 165257 ctgggtctgggtctgggtctg 165237 Score = 42.1 bits (21), Expect = 1.5 Identities = 30/33 (90%) Strand = Plus / Minus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||| ||||| ||||||||||||||| |||||| Sbjct: 165268 tgtgactgggactgggtctgggtctgggtctgg 165236
>emb|AL845172.3| Mouse DNA sequence from clone RP23-285J17 on chromosome 2, complete sequence Length = 185138 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 |||||||| |||||||||||||| |||||| Sbjct: 141791 gtctgggtgtgggtctgggtctgggtctgg 141820 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 |||||||||||||| |||||||| |||||| Sbjct: 141785 gtctgggtctgggtgtgggtctgggtctgg 141814 Score = 44.1 bits (22), Expect = 0.37 Identities = 28/30 (93%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgcgtctgg 420 |||||||||||||||||||| || |||||| Sbjct: 141779 gtctgggtctgggtctgggtgtgggtctgg 141808 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 394 tgggtctgggtctgggtctg 413 |||||||||||||||||||| Sbjct: 141776 tgggtctgggtctgggtctg 141795
>emb|AL589670.21| Mouse DNA sequence from clone RP23-414K1 on chromosome 15, complete sequence Length = 203230 Score = 44.1 bits (22), Expect = 0.37 Identities = 22/22 (100%) Strand = Plus / Plus Query: 392 tctgggtctgggtctgggtctg 413 |||||||||||||||||||||| Sbjct: 173939 tctgggtctgggtctgggtctg 173960
>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence Length = 3587082 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 253 cgacgacgcgcgcgcggtcgc 273 ||||||||||||||||||||| Sbjct: 2246710 cgacgacgcgcgcgcggtcgc 2246730
>gb|AC165240.6| Mus musculus chromosome 5, clone RP24-174P7, complete sequence Length = 196437 Score = 42.1 bits (21), Expect = 1.5 Identities = 30/33 (90%) Strand = Plus / Minus Query: 387 gtgtgtctgggtctgggtctgggtctgcgtctg 419 ||||||||| ||||| ||||| ||||||||||| Sbjct: 10096 gtgtgtctgtgtctgcgtctgtgtctgcgtctg 10064
>gb|AC118318.7| Rattus norvegicus 7 BAC CH230-15G17 (Children's Hospital Oakland Research Institute) complete sequence Length = 128601 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 389 gtgtctgggtctgggtctggg 409 ||||||||||||||||||||| Sbjct: 112186 gtgtctgggtctgggtctggg 112166 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 390 tgtctgggtctgggtctggg 409 |||||||||||||||||||| Sbjct: 112368 tgtctgggtctgggtctggg 112349
>ref|XM_951563.1| Neurospora crassa OR74A hypothetical protein (NCU05158.1) partial mRNA Length = 1014 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 392 tctgggtctgggtctgggtct 412 ||||||||||||||||||||| Sbjct: 736 tctgggtctgggtctgggtct 756
>ref|XM_952041.1| Neurospora crassa OR74A hypothetical protein (NCU06494.1) partial mRNA Length = 1905 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 392 tctgggtctgggtctgggtctgcgt 416 |||||||||| |||||||||||||| Sbjct: 1351 tctgggtctgagtctgggtctgcgt 1375
>ref|XM_953836.1| Neurospora crassa OR74A hypothetical protein (NCU09350.1) partial mRNA Length = 1722 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtc 411 ||||||||||||||||||||| Sbjct: 972 gtctgggtctgggtctgggtc 992
>ref|XM_324514.1| Neurospora crassa OR74A hypothetical protein (NCU05158.1) partial mRNA Length = 1014 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 392 tctgggtctgggtctgggtct 412 ||||||||||||||||||||| Sbjct: 736 tctgggtctgggtctgggtct 756
>ref|XM_326348.1| Neurospora crassa OR74A hypothetical protein (NCU06494.1) partial mRNA Length = 1905 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 392 tctgggtctgggtctgggtctgcgt 416 |||||||||| |||||||||||||| Sbjct: 1351 tctgggtctgagtctgggtctgcgt 1375
>ref|XM_332041.1| Neurospora crassa OR74A hypothetical protein (NCU09350.1) partial mRNA Length = 1722 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtc 411 ||||||||||||||||||||| Sbjct: 972 gtctgggtctgggtctgggtc 992
>ref|XM_658716.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN6204.2), mRNA Length = 4278 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 397 gtctgggtctgggtctgcgtc 417 ||||||||||||||||||||| Sbjct: 3620 gtctgggtctgggtctgcgtc 3600
>gb|AC125160.3| Mus musculus BAC clone RP24-409P4 from chromosome 7, complete sequence Length = 178643 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctg 413 ||||||||||||||||||||| Sbjct: 61493 ctgggtctgggtctgggtctg 61513
>gb|AC145592.3| Mus musculus BAC clone RP24-335F16 from chromosome y, complete sequence Length = 167384 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 390 tgtctgggtctgggtctgggt 410 ||||||||||||||||||||| Sbjct: 91827 tgtctgggtctgggtctgggt 91807
>gb|AC163903.4| Mus musculus BAC clone RP24-314J18 from chromosome 17, complete sequence Length = 197522 Score = 42.1 bits (21), Expect = 1.5 Identities = 30/33 (90%) Strand = Plus / Plus Query: 387 gtgtgtctgggtctgggtctgggtctgcgtctg 419 ||||||||| ||||| ||||| ||||||||||| Sbjct: 136321 gtgtgtctgcgtctgcgtctgcgtctgcgtctg 136353
>gb|AC159139.9| Mus musculus 10 BAC RP24-370M23 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 185202 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 390 tgtctgggtctgggtctgggt 410 ||||||||||||||||||||| Sbjct: 142871 tgtctgggtctgggtctgggt 142851
>gb|AC140554.3| Mus musculus BAC clone RP23-151C18 from chromosome 18, complete sequence Length = 215716 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 393 ctgggtctgggtctgggtctg 413 ||||||||||||||||||||| Sbjct: 26347 ctgggtctgggtctgggtctg 26327
>emb|CT009556.7| Mouse DNA sequence from clone RP23-87H19 on chromosome 14, complete sequence Length = 227368 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 393 ctgggtctgggtctgggtctgcgtctggc 421 |||||||| |||||||||||| ||||||| Sbjct: 158860 ctgggtcttggtctgggtctgggtctggc 158832
>ref|XM_391026.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG10850.1) partial mRNA Length = 2127 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctg 413 ||||||||||||||||||||| Sbjct: 2063 ctgggtctgggtctgggtctg 2083
>gb|AC109364.6| Mus musculus BAC clone RP23-127N24 from chromosome 17, complete sequence Length = 198838 Score = 42.1 bits (21), Expect = 1.5 Identities = 30/33 (90%) Strand = Plus / Minus Query: 387 gtgtgtctgggtctgggtctgggtctgcgtctg 419 ||||||||| ||||| ||||| ||||||||||| Sbjct: 184312 gtgtgtctgcgtctgcgtctgcgtctgcgtctg 184280
>gb|AC130204.4| Mus musculus BAC clone RP24-427M16 from chromosome 18, complete sequence Length = 167394 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 393 ctgggtctgggtctgggtctg 413 ||||||||||||||||||||| Sbjct: 84857 ctgggtctgggtctgggtctg 84837
>emb|Z82242.1|HS96A9 Human DNA sequence from clone RP1-96A9 on chromosome X Contains a CpG island, complete sequence Length = 91690 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 393 ctgggtctgggtctgggtctg 413 ||||||||||||||||||||| Sbjct: 69125 ctgggtctgggtctgggtctg 69105
>emb|AL359741.9| Human DNA sequence from clone RP11-161P17 on chromosome 13 Contains a novel pseudogene, complete sequence Length = 139877 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctg 413 ||||||||||||||||||||| Sbjct: 92862 ctgggtctgggtctgggtctg 92882
>gb|AC111678.6| Rattus norvegicus 18 BAC CH230-60A14 (Children's Hospital Oakland Research Institute) complete sequence Length = 146568 Score = 42.1 bits (21), Expect = 1.5 Identities = 30/33 (90%) Strand = Plus / Minus Query: 387 gtgtgtctgggtctgggtctgggtctgcgtctg 419 ||||||||| ||||| ||||| ||||||||||| Sbjct: 124541 gtgtgtctgcgtctgcgtctgcgtctgcgtctg 124509
>emb|BX284763.1|NCB19A17 Neurospora crassa DNA linkage group II BAC contig B19A17 Length = 155568 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 392 tctgggtctgggtctgggtct 412 ||||||||||||||||||||| Sbjct: 148489 tctgggtctgggtctgggtct 148469
>gb|AC132166.1| Drosophila pseudoobscura FOSMID DPSF1-548A16 (Children's Hospital Oakland Research Institute Drosophila pseudoobscura FOSMID Library) complete sequence Length = 40715 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 392 tctgggtctgggtctgggtctgcgtctgg 420 ||||||||||| |||||||||| |||||| Sbjct: 29275 tctgggtctggctctgggtctgggtctgg 29303 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 392 tctgggtctgggtctgggtc 411 |||||||||||||||||||| Sbjct: 29287 tctgggtctgggtctgggtc 29306
>gb|AC103579.10| Mus Musculus Strain C57BL6/J Chromosome 14 BAC Clone RP23-145J23, Complete Sequence, complete sequence Length = 227361 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctgcgtctggc 421 |||||||| |||||||||||| ||||||| Sbjct: 89179 ctgggtcttggtctgggtctgggtctggc 89207
>gb|AC114147.5| Rattus norvegicus BAC CH230-144F3 (Children's Hospital Oakland Research Institute Rat (BN/SsNHsd/MCW) BAC library) complete sequence Length = 214988 Score = 42.1 bits (21), Expect = 1.5 Identities = 30/33 (90%) Strand = Plus / Minus Query: 387 gtgtgtctgggtctgggtctgggtctgcgtctg 419 ||||||||| ||||| ||||| ||||||||||| Sbjct: 82259 gtgtgtctgcgtctgcgtctgcgtctgcgtctg 82227
>gb|AC023751.3| Drosophila melanogaster 3L BAC RP98-31C17 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 187437 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctg 413 ||||||||||||||||||||| Sbjct: 29853 ctgggtctgggtctgggtctg 29873 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||| ||||||||||||||| |||||| Sbjct: 29847 ctggggctgggtctgggtctgggtctgg 29874
>gb|AC010665.6| Drosophila melanogaster 3L BAC RP98-23H9 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 156526 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctg 413 ||||||||||||||||||||| Sbjct: 156009 ctgggtctgggtctgggtctg 156029 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||| ||||||||||||||| |||||| Sbjct: 156003 ctggggctgggtctgggtctgggtctgg 156030
>gb|AC113761.6| Rattus norvegicus X BAC CH230-91H16 (Children's Hospital Oakland Research Institute) complete sequence Length = 232930 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 388 tgtgtctgggtctgggtctgggtct 412 |||| |||||||||||||||||||| Sbjct: 213694 tgtgcctgggtctgggtctgggtct 213670
>gb|AC147643.4| Mus musculus BAC clone RP23-35L23 from chromosome 7, complete sequence Length = 205110 Score = 42.1 bits (21), Expect = 1.5 Identities = 30/33 (90%) Strand = Plus / Minus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctgg 420 |||| ||||||||||||||||| ||| |||||| Sbjct: 188348 tgtggctgggtctgggtctgggcctgggtctgg 188316
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 42.1 bits (21), Expect = 1.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 216 gggtcggcggcgggccggcgacagc 240 |||||||||||| |||||||||||| Sbjct: 860814 gggtcggcggcgcgccggcgacagc 860790
>gb|AY190945.1| Drosophila pseudoobscura clone DPSF01_10_G08 (D1416) genomic sequence Length = 38050 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctg 413 ||||||||||||||||||||| Sbjct: 27469 ctgggtctgggtctgggtctg 27489
>dbj|AP003413.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1151A10 Length = 124344 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 229 gccggcgacagcgccaccacc 249 ||||||||||||||||||||| Sbjct: 1539 gccggcgacagcgccaccacc 1519
>dbj|AP003308.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1129G05 Length = 132535 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 229 gccggcgacagcgccaccacc 249 ||||||||||||||||||||| Sbjct: 71834 gccggcgacagcgccaccacc 71814
>dbj|AK122441.1| Mus musculus mRNA for mKIAA1096 protein Length = 6418 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 394 tgggtctgggtctgggtctgc 414 ||||||||||||||||||||| Sbjct: 5860 tgggtctgggtctgggtctgc 5840
>dbj|AK110407.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-165-G08, full insert sequence Length = 2605 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtc 411 ||||||||||||||||||||| Sbjct: 341 gtctgggtctgggtctgggtc 361 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 394 tgggtctgggtctgggtctg 413 |||||||||||||||||||| Sbjct: 338 tgggtctgggtctgggtctg 357
>dbj|AK105504.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-127-D09, full insert sequence Length = 1626 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 229 gccggcgacagcgccaccacc 249 ||||||||||||||||||||| Sbjct: 582 gccggcgacagcgccaccacc 602
>gb|AF102990.1|AF102990 Yersinia enterocolitica plasmid pYVe227, complete sequence Length = 69673 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 95 ggaattattgcttttgcttgc 115 ||||||||||||||||||||| Sbjct: 32472 ggaattattgcttttgcttgc 32492
>gb|AE003482.4| Drosophila melanogaster chromosome 3L, section 16 of 83 of the complete sequence Length = 302417 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctg 413 ||||||||||||||||||||| Sbjct: 102863 ctgggtctgggtctgggtctg 102883 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||| ||||||||||||||| |||||| Sbjct: 102857 ctggggctgggtctgggtctgggtctgg 102884
>gb|AC114624.24| Mus musculus chromosome 5, clone RP24-106K21, complete sequence Length = 197077 Score = 42.1 bits (21), Expect = 1.5 Identities = 30/33 (90%) Strand = Plus / Plus Query: 387 gtgtgtctgggtctgggtctgggtctgcgtctg 419 ||||||||| ||||| ||||| ||||||||||| Sbjct: 120179 gtgtgtctgtgtctgcgtctgtgtctgcgtctg 120211
>emb|CT030152.4| Mouse DNA sequence from clone RP24-323G18 on chromosome 13, complete sequence Length = 129293 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctg 413 ||||||||||||||||||||| Sbjct: 53506 ctgggtctgggtctgggtctg 53526
>gb|AC153380.1| Mus musculus BAC RP23-256G5 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 160046 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 393 ctgggtctgggtctgggtct 412 |||||||||||||||||||| Sbjct: 127089 ctgggtctgggtctgggtct 127070
>ref|XM_511568.1| PREDICTED: Pan troglodytes similar to Hypothetical protein FLJ25414 (LOC454749), mRNA Length = 2194 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 392 tctgggtctgggtctgggtc 411 |||||||||||||||||||| Sbjct: 62 tctgggtctgggtctgggtc 43
>gb|AC123629.10| Mus musculus chromosome 13, clone RP24-344N4, complete sequence Length = 177594 Score = 40.1 bits (20), Expect = 5.8 Identities = 29/32 (90%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctg 419 |||||||| ||||| ||||| ||||||||||| Sbjct: 30504 tgtgtctgtgtctgtgtctgtgtctgcgtctg 30535 Score = 40.1 bits (20), Expect = 5.8 Identities = 29/32 (90%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctg 419 |||||||| ||||| ||||| ||||||||||| Sbjct: 30286 tgtgtctgcgtctgcgtctgcgtctgcgtctg 30317 Score = 40.1 bits (20), Expect = 5.8 Identities = 29/32 (90%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctg 419 |||||||| ||||| ||||| ||||||||||| Sbjct: 30280 tgtgtctgtgtctgcgtctgcgtctgcgtctg 30311
>gb|AC152105.2| Ostreococcus sp. CCE9901 clone JGIACFB-9A3, complete sequence Length = 40909 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 253 cgacgacgcgcgcgcggtcg 272 |||||||||||||||||||| Sbjct: 30110 cgacgacgcgcgcgcggtcg 30091
>gb|AC163295.2| Mus musculus BAC clone RP23-132K20 from chromosome 14, complete sequence Length = 212576 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 394 tgggtctgggtctgggtctg 413 |||||||||||||||||||| Sbjct: 202765 tgggtctgggtctgggtctg 202784
>ref|XM_518559.1| PREDICTED: Pan troglodytes similar to bullous pemphigoid antigen 1-b (LOC462793), mRNA Length = 14007 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 324 ttcctcttgcttggactgat 343 |||||||||||||||||||| Sbjct: 9021 ttcctcttgcttggactgat 9002
>ref|NM_183739.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 642 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 389 gtgtctgggtctgggtctgggtct 412 ||||| |||||||||||||||||| Sbjct: 172 gtgtcggggtctgggtctgggtct 149
>gb|AY016021.1| Mus musculus clone 03245 alpha globin gene cluster, complete sequence Length = 183192 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 387 gtgtgtctgggtctgggtctgggt 410 |||||||||||||||||| ||||| Sbjct: 131863 gtgtgtctgggtctgggtatgggt 131840
>gb|AC091453.2| Mus musculus chromosome X clones RP21-19N11, RP21-667A15, RP21-395M8 complete sequence Length = 350000 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||| ||||| |||||| Sbjct: 91509 ctgggtctgggtctgagtctgggtctgg 91536
>gb|AC139580.4| Mus musculus BAC clone RP23-110M15 from chromosome 13, complete sequence Length = 205480 Score = 40.1 bits (20), Expect = 5.8 Identities = 29/32 (90%) Strand = Plus / Minus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctg 419 |||||||| ||||| ||||| ||||||||||| Sbjct: 18318 tgtgtctgtgtctgcgtctgcgtctgcgtctg 18287 Score = 40.1 bits (20), Expect = 5.8 Identities = 29/32 (90%) Strand = Plus / Minus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctg 419 |||||||| ||||| ||||| ||||||||||| Sbjct: 18312 tgtgtctgcgtctgcgtctgcgtctgcgtctg 18281 Score = 40.1 bits (20), Expect = 5.8 Identities = 29/32 (90%) Strand = Plus / Minus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctg 419 |||||||| ||||| ||||| ||||||||||| Sbjct: 18094 tgtgtctgtgtctgtgtctgtgtctgcgtctg 18063
>gb|AC185523.2| Pan troglodytes chromosome X clone PTB-124O20 map human ortholog p11.3, complete sequence Length = 209530 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 394 tgggtctgggtctgggtctg 413 |||||||||||||||||||| Sbjct: 118711 tgggtctgggtctgggtctg 118730
>gb|BC056472.1| Mus musculus RIKEN cDNA 1500031H01 gene, mRNA (cDNA clone IMAGE:5719223), partial cds Length = 4792 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 306 gtcaccggggcgggatcctt 325 |||||||||||||||||||| Sbjct: 769 gtcaccggggcgggatcctt 788
>gb|AC167018.4| Mus musculus BAC clone RP23-354F11 from chromosome 16, complete sequence Length = 199488 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 306 gtcaccggggcgggatcctt 325 |||||||||||||||||||| Sbjct: 61443 gtcaccggggcgggatcctt 61462
>ref|XM_545678.2| PREDICTED: Canis familiaris similar to Prolargin precursor (Proline-arginine-rich end leucine-rich repeat protein) (LOC488561), mRNA Length = 1278 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||||||||| ||||||||| |||||| Sbjct: 251 ctgggtctgggcctgggtctgggtctgg 224 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgcgtct 418 ||||||| ||||||||||||||| |||| Sbjct: 247 gtctgggcctgggtctgggtctgggtct 220
>gb|AC121796.3| Mus musculus BAC clone RP23-423D22 from chromosome 18, complete sequence Length = 158469 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||| ||| |||||| Sbjct: 82243 ctgggtctgggtctgggcctgggtctgg 82216
>gb|AC125218.3| Mus musculus BAC clone RP23-67F22 from 18, complete sequence Length = 149450 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||| ||| |||||| Sbjct: 36784 ctgggtctgggtctgggcctgggtctgg 36757
>emb|CR673080.2|CNS0FIBI Tetraodon nigroviridis full-length cDNA Length = 515 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 31 gtctgggtctgggtctgggt 12
>emb|CR734065.2|CNS0GT6O Tetraodon nigroviridis full-length cDNA Length = 518 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 34 gtctgggtctgggtctgggt 15
>emb|CR724288.2|CNS0GLT2 Tetraodon nigroviridis full-length cDNA Length = 518 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 34 gtctgggtctgggtctgggt 15
>ref|XM_766126.1| Giardia lamblia ATCC 50803 zinc metalloprotease (GLP_447_7571_4170) partial mRNA Length = 3402 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 92 tgcggaattattgcttttgc 111 |||||||||||||||||||| Sbjct: 2907 tgcggaattattgcttttgc 2926
>emb|CR703455.2|CNS0G5QJ Tetraodon nigroviridis full-length cDNA Length = 522 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 34 gtctgggtctgggtctgggt 15
>emb|CR703388.2|CNS0G5OO Tetraodon nigroviridis full-length cDNA Length = 522 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 34 gtctgggtctgggtctgggt 15
>emb|CR703371.2|CNS0G5O7 Tetraodon nigroviridis full-length cDNA Length = 515 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 31 gtctgggtctgggtctgggt 12
>emb|CR702751.2|CNS0G56Z Tetraodon nigroviridis full-length cDNA Length = 522 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 34 gtctgggtctgggtctgggt 15
>emb|CR702101.2|CNS0G4OX Tetraodon nigroviridis full-length cDNA Length = 518 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 34 gtctgggtctgggtctgggt 15
>emb|CR701990.2|CNS0G4LU Tetraodon nigroviridis full-length cDNA Length = 522 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 34 gtctgggtctgggtctgggt 15
>emb|CR701306.2|CNS0G42U Tetraodon nigroviridis full-length cDNA Length = 518 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 34 gtctgggtctgggtctgggt 15
>emb|CR699581.2|CNS0G2QX Tetraodon nigroviridis full-length cDNA Length = 516 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 28 gtctgggtctgggtctgggt 9
>emb|CR699398.2|CNS0G2LU Tetraodon nigroviridis full-length cDNA Length = 518 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 34 gtctgggtctgggtctgggt 15
>emb|CR698590.2|CNS0G1ZE Tetraodon nigroviridis full-length cDNA Length = 522 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 34 gtctgggtctgggtctgggt 15
>emb|CR698428.2|CNS0G1UW Tetraodon nigroviridis full-length cDNA Length = 515 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 31 gtctgggtctgggtctgggt 12
>emb|CR696547.2|CNS0G0EN Tetraodon nigroviridis full-length cDNA Length = 520 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 36 gtctgggtctgggtctgggt 17
>emb|CR695634.2|CNS0FZPA Tetraodon nigroviridis full-length cDNA Length = 522 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 34 gtctgggtctgggtctgggt 15
>emb|CR695737.2|CNS0FZS5 Tetraodon nigroviridis full-length cDNA Length = 512 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 31 gtctgggtctgggtctgggt 12
>emb|CR692949.2|CNS0FXMP Tetraodon nigroviridis full-length cDNA Length = 514 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 30 gtctgggtctgggtctgggt 11
>emb|CR690555.2|CNS0FVS7 Tetraodon nigroviridis full-length cDNA Length = 518 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 34 gtctgggtctgggtctgggt 15
>emb|CR689720.2|CNS0FV50 Tetraodon nigroviridis full-length cDNA Length = 519 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 31 gtctgggtctgggtctgggt 12
>emb|CR685468.2|CNS0FRUW Tetraodon nigroviridis full-length cDNA Length = 518 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 34 gtctgggtctgggtctgggt 15
>emb|CR683899.2|CNS0FQNB Tetraodon nigroviridis full-length cDNA Length = 519 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 31 gtctgggtctgggtctgggt 12
>emb|CR679031.2|CNS0FMW3 Tetraodon nigroviridis full-length cDNA Length = 519 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 31 gtctgggtctgggtctgggt 12
>emb|CR677723.2|CNS0FLW4 Tetraodon nigroviridis full-length cDNA Length = 605 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 31 gtctgggtctgggtctgggt 12
>emb|CR674470.2|CNS0FJE4 Tetraodon nigroviridis full-length cDNA Length = 519 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 31 gtctgggtctgggtctgggt 12
>emb|CR673861.2|CNS0FIX7 Tetraodon nigroviridis full-length cDNA Length = 519 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 31 gtctgggtctgggtctgggt 12
>emb|CR665338.2|CNS0FCCG Tetraodon nigroviridis full-length cDNA Length = 605 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 31 gtctgggtctgggtctgggt 12
>emb|CR664239.2|CNS0FBHX Tetraodon nigroviridis full-length cDNA Length = 519 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 31 gtctgggtctgggtctgggt 12
>emb|CR663256.2|CNS0FAQM Tetraodon nigroviridis full-length cDNA Length = 515 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 31 gtctgggtctgggtctgggt 12
>emb|CR663083.2|CNS0FALT Tetraodon nigroviridis full-length cDNA Length = 519 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 31 gtctgggtctgggtctgggt 12
>emb|CR662377.2|CNS0FA27 Tetraodon nigroviridis full-length cDNA Length = 507 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 31 gtctgggtctgggtctgggt 12
>emb|CR661891.2|CNS0F9OP Tetraodon nigroviridis full-length cDNA Length = 507 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 23 gtctgggtctgggtctgggt 4
>gb|AC102792.7| Mus musculus chromosome 7, clone RP23-370I17, complete sequence Length = 215999 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 387 gtgtgtctgggtctgggtct 406 |||||||||||||||||||| Sbjct: 180515 gtgtgtctgggtctgggtct 180496
>emb|CR657529.2|CNS0F6BJ Tetraodon nigroviridis full-length cDNA Length = 603 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 29 gtctgggtctgggtctgggt 10
>gb|AC152410.6| Mus musculus BAC clone RP24-290C21 from chromosome 10, complete sequence Length = 175812 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 405 ctgggtctgcgtctggcccgggcg 428 ||||||||||| |||||||||||| Sbjct: 16130 ctgggtctgcggctggcccgggcg 16153
>emb|CR788268.5| Human DNA sequence from clone RP11-24B13 on chromosome 9 Contains the 3' end of the gene for a novel protein similar to contactin associated protein-like 3 (CNTNAP3) and an RNA binding motif protein 17 (RBM17) pseudogene, complete sequence Length = 164026 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtct 412 |||||||||||||||||||| Sbjct: 27658 ctgggtctgggtctgggtct 27677
>gb|CP000271.1| Burkholderia xenovorans LB400 chromosome 2, complete sequence Length = 3363523 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 250 gctcgacgacgcgcgcgcgg 269 |||||||||||||||||||| Sbjct: 1438278 gctcgacgacgcgcgcgcgg 1438259
>gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, complete sequence Length = 4895836 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 248 ccgctcgacgacgcgcgcgcggtcgccg 275 ||||||| ||| |||||||||||||||| Sbjct: 4007214 ccgctcgccgatgcgcgcgcggtcgccg 4007241
>emb|AL162233.14| Human DNA sequence from clone RP11-292B8 on chromosome 9 Contains a pseudogene similar to part of contactin associated protein-like 3 (CNTNAP3), an RNA binding motif protein 17 (RBM17) pseudogene and a CpG island, complete sequence Length = 179833 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtct 412 |||||||||||||||||||| Sbjct: 146024 ctgggtctgggtctgggtct 146043
>emb|AL138766.10| Human DNA sequence from clone RP11-469M11 on chromosome 10, complete sequence Length = 131207 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 103 tgcttttgcttgcttgtgtt 122 |||||||||||||||||||| Sbjct: 51059 tgcttttgcttgcttgtgtt 51040
>emb|AL121580.8|HSBB455A7 Human DNA sequence from clone RP13-455A7 on chromosome 22 Contains an STS and GSSs, complete sequence Length = 137139 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 392 tctgggtctgggtctgggtctgcgtctg 419 ||||||| |||||||||||||| ||||| Sbjct: 38196 tctgggtttgggtctgggtctgggtctg 38169
>gb|AC094241.9| Rattus norvegicus 1 BAC CH230-3C7 (Children's Hospital Oakland Research Institute) complete sequence Length = 215638 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 392 tctgggtctgggtctgggtc 411 |||||||||||||||||||| Sbjct: 207070 tctgggtctgggtctgggtc 207051
>emb|AL731687.13| Mouse DNA sequence from clone RP23-56I20 on chromosome 11 Contains the 5' end of the gene for a novel protein similar to dynein, the Efnb3 gene for ephrin B3, a novel gene, the Trp53 gene for transformation related protein 53, the Atp1b2 gene for Na+/K+ transporting ATPase beta 2 polypeptide, the Shbg gene for sex hormone binding globulin, the 5' end of the Sat2 gene for spermidine/spermine N1-acetyl transferase 2 and two CpG islands, complete sequence Length = 116898 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 394 tgggtctgggtctgggtctg 413 |||||||||||||||||||| Sbjct: 31396 tgggtctgggtctgggtctg 31377 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 31393 gtctgggtctgggtctgggt 31374
>emb|AL132792.2|DMBR19J1 Drosophila melanogaster BAC clone BACR19J1 Length = 95463 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 tgtctgggtctgggtctggg 409 |||||||||||||||||||| Sbjct: 34210 tgtctgggtctgggtctggg 34229
>emb|AJ011317.1|MSP011317 Methylobacterium chloromethanicum cobD, metF, cmuB, cmuC, partial cobC and cobQ, genes and genes encoding Orf219 and Orf361, strain CM4 Length = 8457 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 225 gcgggccggcgacagcgcca 244 |||||||||||||||||||| Sbjct: 246 gcgggccggcgacagcgcca 265
>gb|AC108856.20| Mus musculus chromosome 8, clone RP24-355A11, complete sequence Length = 203330 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 148666 gtctgggtctgggtctgggt 148647
>gb|AC131960.1| Drosophila pseudoobscura FOSMID DPSF1-548A6 (Children's Hospital Oakland Research Institute Drosophila pseudoobscura FOSMID Library) complete sequence Length = 46234 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 394 tgggtctgggtctgggtctg 413 |||||||||||||||||||| Sbjct: 5364 tgggtctgggtctgggtctg 5383
>gb|AC156389.5| Mus musculus 10 BAC RP24-308P8 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 158029 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtct 412 |||||||||||||||||||| Sbjct: 88521 ctgggtctgggtctgggtct 88540
>gb|AC103548.8| Drosophila melanogaster X BAC RP98-19J1 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 182490 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 tgtctgggtctgggtctggg 409 |||||||||||||||||||| Sbjct: 45673 tgtctgggtctgggtctggg 45692
>dbj|AK056769.1| Homo sapiens cDNA FLJ32207 fis, clone PLACE6003204 Length = 2496 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 391 gtctgggtctgggtctgggtctgc 414 ||||| |||||||||||||||||| Sbjct: 621 gtctgagtctgggtctgggtctgc 644
>gb|DQ378284.1| Drosophila virilis strain Tucson 15010-1001.10 chromosome 4 fosmids 23A13 and 15G13, complete sequence Length = 54154 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtct 412 |||||||||||||||||||| Sbjct: 30970 ctgggtctgggtctgggtct 30989
>gb|CP000133.1| Rhizobium etli CFN 42, complete genome Length = 4381608 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 217 ggtcggcggcgggccggcga 236 |||||||||||||||||||| Sbjct: 348001 ggtcggcggcgggccggcga 348020
>ref|NM_143784.2| Drosophila melanogaster Pglym87 CG17645-RA (Pglym87), mRNA Length = 1427 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 394 tgggtctgggtctgggtctg 413 |||||||||||||||||||| Sbjct: 1226 tgggtctgggtctgggtctg 1245
>gb|AF359567.1| Bos taurus myozenin precursor (MYOZ) mRNA, complete cds Length = 1396 Score = 40.1 bits (20), Expect = 5.8 Identities = 29/32 (90%) Strand = Plus / Plus Query: 392 tctgggtctgggtctgggtctgcgtctggccc 423 ||||||||||| |||||||||| |||||||| Sbjct: 592 tctgggtctggctctgggtctggctctggccc 623
>gb|AC012153.10| Homo sapiens 11q BAC RP5-1045O21 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 120628 Score = 40.1 bits (20), Expect = 5.8 Identities = 29/32 (90%) Strand = Plus / Minus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctg 419 |||||||| ||||| ||||| ||||||||||| Sbjct: 104678 tgtgtctgtgtctgtgtctgtgtctgcgtctg 104647 Score = 40.1 bits (20), Expect = 5.8 Identities = 29/32 (90%) Strand = Plus / Minus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctg 419 |||||||| ||||| ||||| ||||||||||| Sbjct: 104672 tgtgtctgtgtctgtgtctgcgtctgcgtctg 104641
>gb|AF400226.1| Homo sapiens bullous pemphigoid antigen 1 eA (BPAG1) mRNA, complete cds Length = 16282 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 324 ttcctcttgcttggactgat 343 |||||||||||||||||||| Sbjct: 3828 ttcctcttgcttggactgat 3809
>gb|AC099017.1| Drosophila melanogaster, chromosome 2L, region 37D-37E, BAC clone BACR27M12, complete sequence Length = 157766 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 393 ctgggtctgggtctgggtct 412 |||||||||||||||||||| Sbjct: 106633 ctgggtctgggtctgggtct 106614
>gb|AC130343.7| Homo sapiens chromosome 17, clone RP11-961A15, complete sequence Length = 217253 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggtctgc 414 ||||| |||||||||||||||||| Sbjct: 21438 gtctgagtctgggtctgggtctgc 21415
>gb|AC008213.4|AC008213 Drosophila melanogaster, chromosome 3R, region 97B-97B, BAC clone BACR15K06, complete sequence Length = 183370 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 393 ctgggtctgggtctgggtct 412 |||||||||||||||||||| Sbjct: 153594 ctgggtctgggtctgggtct 153575
>gb|AC005813.13|AC005813 Drosophila melanogaster, chromosome 3R, region 97B2-97B9, BAC clone BACR48G23, complete sequence Length = 166543 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 393 ctgggtctgggtctgggtct 412 |||||||||||||||||||| Sbjct: 110727 ctgggtctgggtctgggtct 110708
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 228 ggccggcgacagcgccaccaccgctcga 255 |||||| ||||| ||||||||||||||| Sbjct: 6308385 ggccggtgacagtgccaccaccgctcga 6308412
>gb|AC087222.21| Homo sapiens chromosome 17, clone RP11-497H17, complete sequence Length = 70000 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 394 tgggtctgggtctgggtctg 413 |||||||||||||||||||| Sbjct: 30055 tgggtctgggtctgggtctg 30074 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 386 agtgtgtctgggtctgggtctggg 409 |||| ||||||||||||||||||| Sbjct: 30053 agtgggtctgggtctgggtctggg 30076
>gb|AC007724.4|AC007724 Drosophila melanogaster, chromosome 3R, region 87B-87B, BAC clone BACR30N15, complete sequence Length = 178199 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 394 tgggtctgggtctgggtctg 413 |||||||||||||||||||| Sbjct: 87905 tgggtctgggtctgggtctg 87886
>ref|NM_174397.2| Bos taurus myozenin 1 (MYOZ1), mRNA Length = 1396 Score = 40.1 bits (20), Expect = 5.8 Identities = 29/32 (90%) Strand = Plus / Plus Query: 392 tctgggtctgggtctgggtctgcgtctggccc 423 ||||||||||| |||||||||| |||||||| Sbjct: 592 tctgggtctggctctgggtctggctctggccc 623
>gb|AC153136.3| Mus musculus BAC clone RP24-191P11 from chromosome 10, complete sequence Length = 199200 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||| ||||||| |||||| Sbjct: 169214 ctgggtctgggtccgggtctgggtctgg 169241
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 40.1 bits (20), Expect = 5.8 Identities = 27/28 (96%), Gaps = 1/28 (3%) Strand = Plus / Minus Query: 241 gccaccacc-gctcgacgacgcgcgcgc 267 ||||||||| |||||||||||||||||| Sbjct: 1500344 gccaccacctgctcgacgacgcgcgcgc 1500317
>gb|AY190947.1| Drosophila pseudoobscura clone DPSF01_40_G23 (D1426) genomic sequence Length = 42336 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 394 tgggtctgggtctgggtctg 413 |||||||||||||||||||| Sbjct: 21377 tgggtctgggtctgggtctg 21396
>gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I, complete sequence Length = 2124241 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 1339934 gtctgggtctgggtctgggt 1339915
>dbj|AP003535.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1012D10 Length = 168267 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 389 gtgtctgggtctgggtctgggtct 412 ||||| |||||||||||||||||| Sbjct: 150374 gtgtcggggtctgggtctgggtct 150397
>emb|AL807802.22| Mouse DNA sequence from clone RP23-351B24 on chromosome 4, complete sequence Length = 186857 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||| ||| |||||| Sbjct: 90569 ctgggtctgggtctgggcctgggtctgg 90596
>ref|XM_312394.1| Anopheles gambiae str. PEST ENSANGP00000002992 (ENSANGG00000002454), partial mRNA Length = 1530 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 239 gcgccaccaccgctcgacga 258 |||||||||||||||||||| Sbjct: 308 gcgccaccaccgctcgacga 289
>dbj|AK099887.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013112E08, full insert sequence Length = 1064 Score = 40.1 bits (20), Expect = 5.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 389 gtgtctgggtctgggtctgggtct 412 ||||| |||||||||||||||||| Sbjct: 225 gtgtcggggtctgggtctgggtct 202
>gb|AE003756.3| Drosophila melanogaster chromosome 3R, section 94 of 118 of the complete sequence Length = 322332 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 393 ctgggtctgggtctgggtct 412 |||||||||||||||||||| Sbjct: 214487 ctgggtctgggtctgggtct 214468
>gb|AE003695.2| Drosophila melanogaster chromosome 3R, section 33 of 118 of the complete sequence Length = 225655 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 394 tgggtctgggtctgggtctg 413 |||||||||||||||||||| Sbjct: 27688 tgggtctgggtctgggtctg 27669
>gb|AE003663.4| Drosophila melanogaster chromosome 2L, section 72 of 83 of the complete sequence Length = 290667 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 393 ctgggtctgggtctgggtct 412 |||||||||||||||||||| Sbjct: 78252 ctgggtctgggtctgggtct 78233
>gb|AE003418.4| Drosophila melanogaster chromosome X, section 2 of 74 of the complete sequence Length = 315092 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 390 tgtctgggtctgggtctggg 409 |||||||||||||||||||| Sbjct: 183678 tgtctgggtctgggtctggg 183697
>emb|CT033786.13| Mouse DNA sequence from clone RP24-298F18 on chromosome 14, complete sequence Length = 185421 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 394 tgggtctgggtctgggtctg 413 |||||||||||||||||||| Sbjct: 106806 tgggtctgggtctgggtctg 106825
>gb|AC076974.33| Mus musculus strain C57BL/6J chromosome 8 clone rp23-267j18, complete sequence Length = 211075 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 393 ctgggtctgggtctgggtct 412 |||||||||||||||||||| Sbjct: 37764 ctgggtctgggtctgggtct 37745
>gb|AC156624.1| Ornithorhynchus anatinus clone OA_Bb-193E18, complete sequence Length = 162554 Score = 40.1 bits (20), Expect = 5.8 Identities = 29/32 (90%) Strand = Plus / Minus Query: 392 tctgggtctgggtctgggtctgcgtctggccc 423 ||||||||||||| |||||||| ||| ||||| Sbjct: 99495 tctgggtctgggtttgggtctgggtcaggccc 99464
>emb|AL732461.23| Mouse DNA sequence from clone RP23-95K12 on chromosome X, complete sequence Length = 245751 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||| ||||| |||||| Sbjct: 202928 ctgggtctgggtctgagtctgggtctgg 202955
>gb|AC005428.1|AC005428 Drosophila melanogaster DNA sequence (P1 DS05231 (D342)), complete sequence Length = 87835 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 393 ctgggtctgggtctgggtct 412 |||||||||||||||||||| Sbjct: 9681 ctgggtctgggtctgggtct 9700
>gb|AC005187.1|AC005187 Homo sapiens chromosome 4 clone B153K6 map 4q25, complete sequence Length = 114621 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 384 ggagtgtgtctgggtctgggtctgggtc 411 |||||| |||||||||||| |||||||| Sbjct: 20849 ggagtgggtctgggtctggatctgggtc 20876
>emb|AL606989.3|OSJN00120 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0033G08, complete sequence Length = 121591 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 228 ggccggcgacagcgccaccaccgctcga 255 |||||| ||||| ||||||||||||||| Sbjct: 78051 ggccggtgacagtgccaccaccgctcga 78078
>emb|CT030157.8| Mouse DNA sequence from clone RP24-316P8 on chromosome 12, complete sequence Length = 199971 Score = 40.1 bits (20), Expect = 5.8 Identities = 29/32 (90%) Strand = Plus / Plus Query: 388 tgtgtctgggtctgggtctgggtctgcgtctg 419 |||||||| ||||| ||||| ||||||||||| Sbjct: 84136 tgtgtctgtgtctgtgtctgtgtctgcgtctg 84167
>gb|AC131187.4| Mus musculus BAC clone RP24-250M7 from 13, complete sequence Length = 159288 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 99 ttattgcttttgcttgcttg 118 |||||||||||||||||||| Sbjct: 15056 ttattgcttttgcttgcttg 15075
>gb|AC149598.2| Mus musculus BAC clone RP24-119N9 from 18, complete sequence Length = 161955 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||||||| ||| |||||| Sbjct: 161351 ctgggtctgggtctgggcctgggtctgg 161324
>emb|CT025551.9| Mouse DNA sequence from clone RP23-414I10 on chromosome 13, complete sequence Length = 196737 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 387 gtgtgtctgggtctgggtct 406 |||||||||||||||||||| Sbjct: 155175 gtgtgtctgggtctgggtct 155156
>gb|AC122315.5| Mus musculus BAC clone RP23-302P6 from 10, complete sequence Length = 197288 Score = 40.1 bits (20), Expect = 5.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 393 ctgggtctgggtctgggtctgcgtctgg 420 ||||||||||||| ||||||| |||||| Sbjct: 120580 ctgggtctgggtccgggtctgggtctgg 120553
>gb|AC129085.6| Mus musculus BAC clone RP23-293B11 from 13, complete sequence Length = 206677 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 99 ttattgcttttgcttgcttg 118 |||||||||||||||||||| Sbjct: 36090 ttattgcttttgcttgcttg 36071
>emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I, complete sequence, strain 2308 Length = 2121359 Score = 40.1 bits (20), Expect = 5.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 391 gtctgggtctgggtctgggt 410 |||||||||||||||||||| Sbjct: 1337084 gtctgggtctgggtctgggt 1337065 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,756,341 Number of Sequences: 3902068 Number of extensions: 2756341 Number of successful extensions: 61690 Number of sequences better than 10.0: 261 Number of HSP's better than 10.0 without gapping: 262 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 59038 Number of HSP's gapped (non-prelim): 2384 length of query: 429 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 407 effective length of database: 17,147,199,772 effective search space: 6978910307204 effective search space used: 6978910307204 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
