>emb|AL589862.28| Human DNA sequence from clone GS1-165F21 on chromosome 10 Contains the 5'
              end of the PAX2 gene for paired box gene 2 and fifteen CpG
              islands, complete sequence
          Length = 187101

 Score = 46.1 bits (23), Expect = 0.087
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 356    tacagcgccagaccattcttctt 378
              |||||||||||||||||||||||
Sbjct: 139014 tacagcgccagaccattcttctt 138992

>gb|AC114763.6| Homo sapiens BAC clone RP11-369K2 from 2, complete sequence
          Length = 87248

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 158   acagcagcttggcgtacaaccgtctt 183
             ||||||||||||| ||||||||||||
Sbjct: 13338 acagcagcttggcttacaaccgtctt 13313

>gb|AC016737.8| Homo sapiens BAC clone RP11-394I13 from 2, complete sequence
          Length = 196085

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 99     caagttacagaatattcaacta 120
              ||||||||||||||||||||||
Sbjct: 126156 caagttacagaatattcaacta 126177

>ref|XM_763279.1| Giardia lamblia ATCC 50803 hypothetical protein
           (GLP_15_12905_13390) partial mRNA
          Length = 486

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 125 ttgagcaggttctcatcagct 145
           |||||||||||||||||||||
Sbjct: 443 ttgagcaggttctcatcagct 423

>ref|XM_763280.1| Giardia lamblia ATCC 50803 hypothetical protein
           (GLP_15_13494_12943) partial mRNA
          Length = 552

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 125 ttgagcaggttctcatcagct 145
           |||||||||||||||||||||
Sbjct: 148 ttgagcaggttctcatcagct 168

>emb|X92428.1|ZMHOX1BGN Z.mays mRNA for Hox1b protein
          Length = 2790

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 363  ccagaccattcttcttcatca 383
            |||||||||||||||||||||
Sbjct: 1632 ccagaccattcttcttcatca 1612

>gb|AC005375.4|AC005375 Homo sapiens chromosome 17, clone hRPK.388_F_14, complete sequence
          Length = 149030

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 263   taattatttcccctaaaaatg 283
             |||||||||||||||||||||
Sbjct: 90915 taattatttcccctaaaaatg 90895

>gb|CP000233.1| Lactobacillus salivarius subsp. salivarius UCC118, complete genome
          Length = 1827111

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 154    cctaacagcagcttggcgtacaac 177
              ||||||||| ||||||||||||||
Sbjct: 609609 cctaacagctgcttggcgtacaac 609632

>gb|AC091726.2| Gallus gallus clone WAG-126P17, complete sequence
          Length = 129285

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 187   tgagcactgattgcagaggg 206
             ||||||||||||||||||||
Sbjct: 58108 tgagcactgattgcagaggg 58127

>emb|AL021069.1|HS970D1 Human DNA sequence from clone RP5-970D1 on chromosome 1q24 Contains the
             3' end of a variant of the gene for expressed in
             hematopoietic cells (heart, liver) (HLL), complete
             sequence
          Length = 100496

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 260   aactaattatttcccctaaa 279
             ||||||||||||||||||||
Sbjct: 64950 aactaattatttcccctaaa 64969

>gb|AC087231.1|AC087231 Caenorhabditis briggsae cosmid CB034P13, complete sequence
          Length = 71462

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 69    ttgcgaaaacatttatatctttcc 92
             |||||||||||||||| |||||||
Sbjct: 68882 ttgcgaaaacatttatttctttcc 68859


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,882,809
Number of Sequences: 3902068
Number of extensions: 3882809
Number of successful extensions: 77959
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 77936
Number of HSP's gapped (non-prelim): 23
length of query: 403
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 381
effective length of database: 17,147,199,772
effective search space: 6533083113132
effective search space used: 6533083113132
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)