Clone Name | rbastl03f06 |
---|---|
Clone Library Name | barley_pub |
>emb|AL589862.28| Human DNA sequence from clone GS1-165F21 on chromosome 10 Contains the 5' end of the PAX2 gene for paired box gene 2 and fifteen CpG islands, complete sequence Length = 187101 Score = 46.1 bits (23), Expect = 0.087 Identities = 23/23 (100%) Strand = Plus / Minus Query: 356 tacagcgccagaccattcttctt 378 ||||||||||||||||||||||| Sbjct: 139014 tacagcgccagaccattcttctt 138992
>gb|AC114763.6| Homo sapiens BAC clone RP11-369K2 from 2, complete sequence Length = 87248 Score = 44.1 bits (22), Expect = 0.35 Identities = 25/26 (96%) Strand = Plus / Minus Query: 158 acagcagcttggcgtacaaccgtctt 183 ||||||||||||| |||||||||||| Sbjct: 13338 acagcagcttggcttacaaccgtctt 13313
>gb|AC016737.8| Homo sapiens BAC clone RP11-394I13 from 2, complete sequence Length = 196085 Score = 44.1 bits (22), Expect = 0.35 Identities = 22/22 (100%) Strand = Plus / Plus Query: 99 caagttacagaatattcaacta 120 |||||||||||||||||||||| Sbjct: 126156 caagttacagaatattcaacta 126177
>ref|XM_763279.1| Giardia lamblia ATCC 50803 hypothetical protein (GLP_15_12905_13390) partial mRNA Length = 486 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 125 ttgagcaggttctcatcagct 145 ||||||||||||||||||||| Sbjct: 443 ttgagcaggttctcatcagct 423
>ref|XM_763280.1| Giardia lamblia ATCC 50803 hypothetical protein (GLP_15_13494_12943) partial mRNA Length = 552 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 125 ttgagcaggttctcatcagct 145 ||||||||||||||||||||| Sbjct: 148 ttgagcaggttctcatcagct 168
>emb|X92428.1|ZMHOX1BGN Z.mays mRNA for Hox1b protein Length = 2790 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 363 ccagaccattcttcttcatca 383 ||||||||||||||||||||| Sbjct: 1632 ccagaccattcttcttcatca 1612
>gb|AC005375.4|AC005375 Homo sapiens chromosome 17, clone hRPK.388_F_14, complete sequence Length = 149030 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 263 taattatttcccctaaaaatg 283 ||||||||||||||||||||| Sbjct: 90915 taattatttcccctaaaaatg 90895
>gb|CP000233.1| Lactobacillus salivarius subsp. salivarius UCC118, complete genome Length = 1827111 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 154 cctaacagcagcttggcgtacaac 177 ||||||||| |||||||||||||| Sbjct: 609609 cctaacagctgcttggcgtacaac 609632
>gb|AC091726.2| Gallus gallus clone WAG-126P17, complete sequence Length = 129285 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 187 tgagcactgattgcagaggg 206 |||||||||||||||||||| Sbjct: 58108 tgagcactgattgcagaggg 58127
>emb|AL021069.1|HS970D1 Human DNA sequence from clone RP5-970D1 on chromosome 1q24 Contains the 3' end of a variant of the gene for expressed in hematopoietic cells (heart, liver) (HLL), complete sequence Length = 100496 Score = 40.1 bits (20), Expect = 5.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 260 aactaattatttcccctaaa 279 |||||||||||||||||||| Sbjct: 64950 aactaattatttcccctaaa 64969
>gb|AC087231.1|AC087231 Caenorhabditis briggsae cosmid CB034P13, complete sequence Length = 71462 Score = 40.1 bits (20), Expect = 5.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 69 ttgcgaaaacatttatatctttcc 92 |||||||||||||||| ||||||| Sbjct: 68882 ttgcgaaaacatttatttctttcc 68859 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,882,809 Number of Sequences: 3902068 Number of extensions: 3882809 Number of successful extensions: 77959 Number of sequences better than 10.0: 11 Number of HSP's better than 10.0 without gapping: 11 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 77936 Number of HSP's gapped (non-prelim): 23 length of query: 403 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 381 effective length of database: 17,147,199,772 effective search space: 6533083113132 effective search space used: 6533083113132 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)