>dbj|AK174167.1| Ciona intestinalis cDNA, clone:cibd027m13, full insert sequence
          Length = 892

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 44  tgcaaaaaccaacctattatg 64
           |||||||||||||||||||||
Sbjct: 92  tgcaaaaaccaacctattatg 112

>gb|AC108767.10| Mus musculus chromosome 3, clone RP24-377E5, complete sequence
          Length = 167878

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 272    ctgttttgctttgcaggatcatctgttt 299
              |||| ||||| |||||||||||||||||
Sbjct: 128448 ctgtcttgctgtgcaggatcatctgttt 128421

>gb|AC124773.4| Mus musculus BAC clone RP23-49B23 from 3, complete sequence
          Length = 216860

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 272   ctgttttgctttgcaggatcatctgttt 299
             |||| ||||| |||||||||||||||||
Sbjct: 17406 ctgtcttgctgtgcaggatcatctgttt 17379

>gb|AC117230.3| Mus musculus BAC clone RP23-385F15 from 16, complete sequence
          Length = 184556

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 110    gtaatggttttaagacaagcatgg 133
              |||||||||||||||||| |||||
Sbjct: 111015 gtaatggttttaagacaaacatgg 110992

>gb|DQ444329.1| Bibimys labiosus voucher MN 62062 cytochrome b (cytb) gene, complete
            cds; mitochondrial
          Length = 1140

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 68   aattgcatcaatctcttact 87
            ||||||||||||||||||||
Sbjct: 1056 aattgcatcaatctcttact 1075

>emb|AL591363.4| Human DNA sequence from clone RP11-45P22 on chromosome 10 Contains a
             peptidylprolyl isomerase A (cyclophilin A) (CYPA, CYPH)
             (PPIA) pseudogene and a tyrosine
             3-monooxygenase/tryptophan 5-monooxygenase activation
             protein, zeta polypeptide (KCIP-1) (YWHAZ) pseudogene,
             complete sequence
          Length = 115806

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 273   tgttttgctttgcaggatca 292
             ||||||||||||||||||||
Sbjct: 58953 tgttttgctttgcaggatca 58934

>gb|AC093043.6| Mus Musculus Strain C57BL6/J Chromosome 14 BAC, RP23-337O1, complete
             sequence
          Length = 232491

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 369   cggcagagtccagggcaatg 388
             ||||||||||||||||||||
Sbjct: 87964 cggcagagtccagggcaatg 87945

>emb|BX950851.1| Erwinia carotovora subsp. atroseptica SCRI1043, complete genome
          Length = 5064019

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 128     gcatggatatcgatttcgcatcct 151
               |||||||| |||||||||||||||
Sbjct: 3469823 gcatggatgtcgatttcgcatcct 3469846

>gb|AC007126.6|AC007126 Homo sapiens chromosome 4 clone C0496D08, complete sequence
          Length = 218698

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 303   ctgcaggaacattctcccag 322
             ||||||||||||||||||||
Sbjct: 28849 ctgcaggaacattctcccag 28830


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,266,123
Number of Sequences: 3902068
Number of extensions: 3266123
Number of successful extensions: 52903
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 52872
Number of HSP's gapped (non-prelim): 31
length of query: 433
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 411
effective length of database: 17,147,199,772
effective search space: 7047499106292
effective search space used: 7047499106292
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)