ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbastl03c11 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|D13472.2|BLYINOPP Hordeum vulgare mRNA for vacuolar membrane proton-translocating inorganic pyrophosphatase, complete cds Length = 2649 Score = 852 bits (430), Expect = 0.0 Identities = 497/514 (96%), Gaps = 14/514 (2%) Strand = Plus / Minus Query: 5 caatcatcatgatatcattgttcaagggtgggttcaaacattatcgtcgtcatcacggga 64 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 2649 caatcatcatgatatcattgttcaagggtgggttcaaacattatcgtcgtcatcatggga 2590 Query: 65 cgaggaaaatttgccaggcacataccaacgagggaggacatctggtctctctcttctact 124 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Sbjct: 2589 cgaggaaaatttgccagacacataccaacgagggaggacatctggtctctctcttctact 2530 Query: 125 acatggagctacaagccggtaatgtaatggtgagactaacataacgccttcaagaggcca 184 |||||||||||||||||| |||||||||| ||||||||||||||||| |||||||||||| Sbjct: 2529 acatggagctacaagccg-taatgtaatg-tgagactaacataacgc-ttcaagaggcca 2473 Query: 185 ggggaaaggggggtaggtaaccgcggcaatcctggaatgacattgacaaccaaaaataac 244 ||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| Sbjct: 2472 ggggaaaggggggtaggtaactgcggcaatcctgga-tgacattgacaaccaaaaataac 2414 Query: 245 agcagcgcacaacgtacgaa-----ggcgggcgggcaggcaggcgggggagttattcgtg 299 |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 2413 agcagcgcacaacgtacgaacggcgggcgggcgggcaggcaggcgggggagttattcgtg 2354 Query: 300 acagtgtctgtagatcatcgctcgactc-----gagtcctctagatgtacttgaacagca 354 |||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 2353 acagtgtctgtagatcatcgctcgactcatcacgagtcctctagatgtacttgaacagca 2294 Query: 355 gacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttga 414 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2293 gacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttga 2234 Query: 415 tgaggatgttgagcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccga 474 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2233 tgaggatgttgagcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccga 2174 Query: 475 tcacggcggccttgtggcagtctgaacccttggg 508 |||||||||||||||||||||||||||||||||| Sbjct: 2173 tcacggcggccttgtggcagtctgaacccttggg 2140
>gb|AY296911.1| Triticum aestivum vacuolar proton-inorganic pyrophosphatase mRNA, complete cds Length = 2671 Score = 313 bits (158), Expect = 3e-82 Identities = 176/182 (96%) Strand = Plus / Minus Query: 327 cgagtcctctagatgtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaac 386 |||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| Sbjct: 2327 cgagtcttctagatgtacttgaacagcacacctccgtacgtggcgaagaagggcgcgaac 2268 Query: 387 acgagggactcaacggccatgagcttgatgaggatgttgagcgacgggcctgaggtgtcc 446 ||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 2267 acgagggactcgacggccatcagcttgatgaggatgttgagcgacgggcctgaggtgtcc 2208 Query: 447 ttgagggggtctccgatggtgtcaccgatcacggcggccttgtggcagtctgaacccttg 506 ||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| Sbjct: 2207 ttgagggggtctccgatggtgtcgccgatcacggccgccttgtggcagtctgaacccttg 2148 Query: 507 gg 508 || Sbjct: 2147 gg 2146 Score = 192 bits (97), Expect = 8e-46 Identities = 218/251 (86%), Gaps = 18/251 (7%) Strand = Plus / Minus Query: 34 gggttcaaacattatcgtcgtcatcacgggacgaggaaaatttgccaggcacatacc--- 90 |||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 2617 gggttcaaacattatcgtcgtcatcacgggacgaggaaaatttgccagacacataccaat 2558 Query: 91 aacgagggaggacatctggtctctctcttctactacatggagctacaagccggtaatgta 150 || || ||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 2557 aatgaccgaggacatctggtctctctcttctactacatggagctacaagccg-----gta 2503 Query: 151 atggtgagactaacataacgccttcaagaggcc-aggggaaag-gggggtaggtaaccgc 208 |||||||||||||| |||| | ||||||||| | ||||||| ||||||| ||| || Sbjct: 2502 atggtgagactaacgtaacacacccaagaggccaaagggaaagtgggggta---aactgc 2446 Query: 209 ggcaatcctgg---aatgacattgacaaccaaaaataacagcagcgcacaacgtacgaa- 264 ||||||||||| ||||||| | |||||||||||||||||||||||||| |||||| Sbjct: 2445 ggcaatcctggaataatgaca-caagaaccaaaaataacagcagcgcacaacatacgaac 2387 Query: 265 ggcgggcgggc 275 ||||||||||| Sbjct: 2386 ggcgggcgggc 2376
>ref|XM_476313.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2304 Score = 250 bits (126), Expect = 4e-63 Identities = 156/166 (93%) Strand = Plus / Minus Query: 343 acttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacgg 402 |||||||||||||||| |||| ||||||||||| ||||| ||||| |||||||| |||| Sbjct: 2296 acttgaacagcagaccaccgtgtgtggcgaagaaaggcgcaaacacaagggactcgacgg 2237 Query: 403 ccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgagggggtctccga 462 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | Sbjct: 2236 ccatgagcttgatgaggatgttgagcgacgggcctgatgtgtccttgagggggtctccaa 2177 Query: 463 tggtgtcaccgatcacggcggccttgtggcagtctgaacccttggg 508 ||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 2176 tggtgtcaccgatcacggcggccttgtggcagtctgatcccttggg 2131
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 250 bits (126), Expect = 4e-63 Identities = 156/166 (93%) Strand = Plus / Minus Query: 343 acttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacgg 402 |||||||||||||||| |||| ||||||||||| ||||| ||||| |||||||| |||| Sbjct: 3934784 acttgaacagcagaccaccgtgtgtggcgaagaaaggcgcaaacacaagggactcgacgg 3934725 Query: 403 ccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgagggggtctccga 462 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | Sbjct: 3934724 ccatgagcttgatgaggatgttgagcgacgggcctgatgtgtccttgagggggtctccaa 3934665 Query: 463 tggtgtcaccgatcacggcggccttgtggcagtctgaacccttggg 508 ||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 3934664 tggtgtcaccgatcacggcggccttgtggcagtctgatcccttggg 3934619 Score = 147 bits (74), Expect = 4e-32 Identities = 119/134 (88%) Strand = Plus / Minus Query: 366 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 425 ||||||||||| || || |||||||| ||||| || ||||| |||||||||||||||||| Sbjct: 25894188 gtggcgaagaacggggcaaacacgagcgactcgacagccatcagcttgatgaggatgttg 25894129 Query: 426 agcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcc 485 ||||| |||||||||||||||||||| || || || |||||||| |||||||| || ||| Sbjct: 25894128 agcgaggggcctgaggtgtccttgagaggatccccaatggtgtcgccgatcacagcagcc 25894069 Query: 486 ttgtggcagtctga 499 |||||||||||||| Sbjct: 25894068 ttgtggcagtctga 25894055 Score = 83.8 bits (42), Expect = 5e-13 Identities = 45/46 (97%) Strand = Plus / Minus Query: 36 gttcaaacattatcgtcgtcatcacgggacgaggaaaatttgccag 81 |||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 3935071 gttcaaacattatcgtcgtcatcatgggacgaggaaaatttgccag 3935026
>dbj|AP003019.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0035I03 Length = 153749 Score = 250 bits (126), Expect = 4e-63 Identities = 156/166 (93%) Strand = Plus / Minus Query: 343 acttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacgg 402 |||||||||||||||| |||| ||||||||||| ||||| ||||| |||||||| |||| Sbjct: 40660 acttgaacagcagaccaccgtgtgtggcgaagaaaggcgcaaacacaagggactcgacgg 40601 Query: 403 ccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgagggggtctccga 462 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | Sbjct: 40600 ccatgagcttgatgaggatgttgagcgacgggcctgatgtgtccttgagggggtctccaa 40541 Query: 463 tggtgtcaccgatcacggcggccttgtggcagtctgaacccttggg 508 ||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 40540 tggtgtcaccgatcacggcggccttgtggcagtctgatcccttggg 40495 Score = 83.8 bits (42), Expect = 5e-13 Identities = 45/46 (97%) Strand = Plus / Minus Query: 36 gttcaaacattatcgtcgtcatcacgggacgaggaaaatttgccag 81 |||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 40947 gttcaaacattatcgtcgtcatcatgggacgaggaaaatttgccag 40902
>dbj|AK066933.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013091F19, full insert sequence Length = 2738 Score = 250 bits (126), Expect = 4e-63 Identities = 156/166 (93%) Strand = Plus / Minus Query: 343 acttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacgg 402 |||||||||||||||| |||| ||||||||||| ||||| ||||| |||||||| |||| Sbjct: 2405 acttgaacagcagaccaccgtgtgtggcgaagaaaggcgcaaacacaagggactcgacgg 2346 Query: 403 ccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgagggggtctccga 462 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | Sbjct: 2345 ccatgagcttgatgaggatgttgagcgacgggcctgatgtgtccttgagggggtctccaa 2286 Query: 463 tggtgtcaccgatcacggcggccttgtggcagtctgaacccttggg 508 ||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 2285 tggtgtcaccgatcacggcggccttgtggcagtctgatcccttggg 2240 Score = 83.8 bits (42), Expect = 5e-13 Identities = 45/46 (97%) Strand = Plus / Minus Query: 36 gttcaaacattatcgtcgtcatcacgggacgaggaaaatttgccag 81 |||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 2692 gttcaaacattatcgtcgtcatcatgggacgaggaaaatttgccag 2647
>dbj|AB012766.1| Oryza sativa gene for ovp2, complete cds Length = 5985 Score = 250 bits (126), Expect = 4e-63 Identities = 156/166 (93%) Strand = Plus / Minus Query: 343 acttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacgg 402 |||||||||||||||| |||| ||||||||||| ||||| ||||| |||||||| |||| Sbjct: 5664 acttgaacagcagaccaccgtgtgtggcgaagaaaggcgcaaacacaagggactcgacgg 5605 Query: 403 ccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgagggggtctccga 462 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | Sbjct: 5604 ccatgagcttgatgaggatgttgagcgacgggcctgatgtgtccttgagggggtctccaa 5545 Query: 463 tggtgtcaccgatcacggcggccttgtggcagtctgaacccttggg 508 ||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 5544 tggtgtcaccgatcacggcggccttgtggcagtctgatcccttggg 5499 Score = 83.8 bits (42), Expect = 5e-13 Identities = 45/46 (97%) Strand = Plus / Minus Query: 36 gttcaaacattatcgtcgtcatcacgggacgaggaaaatttgccag 81 |||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 5951 gttcaaacattatcgtcgtcatcatgggacgaggaaaatttgccag 5906
>dbj|D45384.1| Oryza sativa mRNA for vacuolar H+-pyrophosphatase, complete cds Length = 2710 Score = 250 bits (126), Expect = 4e-63 Identities = 156/166 (93%) Strand = Plus / Minus Query: 343 acttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacgg 402 |||||||||||||||| |||| ||||||||||| ||||| ||||| |||||||| |||| Sbjct: 2390 acttgaacagcagaccaccgtgtgtggcgaagaaaggcgcaaacacaagggactcgacgg 2331 Query: 403 ccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgagggggtctccga 462 ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | Sbjct: 2330 ccatgagcttgatgaggatgttgagcgacgggcctgatgtgtccttgagggggtctccaa 2271 Query: 463 tggtgtcaccgatcacggcggccttgtggcagtctgaacccttggg 508 ||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 2270 tggtgtcaccgatcacggcggccttgtggcagtctgatcccttggg 2225 Score = 83.8 bits (42), Expect = 5e-13 Identities = 45/46 (97%) Strand = Plus / Minus Query: 36 gttcaaacattatcgtcgtcatcacgggacgaggaaaatttgccag 81 |||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 2677 gttcaaacattatcgtcgtcatcatgggacgaggaaaatttgccag 2632
>dbj|AB032839.1| Hordeum vulgare HVP1 mRNA for vacuolar proton-inorganic pyrophosphatase, complete cds Length = 2757 Score = 214 bits (108), Expect = 2e-52 Identities = 132/140 (94%) Strand = Plus / Minus Query: 357 cctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatg 416 ||||| || |||||||||||||| |||||||||||||||||||| ||||||||||||||| Sbjct: 2376 cctccataggtggcgaagaagggggcgaacacgagggactcaaccgccatgagcttgatg 2317 Query: 417 aggatgttgagcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatc 476 |||||||||||||| ||||| |||||||||||||| ||||| |||||||||||||||||| Sbjct: 2316 aggatgttgagcgaggggcccgaggtgtccttgagagggtccccgatggtgtcaccgatc 2257 Query: 477 acggcggccttgtggcagtc 496 |||||||||||||||||||| Sbjct: 2256 acggcggccttgtggcagtc 2237
>gb|AY255181.1| Hordeum brevisubulatum vacuolar proton-inorganic pyrophosphatase (AVP1) mRNA, complete cds Length = 2777 Score = 204 bits (103), Expect = 2e-49 Identities = 133/143 (93%) Strand = Plus / Minus Query: 357 cctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatg 416 |||||||| |||||||||||||| ||||||||||||||||| || ||||||||||||||| Sbjct: 2338 cctccgtaggtggcgaagaagggggcgaacacgagggactcgaccgccatgagcttgatg 2279 Query: 417 aggatgttgagcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatc 476 |||||||||||||| ||||| |||||||||||||| ||||| ||||||||||| |||||| Sbjct: 2278 aggatgttgagcgaggggcccgaggtgtccttgagagggtccccgatggtgtcgccgatc 2219 Query: 477 acggcggccttgtggcagtctga 499 || |||||||||||||||||||| Sbjct: 2218 actgcggccttgtggcagtctga 2196
>emb|AJ621242.1| Oryza sativa mRNA for proton translocating pyrophosphatase (VP4 gene) Length = 2289 Score = 182 bits (92), Expect = 7e-43 Identities = 137/152 (90%) Strand = Plus / Minus Query: 357 cctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatg 416 ||||||| |||||||||||| ||||||||||| || ||||| |||||||||||||||||| Sbjct: 2267 cctccgtgcgtggcgaagaatggcgcgaacaccagcgactcgacggccatgagcttgatg 2208 Query: 417 aggatgttgagcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatc 476 |||||||| ||||||||||| || ||||||||||| ||||| ||||||||||| |||||| Sbjct: 2207 aggatgttcagcgacgggcccgacgtgtccttgagcgggtcgccgatggtgtcgccgatc 2148 Query: 477 acggcggccttgtggcagtctgaacccttggg 508 || || |||||||||||||| || |||||||| Sbjct: 2147 accgccgccttgtggcagtccgatcccttggg 2116
>gb|AY103622.1| Zea mays PCO084888 mRNA sequence Length = 2801 Score = 182 bits (92), Expect = 7e-43 Identities = 149/168 (88%) Strand = Plus / Minus Query: 341 gtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaac 400 ||||||||| ||||| || || | ||||| |||||||| || |||||||||||||| || Sbjct: 2373 gtacttgaagagcaggccaccctgggtggcaaagaagggggcaaacacgagggactccac 2314 Query: 401 ggccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgagggggtctcc 460 ||||||||||||||||||||||||||| |||||||| ||||||||||| |||||||| || Sbjct: 2313 ggccatgagcttgatgaggatgttgagggacgggccggaggtgtccttcagggggtcacc 2254 Query: 461 gatggtgtcaccgatcacggcggccttgtggcagtctgaacccttggg 508 ||||||||||| ||||| ||||||||||||||||| || |||||||| Sbjct: 2253 aatggtgtcacctatcacagcggccttgtggcagtcggatcccttggg 2206
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 174 bits (88), Expect = 2e-40 Identities = 136/152 (89%) Strand = Plus / Plus Query: 357 cctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatg 416 ||||||| |||||||||||| ||||||||||| || ||||| |||||||||||||||||| Sbjct: 34229256 cctccgtgcgtggcgaagaatggcgcgaacaccagcgactcgacggccatgagcttgatg 34229315 Query: 417 aggatgttgagcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatc 476 |||||||| ||||||||||| || ||||||||||| ||||| || |||||||| |||||| Sbjct: 34229316 aggatgttcagcgacgggcccgacgtgtccttgagcgggtcgccaatggtgtcgccgatc 34229375 Query: 477 acggcggccttgtggcagtctgaacccttggg 508 || || |||||||||||||| || |||||||| Sbjct: 34229376 accgccgccttgtggcagtccgatcccttggg 34229407 Score = 155 bits (78), Expect = 2e-34 Identities = 114/126 (90%) Strand = Plus / Plus Query: 366 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 425 |||||||||||||| ||||| |||||||| || || |||||||||||||||||||||||| Sbjct: 4694181 gtggcgaagaagggggcgaaaacgagggattcgaccgccatgagcttgatgaggatgttg 4694240 Query: 426 agcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcc 485 || || || ||||| ||||||||||| ||||||||||||||||||||||| ||||| ||| Sbjct: 4694241 agagagggtcctgaagtgtccttgagagggtctccgatggtgtcaccgatgacggccgcc 4694300 Query: 486 ttgtgg 491 |||||| Sbjct: 4694301 ttgtgg 4694306
>dbj|AP007227.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0032L17 Length = 165808 Score = 174 bits (88), Expect = 2e-40 Identities = 136/152 (89%) Strand = Plus / Plus Query: 357 cctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatg 416 ||||||| |||||||||||| ||||||||||| || ||||| |||||||||||||||||| Sbjct: 156770 cctccgtgcgtggcgaagaatggcgcgaacaccagcgactcgacggccatgagcttgatg 156829 Query: 417 aggatgttgagcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatc 476 |||||||| ||||||||||| || ||||||||||| ||||| || |||||||| |||||| Sbjct: 156830 aggatgttcagcgacgggcccgacgtgtccttgagcgggtcgccaatggtgtcgccgatc 156889 Query: 477 acggcggccttgtggcagtctgaacccttggg 508 || || |||||||||||||| || |||||||| Sbjct: 156890 accgccgccttgtggcagtccgatcccttggg 156921
>dbj|AP005056.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0689B12 Length = 154745 Score = 174 bits (88), Expect = 2e-40 Identities = 136/152 (89%) Strand = Plus / Plus Query: 357 cctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatg 416 ||||||| |||||||||||| ||||||||||| || ||||| |||||||||||||||||| Sbjct: 64529 cctccgtgcgtggcgaagaatggcgcgaacaccagcgactcgacggccatgagcttgatg 64588 Query: 417 aggatgttgagcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatc 476 |||||||| ||||||||||| || ||||||||||| ||||| || |||||||| |||||| Sbjct: 64589 aggatgttcagcgacgggcccgacgtgtccttgagcgggtcgccaatggtgtcgccgatc 64648 Query: 477 acggcggccttgtggcagtctgaacccttggg 508 || || |||||||||||||| || |||||||| Sbjct: 64649 accgccgccttgtggcagtccgatcccttggg 64680
>dbj|AB126350.1| Oryza sativa (japonica cultivar-group) OVP3 gene for vacuolar proton pyrophosphatase, complete cds Length = 5548 Score = 174 bits (88), Expect = 2e-40 Identities = 136/152 (89%) Strand = Plus / Minus Query: 357 cctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatg 416 ||||||| |||||||||||| ||||||||||| || ||||| |||||||||||||||||| Sbjct: 5235 cctccgtgcgtggcgaagaatggcgcgaacaccagcgactcgacggccatgagcttgatg 5176 Query: 417 aggatgttgagcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatc 476 |||||||| ||||||||||| || ||||||||||| ||||| || |||||||| |||||| Sbjct: 5175 aggatgttcagcgacgggcccgacgtgtccttgagcgggtcgccaatggtgtcgccgatc 5116 Query: 477 acggcggccttgtggcagtctgaacccttggg 508 || || |||||||||||||| || |||||||| Sbjct: 5115 accgccgccttgtggcagtccgatcccttggg 5084
>dbj|AK102146.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086B11, full insert sequence Length = 2699 Score = 174 bits (88), Expect = 2e-40 Identities = 136/152 (89%) Strand = Plus / Minus Query: 357 cctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatg 416 ||||||| |||||||||||| ||||||||||| || ||||| |||||||||||||||||| Sbjct: 2376 cctccgtgcgtggcgaagaatggcgcgaacaccagcgactcgacggccatgagcttgatg 2317 Query: 417 aggatgttgagcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatc 476 |||||||| ||||||||||| || ||||||||||| ||||| || |||||||| |||||| Sbjct: 2316 aggatgttcagcgacgggcccgacgtgtccttgagcgggtcgccaatggtgtcgccgatc 2257 Query: 477 acggcggccttgtggcagtctgaacccttggg 508 || || |||||||||||||| || |||||||| Sbjct: 2256 accgccgccttgtggcagtccgatcccttggg 2225
>dbj|AK064361.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-108-B10, full insert sequence Length = 2009 Score = 167 bits (84), Expect = 4e-38 Identities = 135/152 (88%) Strand = Plus / Minus Query: 357 cctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatg 416 ||||||| |||||||||||| ||||||||||| || ||||| |||||| ||||||||||| Sbjct: 1670 cctccgtgcgtggcgaagaatggcgcgaacaccagcgactcgacggccgtgagcttgatg 1611 Query: 417 aggatgttgagcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatc 476 |||||||| ||||||||||| || ||||||||||| ||||| || |||||||| |||||| Sbjct: 1610 aggatgttcagcgacgggcccgacgtgtccttgagcgggtcgccaatggtgtcgccgatc 1551 Query: 477 acggcggccttgtggcagtctgaacccttggg 508 || || |||||||||||||| || |||||||| Sbjct: 1550 accgccgccttgtggcagtccgatcccttggg 1519
>ref|XM_464356.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2313 Score = 155 bits (78), Expect = 2e-34 Identities = 114/126 (90%) Strand = Plus / Minus Query: 366 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 425 |||||||||||||| ||||| |||||||| || || |||||||||||||||||||||||| Sbjct: 2282 gtggcgaagaagggggcgaaaacgagggattcgaccgccatgagcttgatgaggatgttg 2223 Query: 426 agcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcc 485 || || || ||||| ||||||||||| ||||||||||||||||||||||| ||||| ||| Sbjct: 2222 agagagggtcctgaagtgtccttgagagggtctccgatggtgtcaccgatgacggccgcc 2163 Query: 486 ttgtgg 491 |||||| Sbjct: 2162 ttgtgg 2157
>dbj|AP004066.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1572_F02 Length = 93626 Score = 155 bits (78), Expect = 2e-34 Identities = 114/126 (90%) Strand = Plus / Plus Query: 366 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 425 |||||||||||||| ||||| |||||||| || || |||||||||||||||||||||||| Sbjct: 66253 gtggcgaagaagggggcgaaaacgagggattcgaccgccatgagcttgatgaggatgttg 66312 Query: 426 agcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcc 485 || || || ||||| ||||||||||| ||||||||||||||||||||||| ||||| ||| Sbjct: 66313 agagagggtcctgaagtgtccttgagagggtctccgatggtgtcaccgatgacggccgcc 66372 Query: 486 ttgtgg 491 |||||| Sbjct: 66373 ttgtgg 66378
>dbj|AB126351.1| Oryza sativa (japonica cultivar-group) OVP5 gene for vacuolar proton pyrophosphatase, complete cds Length = 5595 Score = 155 bits (78), Expect = 2e-34 Identities = 114/126 (90%) Strand = Plus / Minus Query: 366 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 425 |||||||||||||| ||||| |||||||| || || |||||||||||||||||||||||| Sbjct: 5248 gtggcgaagaagggggcgaaaacgagggattcgaccgccatgagcttgatgaggatgttg 5189 Query: 426 agcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcc 485 || || || ||||| ||||||||||| ||||||||||||||||||||||| ||||| ||| Sbjct: 5188 agagagggtcctgaagtgtccttgagagggtctccgatggtgtcaccgatgacggccgcc 5129 Query: 486 ttgtgg 491 |||||| Sbjct: 5128 ttgtgg 5123
>dbj|AB097115.1| Pyrus communis PVP3 mRNA for vacuolar proton-inorganic pyrophosphatase, complete cds Length = 2625 Score = 151 bits (76), Expect = 3e-33 Identities = 124/140 (88%) Strand = Plus / Minus Query: 366 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 425 |||||||||||||| || |||||||||||||| |||||||||||||| || ||||||||| Sbjct: 2337 gtggcgaagaagggagcaaacacgagggactccacggccatgagcttaataaggatgttg 2278 Query: 426 agcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcc 485 || || || ||||||||||||||||| |||||||| ||||||||||| ||||| || ||| Sbjct: 2277 agtgatggccctgaggtgtccttgagcgggtctccaatggtgtcaccaatcactgctgcc 2218 Query: 486 ttgtggcagtctgaaccctt 505 ||||| |||||||||||| Sbjct: 2217 ttgtgtgggtctgaaccctt 2198
>dbj|AP003568.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0017B12 Length = 157424 Score = 147 bits (74), Expect = 4e-32 Identities = 119/134 (88%) Strand = Plus / Minus Query: 366 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 425 ||||||||||| || || |||||||| ||||| || ||||| |||||||||||||||||| Sbjct: 49286 gtggcgaagaacggggcaaacacgagcgactcgacagccatcagcttgatgaggatgttg 49227 Query: 426 agcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcc 485 ||||| |||||||||||||||||||| || || || |||||||| |||||||| || ||| Sbjct: 49226 agcgaggggcctgaggtgtccttgagaggatccccaatggtgtcgccgatcacagcagcc 49167 Query: 486 ttgtggcagtctga 499 |||||||||||||| Sbjct: 49166 ttgtggcagtctga 49153
>dbj|AK119631.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-E10, full insert sequence Length = 1674 Score = 147 bits (74), Expect = 4e-32 Identities = 119/134 (88%) Strand = Plus / Minus Query: 366 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 425 ||||||||||| || || |||||||| ||||| || ||||| |||||||||||||||||| Sbjct: 1300 gtggcgaagaacggggcaaacacgagcgactcgacagccatcagcttgatgaggatgttg 1241 Query: 426 agcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcc 485 ||||| |||||||||||||||||||| || || || |||||||| |||||||| || ||| Sbjct: 1240 agcgaggggcctgaggtgtccttgagaggatccccaatggtgtcgccgatcacagcagcc 1181 Query: 486 ttgtggcagtctga 499 |||||||||||||| Sbjct: 1180 ttgtggcagtctga 1167
>emb|AJ304836.1|CRE304836 Chlamydomonas reinhardtii mRNA for proton-translocating inorganic pyrophosphatase (vppa gene) Length = 2381 Score = 147 bits (74), Expect = 4e-32 Identities = 113/126 (89%) Strand = Plus / Minus Query: 371 gaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcga 430 |||||||||||||||||| || ||||| ||||||||||||||||| |||||||||||||| Sbjct: 2277 gaagaagggcgcgaacaccagcgactccacggccatgagcttgatcaggatgttgagcga 2218 Query: 431 cgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtg 490 ||||| |||||||||||| ||||| || | |||||| |||||||||||||||||||| Sbjct: 2217 ggggccgttggtgtccttgagcgggtcgcccacggtgtcgccgatcacggcggccttgtg 2158 Query: 491 gcagtc 496 |||||| Sbjct: 2157 gcagtc 2152
>dbj|AK099807.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013098H04, full insert sequence Length = 3197 Score = 147 bits (74), Expect = 4e-32 Identities = 119/134 (88%) Strand = Plus / Minus Query: 366 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 425 ||||||||||| || || |||||||| ||||| || ||||| |||||||||||||||||| Sbjct: 2373 gtggcgaagaacggggcaaacacgagcgactcgacagccatcagcttgatgaggatgttg 2314 Query: 426 agcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcc 485 ||||| |||||||||||||||||||| || || || |||||||| |||||||| || ||| Sbjct: 2313 agcgaggggcctgaggtgtccttgagaggatccccaatggtgtcgccgatcacagcagcc 2254 Query: 486 ttgtggcagtctga 499 |||||||||||||| Sbjct: 2253 ttgtggcagtctga 2240
>dbj|AB012765.1| Oryza sativa gene for ovp1, complete cds Length = 6410 Score = 147 bits (74), Expect = 4e-32 Identities = 119/134 (88%) Strand = Plus / Minus Query: 366 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 425 ||||||||||| || || |||||||| ||||| || ||||| |||||||||||||||||| Sbjct: 6016 gtggcgaagaacggggcaaacacgagcgactcgacagccatcagcttgatgaggatgttg 5957 Query: 426 agcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcc 485 ||||| |||||||||||||||||||| || || || |||||||| |||||||| || ||| Sbjct: 5956 agcgaggggcctgaggtgtccttgagaggatccccaatggtgtcgccgatcacagcagcc 5897 Query: 486 ttgtggcagtctga 499 |||||||||||||| Sbjct: 5896 ttgtggcagtctga 5883
>dbj|D45383.1| Oryza sativa mRNA for vacuolar H+-pyrophosphatase, complete cds Length = 2742 Score = 147 bits (74), Expect = 4e-32 Identities = 119/134 (88%) Strand = Plus / Minus Query: 366 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 425 ||||||||||| || || |||||||| ||||| || ||||| |||||||||||||||||| Sbjct: 2349 gtggcgaagaacggggcaaacacgagcgactcgacagccatcagcttgatgaggatgttg 2290 Query: 426 agcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcc 485 ||||| |||||||||||||||||||| || || || |||||||| |||||||| || ||| Sbjct: 2289 agcgaggggcctgaggtgtccttgagaggatccccaatggtgtcgccgatcacagcagcc 2230 Query: 486 ttgtggcagtctga 499 |||||||||||||| Sbjct: 2229 ttgtggcagtctga 2216
>ref|XM_475605.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2313 Score = 133 bits (67), Expect = 6e-28 Identities = 109/123 (88%) Strand = Plus / Minus Query: 368 ggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgag 427 |||||||||||| ||||| ||||| | ||| |||||||||||||||| |||||||||||| Sbjct: 2280 ggcgaagaagggggcgaagacgagcgcctcgacggccatgagcttgacgaggatgttgag 2221 Query: 428 cgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcctt 487 ||| || || |||||||||||||| ||||| ||||||||||| |||||||| || ||||| Sbjct: 2220 cgatggccccgaggtgtccttgagcgggtcgccgatggtgtccccgatcaccgccgcctt 2161 Query: 488 gtg 490 ||| Sbjct: 2160 gtg 2158
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 133 bits (67), Expect = 6e-28 Identities = 109/123 (88%) Strand = Plus / Plus Query: 368 ggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgag 427 |||||||||||| ||||| ||||| | ||| |||||||||||||||| |||||||||||| Sbjct: 3275269 ggcgaagaagggggcgaagacgagcgcctcgacggccatgagcttgacgaggatgttgag 3275328 Query: 428 cgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcctt 487 ||| || || |||||||||||||| ||||| ||||||||||| |||||||| || ||||| Sbjct: 3275329 cgatggccccgaggtgtccttgagcgggtcgccgatggtgtccccgatcaccgccgcctt 3275388 Query: 488 gtg 490 ||| Sbjct: 3275389 gtg 3275391
>dbj|AK109809.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-147-G08, full insert sequence Length = 1486 Score = 133 bits (67), Expect = 6e-28 Identities = 109/123 (88%) Strand = Plus / Plus Query: 368 ggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgag 427 |||||||||||| ||||| ||||| | ||| |||||||||||||||| |||||||||||| Sbjct: 23 ggcgaagaagggggcgaagacgagcgcctcgacggccatgagcttgacgaggatgttgag 82 Query: 428 cgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcctt 487 ||| || || |||||||||||||| ||||| ||||||||||| |||||||| || ||||| Sbjct: 83 cgatggccccgaggtgtccttgagcgggtcgccgatggtgtccccgatcaccgccgcctt 142 Query: 488 gtg 490 ||| Sbjct: 143 gtg 145
>dbj|AK107275.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-126-A04, full insert sequence Length = 2661 Score = 133 bits (67), Expect = 6e-28 Identities = 109/123 (88%) Strand = Plus / Minus Query: 368 ggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgag 427 |||||||||||| ||||| ||||| | ||| |||||||||||||||| |||||||||||| Sbjct: 2375 ggcgaagaagggggcgaagacgagcgcctcgacggccatgagcttgacgaggatgttgag 2316 Query: 428 cgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcctt 487 ||| || || |||||||||||||| ||||| ||||||||||| |||||||| || ||||| Sbjct: 2315 cgatggccccgaggtgtccttgagcgggtcgccgatggtgtccccgatcaccgccgcctt 2256 Query: 488 gtg 490 ||| Sbjct: 2255 gtg 2253
>gb|AC087425.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0676G05, complete sequence Length = 167317 Score = 133 bits (67), Expect = 6e-28 Identities = 109/123 (88%) Strand = Plus / Plus Query: 368 ggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgag 427 |||||||||||| ||||| ||||| | ||| |||||||||||||||| |||||||||||| Sbjct: 69093 ggcgaagaagggggcgaagacgagcgcctcgacggccatgagcttgacgaggatgttgag 69152 Query: 428 cgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcctt 487 ||| || || |||||||||||||| ||||| ||||||||||| |||||||| || ||||| Sbjct: 69153 cgatggccccgaggtgtccttgagcgggtcgccgatggtgtccccgatcaccgccgcctt 69212 Query: 488 gtg 490 ||| Sbjct: 69213 gtg 69215
>gb|AF367446.1| Prunus persica clone Vp1 vacuolar H+-pyrophosphatase (vp1) mRNA, complete cds Length = 2619 Score = 129 bits (65), Expect = 1e-26 Identities = 110/125 (88%) Strand = Plus / Minus Query: 366 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 425 ||||| |||||||| || ||||| |||||||| || |||||||||||||||||||||||| Sbjct: 2346 gtggcaaagaagggagcaaacacaagggactccactgccatgagcttgatgaggatgttg 2287 Query: 426 agcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcc 485 || || ||||||||||||||||| || ||||| || ||||||||||| ||||| || ||| Sbjct: 2286 agtgatgggcctgaggtgtccttcagtgggtccccaatggtgtcaccaatcactgctgcc 2227 Query: 486 ttgtg 490 ||||| Sbjct: 2226 ttgtg 2222
>gb|AF257777.1|AF257777 Vitis vinifera H+-pyrophosphatase mRNA, complete cds Length = 2745 Score = 119 bits (60), Expect = 9e-24 Identities = 120/140 (85%) Strand = Plus / Minus Query: 369 gcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagc 428 |||||||| || ||||| || | |||||| || |||||||||||||| ||||||||||| Sbjct: 2495 gcgaagaacggagcgaagaccaaggactcgaccgccatgagcttgatcaggatgttgagt 2436 Query: 429 gacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttg 488 || ||||| ||||||||||||||||| || ||||| |||||||| ||||| || |||||| Sbjct: 2435 gaagggccagaggtgtccttgaggggatcgccgattgtgtcacctatcacagctgccttg 2376 Query: 489 tggcagtctgaacccttggg 508 ||| |||||| |||||||| Sbjct: 2375 tgggggtctgaccccttggg 2356
>gb|L32792.1|BEUPYROA Beta vulgaris clone P1 pyrophosphatase mRNA, complete cds Length = 2801 Score = 117 bits (59), Expect = 4e-23 Identities = 131/155 (84%) Strand = Plus / Minus Query: 336 tagatgtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggac 395 |||| ||||||||| |||| || |||| |||||||||||||| |||||||| || ||| Sbjct: 2354 tagaggtacttgaagagcaagccaccgtgggtggcgaagaagggggcgaacactagtgac 2295 Query: 396 tcaacggccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgaggggg 455 || || ||||| |||||||| || |||||||| || || ||||| |||||||| || ||| Sbjct: 2294 tcgacagccataagcttgattagaatgttgagtgatggtcctgatgtgtccttaagtggg 2235 Query: 456 tctccgatggtgtcaccgatcacggcggccttgtg 490 || |||||||||||||||||||| || |||||||| Sbjct: 2234 tcaccgatggtgtcaccgatcacagctgccttgtg 2200
>emb|AJ715528.1| Zea mays mRNA for vacuolar H+-translocating inorganic pyrophosphatase (vpp1 gene) Length = 2631 Score = 109 bits (55), Expect = 9e-21 Identities = 106/123 (86%) Strand = Plus / Minus Query: 368 ggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgag 427 |||||||||||| ||||| || ||||| ||||| ||||| |||||||||||||||||||| Sbjct: 2268 ggcgaagaagggggcgaagacaagggattcaaccgccataagcttgatgaggatgttgag 2209 Query: 428 cgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcctt 487 || ||||| || ||||||||||| || ||||| ||||||||||| || || || ||||| Sbjct: 2208 ggaagggccagacgtgtccttgagaggatctccaatggtgtcaccaatgacagccgcctt 2149 Query: 488 gtg 490 ||| Sbjct: 2148 gtg 2146
>emb|AJ715529.1| Zea mays vpp1 gene for vacuolar H+-translocating inorganic pyrophosphatase, exons 1-8 Length = 9177 Score = 109 bits (55), Expect = 9e-21 Identities = 106/123 (86%) Strand = Plus / Minus Query: 368 ggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgag 427 |||||||||||| ||||| || ||||| ||||| ||||| |||||||||||||||||||| Sbjct: 8742 ggcgaagaagggggcgaagacaagggattcaaccgccataagcttgatgaggatgttgag 8683 Query: 428 cgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcctt 487 || ||||| || ||||||||||| || ||||| ||||||||||| || || || ||||| Sbjct: 8682 ggaagggccagacgtgtccttgagaggatctccaatggtgtcaccaatgacagccgcctt 8623 Query: 488 gtg 490 ||| Sbjct: 8622 gtg 8620
>ref|NM_183912.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2322 Score = 105 bits (53), Expect = 1e-19 Identities = 116/137 (84%) Strand = Plus / Minus Query: 372 aagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcgac 431 ||||| |||||||| ||||| || || ||||||||||||||||| | ||||||||||||| Sbjct: 2291 aagaatggcgcgaagacgagagattcgacggccatgagcttgatcaagatgttgagcgac 2232 Query: 432 gggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtgg 491 || || || ||||||||||| ||||| || ||||| || |||||||| || |||||||| Sbjct: 2231 ggcccggatgtgtccttgagcgggtcgccaatggtatcgccgatcaccgccgccttgtga 2172 Query: 492 cagtctgaacccttggg 508 ||| ||||||||||| Sbjct: 2171 gcgtccgaacccttggg 2155
>gb|AY333187.1| Oryza sativa (japonica cultivar-group) H+-pyrophosphatase mRNA, complete cds Length = 2610 Score = 105 bits (53), Expect = 1e-19 Identities = 116/137 (84%) Strand = Plus / Minus Query: 372 aagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcgac 431 ||||| |||||||| ||||| || || ||||||||||||||||| | ||||||||||||| Sbjct: 2388 aagaatggcgcgaagacgagagattcgacggccatgagcttgatcaagatgttgagcgac 2329 Query: 432 gggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtgg 491 || || || ||||||||||| ||||| || ||||| || |||||||| || |||||||| Sbjct: 2328 ggcccggatgtgtccttgagcgggtcgccaatggtatcgccgatcaccgccgccttgtga 2269 Query: 492 cagtctgaacccttggg 508 ||| ||||||||||| Sbjct: 2268 gcgtccgaacccttggg 2252
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 105 bits (53), Expect = 1e-19 Identities = 116/137 (84%) Strand = Plus / Minus Query: 372 aagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcgac 431 ||||| |||||||| ||||| || || ||||||||||||||||| | ||||||||||||| Sbjct: 13228730 aagaatggcgcgaagacgagagattcgacggccatgagcttgatcaagatgttgagcgac 13228671 Query: 432 gggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtgg 491 || || || ||||||||||| ||||| || ||||| || |||||||| || |||||||| Sbjct: 13228670 ggcccggatgtgtccttgagcgggtcgccaatggtatcgccgatcaccgccgccttgtga 13228611 Query: 492 cagtctgaacccttggg 508 ||| ||||||||||| Sbjct: 13228610 gcgtccgaacccttggg 13228594
>dbj|AP003793.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0487E11 Length = 151303 Score = 105 bits (53), Expect = 1e-19 Identities = 116/137 (84%) Strand = Plus / Minus Query: 372 aagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcgac 431 ||||| |||||||| ||||| || || ||||||||||||||||| | ||||||||||||| Sbjct: 101031 aagaatggcgcgaagacgagagattcgacggccatgagcttgatcaagatgttgagcgac 100972 Query: 432 gggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtgg 491 || || || ||||||||||| ||||| || ||||| || |||||||| || |||||||| Sbjct: 100971 ggcccggatgtgtccttgagcgggtcgccaatggtatcgccgatcaccgccgccttgtga 100912 Query: 492 cagtctgaacccttggg 508 ||| ||||||||||| Sbjct: 100911 gcgtccgaacccttggg 100895
>gb|AF367447.1| Prunus persica clone Vp2 vacuolar H+-pyrophosphatase (vp2) mRNA, complete cds Length = 2646 Score = 101 bits (51), Expect = 2e-18 Identities = 87/99 (87%) Strand = Plus / Minus Query: 392 ggactcaacggccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgag 451 ||||||||| |||||||||||||| || |||||||| || || || || ||||||||||| Sbjct: 2340 ggactcaactgccatgagcttgataagaatgttgagtgaaggaccagaagtgtccttgag 2281 Query: 452 ggggtctccgatggtgtcaccgatcacggcggccttgtg 490 |||||||||||| ||||| || |||||||| |||||||| Sbjct: 2280 ggggtctccgattgtgtcgcctatcacggccgccttgtg 2242
>dbj|AP006375.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT32M04, TM0219, complete sequence Length = 72880 Score = 95.6 bits (48), Expect = 1e-16 Identities = 90/104 (86%) Strand = Plus / Minus Query: 369 gcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagc 428 ||||||||||| ||||||||||| |||||||| ||||| ||||||||||||||||| || Sbjct: 42907 gcgaagaagggtgcgaacacgagagactcaacagccattagcttgatgaggatgttaagt 42848 Query: 429 gacgggcctgaggtgtccttgagggggtctccgatggtgtcacc 472 || || || || || ||||| || |||||||| ||||||||||| Sbjct: 42847 gagggaccagatgtatccttaagagggtctccaatggtgtcacc 42804
>gb|BT018996.1| Zea mays clone Contig484.F mRNA sequence Length = 1100 Score = 93.7 bits (47), Expect = 5e-16 Identities = 104/123 (84%) Strand = Plus / Minus Query: 368 ggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgag 427 |||||||||||| ||||| || ||||| ||||| ||||| ||||||||||| |||||||| Sbjct: 580 ggcgaagaagggggcgaagacaagggattcaaccgccataagcttgatgagaatgttgag 521 Query: 428 cgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcctt 487 || ||||| || ||||||||||| || ||||| || |||||||| || || || ||||| Sbjct: 520 ggaggggccagacgtgtccttgagaggatctccaatagtgtcaccaatgacagccgcctt 461 Query: 488 gtg 490 ||| Sbjct: 460 gtg 458
>emb|AJ557256.2|VVI557256 Vitis vinifera mRNA for vacuolar pyrophosphatase (vpp2 gene) Length = 2664 Score = 93.7 bits (47), Expect = 5e-16 Identities = 83/95 (87%) Strand = Plus / Minus Query: 396 tcaacggccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgaggggg 455 ||||| ||||| |||||||||||||||||||| |||||||| || ||||||||||| ||| Sbjct: 2231 tcaactgccattagcttgatgaggatgttgagagacgggccagaagtgtccttgagaggg 2172 Query: 456 tctccgatggtgtcaccgatcacggcggccttgtg 490 || || || |||||||| ||||| || |||||||| Sbjct: 2171 tccccaattgtgtcaccaatcacagctgccttgtg 2137
>gb|AY514019.1| Hevea brasiliensis PPase mRNA, complete cds Length = 2807 Score = 89.7 bits (45), Expect = 8e-15 Identities = 96/113 (84%) Strand = Plus / Minus Query: 366 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 425 ||||| |||||||| || || ||||| || || || ||||| ||||||||||| |||||| Sbjct: 2386 gtggcaaagaagggagcaaagacgagagattccacagccataagcttgatgagaatgttg 2327 Query: 426 agcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcac 478 || || |||||||| |||||||| || ||||| |||||||||||||| ||||| Sbjct: 2326 agtgatgggcctgaagtgtccttaagtgggtcaccgatggtgtcaccaatcac 2274
>gb|BT018410.1| Zea mays clone EL01N0326G05.d mRNA sequence Length = 1446 Score = 87.7 bits (44), Expect = 3e-14 Identities = 105/124 (84%), Gaps = 1/124 (0%) Strand = Plus / Minus Query: 368 ggcgaagaagggcgcgaacac-gagggactcaacggccatgagcttgatgaggatgttga 426 |||||||||||| ||||| || |||||| ||||| ||||| ||||||||||| ||||||| Sbjct: 936 ggcgaagaagggggcgaagacagagggattcaaccgccataagcttgatgagaatgttga 877 Query: 427 gcgacgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcct 486 | || ||||| || ||||||||||| || ||||| || |||||||| || || || |||| Sbjct: 876 gggaggggccagacgtgtccttgagaggatctccaatagtgtcaccaatgacagccgcct 817 Query: 487 tgtg 490 |||| Sbjct: 816 tgtg 813
>gb|AF533337.1| Chenopodium rubrum vacuolar proton-pumping PPase (CVP1) precursor RNA, intron and complete cds Length = 2898 Score = 85.7 bits (43), Expect = 1e-13 Identities = 100/119 (84%) Strand = Plus / Minus Query: 372 aagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcgac 431 |||||||| || ||||| || ||||| || ||||| |||||||| || |||||||| ||| Sbjct: 2540 aagaagggggcaaacactagtgactcgacagccataagcttgatcagaatgttgagtgac 2481 Query: 432 gggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtg 490 || || || |||||||| || ||||| || ||||||||||||||||| || |||||||| Sbjct: 2480 ggtccagatgtgtccttaagagggtcaccaatggtgtcaccgatcacagcagccttgtg 2422
>gb|AF533336.1| Chenopodium rubrum vacuolar proton-pumping PPase (CVP1) mRNA, complete cds Length = 2695 Score = 85.7 bits (43), Expect = 1e-13 Identities = 100/119 (84%) Strand = Plus / Minus Query: 372 aagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcgac 431 |||||||| || ||||| || ||||| || ||||| |||||||| || |||||||| ||| Sbjct: 2337 aagaagggggcaaacactagtgactcgacagccataagcttgatcagaatgttgagtgac 2278 Query: 432 gggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtg 490 || || || |||||||| || ||||| || ||||||||||||||||| || |||||||| Sbjct: 2277 ggtccagatgtgtccttaagagggtcaccaatggtgtcaccgatcacagcagccttgtg 2219
>dbj|AB018529.1| Chara corallina CPP1 mRNA for vacuolar H+-pyrophosphatase, complete cds Length = 2839 Score = 83.8 bits (42), Expect = 5e-13 Identities = 114/138 (82%) Strand = Plus / Minus Query: 371 gaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcga 430 |||||| ||||| ||||| ||||| || ||||||||||||||||| || |||||||| || Sbjct: 2558 gaagaaaggcgcaaacacaagggattcgacggccatgagcttgataagaatgttgagtga 2499 Query: 431 cgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtg 490 ||| || || ||||||||||| || || || | ||||| || || || ||||| ||||| Sbjct: 2498 cggtccagatgtgtccttgagaggatcacccacagtgtccccaatgacagcggctttgtg 2439 Query: 491 gcagtctgaacccttggg 508 |||||| || |||||||| Sbjct: 2438 gcagtccgaccccttggg 2421
>gb|U31467.1|VRU31467 Vigna radiata pyrophosphatase mRNA, complete cds Length = 2522 Score = 79.8 bits (40), Expect = 8e-12 Identities = 106/128 (82%) Strand = Plus / Minus Query: 372 aagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcgac 431 |||||||| || || || || |||||||| ||||| |||||||| |||||||| || || Sbjct: 2284 aagaagggggcaaaaacaagagactcaactgccatcagcttgataaggatgttaagtgag 2225 Query: 432 gggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtgg 491 || || || || |||||||| |||||||| ||||||||||| || || || ||||||||| Sbjct: 2224 ggaccagatgtatccttgagagggtctccaatggtgtcaccaataactgctgccttgtgg 2165 Query: 492 cagtctga 499 || ||||| Sbjct: 2164 caatctga 2157
>dbj|AB009077.1| Vigna radiata mRNA for proton pyrophosphatase, complete cds Length = 2531 Score = 79.8 bits (40), Expect = 8e-12 Identities = 106/128 (82%) Strand = Plus / Minus Query: 372 aagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcgac 431 |||||||| || || || || |||||||| ||||| |||||||| |||||||| || || Sbjct: 2277 aagaagggggcaaaaacaagagactcaactgccatcagcttgataaggatgttaagtgag 2218 Query: 432 gggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtgg 491 || || || || |||||||| |||||||| ||||||||||| || || || ||||||||| Sbjct: 2217 ggaccagatgtatccttgagagggtctccaatggtgtcaccaataactgctgccttgtgg 2158 Query: 492 cagtctga 499 || ||||| Sbjct: 2157 caatctga 2150
>ref|NM_101437.2| Arabidopsis thaliana AVP1; ATPase AT1G15690 (AVP1) mRNA, complete cds Length = 3207 Score = 77.8 bits (39), Expect = 3e-11 Identities = 126/155 (81%) Strand = Plus / Minus Query: 336 tagatgtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggac 395 |||| ||||||||| || | ||| |||| |||||||||||||| || || || || ||| Sbjct: 2437 tagaagtacttgaaaaggataccaccgtgagtggcgaagaagggagcaaagacaagagac 2378 Query: 396 tcaacggccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgaggggg 455 ||||| ||||||||||||||||||||||| | || || ||||| || ||||| | ||| Sbjct: 2377 tcaacagccatgagcttgatgaggatgttcaatgaaggtcctgaagtatccttcaatggg 2318 Query: 456 tctccgatggtgtcaccgatcacggcggccttgtg 490 ||||| || ||||| || ||||| || |||||||| Sbjct: 2317 tctccaattgtgtctccaatcacagctgccttgtg 2283
>gb|DQ443731.1| Chenopodium glaucum vacuolar H+-pyrophosphatase (CVP1) mRNA, complete cds Length = 2718 Score = 77.8 bits (39), Expect = 3e-11 Identities = 99/119 (83%) Strand = Plus / Minus Query: 372 aagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcgac 431 |||||||| || ||||| || |||||||| ||||| |||||||| ||||||||||| || Sbjct: 2255 aagaagggggcaaacactagtgactcaacagccatcagcttgatcaggatgttgagtgat 2196 Query: 432 gggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtg 490 || || || || ||||| || ||||| || ||||||||||| ||||| || |||||||| Sbjct: 2195 ggtccagatgtatccttaagagggtcaccaatggtgtcaccaatcacagctgccttgtg 2137
>gb|AY078953.1| Arabidopsis thaliana At1g15690/F7H2_3 mRNA, complete cds Length = 2669 Score = 77.8 bits (39), Expect = 3e-11 Identities = 126/155 (81%) Strand = Plus / Minus Query: 336 tagatgtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggac 395 |||| ||||||||| || | ||| |||| |||||||||||||| || || || || ||| Sbjct: 2430 tagaagtacttgaaaaggataccaccgtgagtggcgaagaagggagcaaagacaagagac 2371 Query: 396 tcaacggccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgaggggg 455 ||||| ||||||||||||||||||||||| | || || ||||| || ||||| | ||| Sbjct: 2370 tcaacagccatgagcttgatgaggatgttcaatgaaggtcctgaagtatccttcaatggg 2311 Query: 456 tctccgatggtgtcaccgatcacggcggccttgtg 490 ||||| || ||||| || ||||| || |||||||| Sbjct: 2310 tctccaattgtgtctccaatcacagctgccttgtg 2276
>gb|AY065016.1| Arabidopsis thaliana At1g15690/F7H2_3 mRNA, complete cds Length = 2760 Score = 77.8 bits (39), Expect = 3e-11 Identities = 126/155 (81%) Strand = Plus / Minus Query: 336 tagatgtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggac 395 |||| ||||||||| || | ||| |||| |||||||||||||| || || || || ||| Sbjct: 2430 tagaagtacttgaaaaggataccaccgtgagtggcgaagaagggagcaaagacaagagac 2371 Query: 396 tcaacggccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgaggggg 455 ||||| ||||||||||||||||||||||| | || || ||||| || ||||| | ||| Sbjct: 2370 tcaacagccatgagcttgatgaggatgttcaatgaaggtcctgaagtatccttcaatggg 2311 Query: 456 tctccgatggtgtcaccgatcacggcggccttgtg 490 ||||| || ||||| || ||||| || |||||||| Sbjct: 2310 tctccaattgtgtctccaatcacagctgccttgtg 2276
>dbj|AK221989.1| Arabidopsis thaliana mRNA for hypothetical protein, complete cds, clone: RAFL22-60-N09 Length = 717 Score = 77.8 bits (39), Expect = 3e-11 Identities = 126/155 (81%) Strand = Plus / Minus Query: 336 tagatgtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggac 395 |||| ||||||||| || | ||| |||| |||||||||||||| || || || || ||| Sbjct: 532 tagaagtacttgaaaaggataccaccgtgagtggcgaagaagggagcaaagacaagagac 473 Query: 396 tcaacggccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgaggggg 455 ||||| ||||||||||||||||||||||| | || || ||||| || ||||| | ||| Sbjct: 472 tcaacagccatgagcttgatgaggatgttcaatgaaggtcctgaagtatccttcaatggg 413 Query: 456 tctccgatggtgtcaccgatcacggcggccttgtg 490 ||||| || ||||| || ||||| || |||||||| Sbjct: 412 tctccaattgtgtctccaatcacagctgccttgtg 378
>gb|BT002481.1| Arabidopsis thaliana Unknown protein mRNA, complete cds Length = 2680 Score = 77.8 bits (39), Expect = 3e-11 Identities = 126/155 (81%) Strand = Plus / Minus Query: 336 tagatgtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggac 395 |||| ||||||||| || | ||| |||| |||||||||||||| || || || || ||| Sbjct: 2437 tagaagtacttgaaaaggataccaccgtgagtggcgaagaagggagcaaagacaagagac 2378 Query: 396 tcaacggccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgaggggg 455 ||||| ||||||||||||||||||||||| | || || ||||| || ||||| | ||| Sbjct: 2377 tcaacagccatgagcttgatgaggatgttcaatgaaggtcctgaagtatccttcaatggg 2318 Query: 456 tctccgatggtgtcaccgatcacggcggccttgtg 490 ||||| || ||||| || ||||| || |||||||| Sbjct: 2317 tctccaattgtgtctccaatcacagctgccttgtg 2283
>gb|AC034256.3|F7H2 Sequence of BAC F7H2 from Arabidopsis thaliana chromosome 1, complete sequence Length = 77521 Score = 77.8 bits (39), Expect = 3e-11 Identities = 126/155 (81%) Strand = Plus / Minus Query: 336 tagatgtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggac 395 |||| ||||||||| || | ||| |||| |||||||||||||| || || || || ||| Sbjct: 14757 tagaagtacttgaaaaggataccaccgtgagtggcgaagaagggagcaaagacaagagac 14698 Query: 396 tcaacggccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgaggggg 455 ||||| ||||||||||||||||||||||| | || || ||||| || ||||| | ||| Sbjct: 14697 tcaacagccatgagcttgatgaggatgttcaatgaaggtcctgaagtatccttcaatggg 14638 Query: 456 tctccgatggtgtcaccgatcacggcggccttgtg 490 ||||| || ||||| || ||||| || |||||||| Sbjct: 14637 tctccaattgtgtctccaatcacagctgccttgtg 14603
>dbj|AB015138.1| Arabidopsis thaliana AVP3 gene for Vacuolar proton pyrophosphatase, complete cds Length = 4648 Score = 77.8 bits (39), Expect = 3e-11 Identities = 126/155 (81%) Strand = Plus / Minus Query: 336 tagatgtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggac 395 |||| ||||||||| || | ||| |||| |||||||||||||| || || || || ||| Sbjct: 4484 tagaagtacttgaaaaggataccaccgtgagtggcgaagaagggagcaaagacaagagac 4425 Query: 396 tcaacggccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgaggggg 455 ||||| ||||||||||||||||||||||| | || || ||||| || ||||| | ||| Sbjct: 4424 tcaacagccatgagcttgatgaggatgttcaatgaaggtcctgaagtatccttcaatggg 4365 Query: 456 tctccgatggtgtcaccgatcacggcggccttgtg 490 ||||| || ||||| || ||||| || |||||||| Sbjct: 4364 tctccaattgtgtctccaatcacagctgccttgtg 4330
>emb|X83728.1|NTIPTVP17 N.tabacum mRNA for inorganic pyrophosphatase (TVP17 clone) Length = 1838 Score = 77.8 bits (39), Expect = 3e-11 Identities = 120/147 (81%) Strand = Plus / Minus Query: 344 cttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggc 403 |||||| || ||||| |||| |||||||||||||| |||||||||||||| || || || Sbjct: 1618 cttgaagagaagaccaccgtgagtggcgaagaagggagcgaacacgagggattcgacagc 1559 Query: 404 catgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgagggggtctccgat 463 ||| ||||||||||| ||||| | || || || || ||||||||||| ||||| || | Sbjct: 1558 catcagcttgatgagaatgttcaatgatggtccagatgtgtccttgagagggtcaccaac 1499 Query: 464 ggtgtcaccgatcacggcggccttgtg 490 |||||||| || || || |||||||| Sbjct: 1498 agtgtcaccaataacagcagccttgtg 1472
>gb|M61742.1|ATHPATPC A.thaliana chloroplast ATP synthase gamma subunit (atpC2) gene, complete cds Length = 4418 Score = 77.8 bits (39), Expect = 3e-11 Identities = 126/155 (81%) Strand = Plus / Plus Query: 336 tagatgtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggac 395 |||| ||||||||| || | ||| |||| |||||||||||||| || || || || ||| Sbjct: 3647 tagaagtacttgaaaaggataccaccgtgagtggcgaagaagggagcaaagacaagagac 3706 Query: 396 tcaacggccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgaggggg 455 ||||| ||||||||||||||||||||||| | || || ||||| || ||||| | ||| Sbjct: 3707 tcaacagccatgagcttgatgaggatgttcaatgaaggtcctgaagtatccttcaatggg 3766 Query: 456 tctccgatggtgtcaccgatcacggcggccttgtg 490 ||||| || ||||| || ||||| || |||||||| Sbjct: 3767 tctccaattgtgtctccaatcacagctgccttgtg 3801
>gb|M81892.1|ATHAVP3 Arabidopsis thaliana vacuolar H+ - pyrophosphatase (AVP-3) mRNA, complete cds Length = 2813 Score = 77.8 bits (39), Expect = 3e-11 Identities = 126/155 (81%) Strand = Plus / Minus Query: 336 tagatgtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggac 395 |||| ||||||||| || | ||| |||| |||||||||||||| || || || || ||| Sbjct: 2467 tagaagtacttgaaaaggataccaccgtgagtggcgaagaagggagcaaagacaagagac 2408 Query: 396 tcaacggccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgaggggg 455 ||||| ||||||||||||||||||||||| | || || ||||| || ||||| | ||| Sbjct: 2407 tcaacagccatgagcttgatgaggatgttcaatgaaggtcctgaagtatccttcaatggg 2348 Query: 456 tctccgatggtgtcaccgatcacggcggccttgtg 490 ||||| || ||||| || ||||| || |||||||| Sbjct: 2347 tctccaattgtgtctccaatcacagctgccttgtg 2313
>emb|X83730.1|NTIPTVP9 N.tabacum mRNA for inorganic pyrophosphatase (TVP9 clone) Length = 2551 Score = 75.8 bits (38), Expect = 1e-10 Identities = 131/162 (80%) Strand = Plus / Minus Query: 344 cttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggc 403 |||||| |||||||| || | ||||| ||||| || || || ||||| || || || || Sbjct: 2307 cttgaaaagcagaccaccatgagtggcaaagaatggagcaaatacgagtgattcgactgc 2248 Query: 404 catgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgagggggtctccgat 463 ||| |||||||| || |||||||| || |||||||| |||||||| || ||||| || || Sbjct: 2247 catcagcttgatcagaatgttgagtgatgggcctgaagtgtccttcagagggtcgccaat 2188 Query: 464 ggtgtcaccgatcacggcggccttgtggcagtctgaaccctt 505 ||||||||| || || || |||||||| |||||||||||| Sbjct: 2187 ggtgtcaccaataacagctgccttgtgtgggtctgaaccctt 2146
>dbj|AK110424.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-166-A10, full insert sequence Length = 2654 Score = 75.8 bits (38), Expect = 1e-10 Identities = 65/74 (87%) Strand = Plus / Minus Query: 401 ggccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgagggggtctcc 460 ||||||||| |||||||| ||||||||||||||||| || |||||||| || ||||| || Sbjct: 2229 ggccatgagtttgatgagaatgttgagcgacgggccagacgtgtccttcagcgggtcacc 2170 Query: 461 gatggtgtcaccga 474 || |||||||||| Sbjct: 2169 gaccgtgtcaccga 2156
>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome Length = 3566135 Score = 71.9 bits (36), Expect = 2e-09 Identities = 72/84 (85%) Strand = Plus / Plus Query: 408 agcttgatgaggatgttgagcgacgggcctgaggtgtccttgagggggtctccgatggtg 467 |||||||| |||||||| | ||||||||| ||||||||||||| |||||| |||| ||| Sbjct: 2750041 agcttgatcaggatgttcatcgacgggccggaggtgtccttgaaggggtcgccgaccgtg 2750100 Query: 468 tcaccgatcacggcggccttgtgg 491 || |||| ||||| ||||||||| Sbjct: 2750101 tcgccgacgacggccgccttgtgg 2750124
>gb|L32791.1|BEUPYRO Beta vulgaris clone P2 pyrophosphatase mRNA, complete cds Length = 2868 Score = 69.9 bits (35), Expect = 8e-09 Identities = 98/119 (82%) Strand = Plus / Minus Query: 372 aagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcgac 431 ||||| || ||||| ||||| |||||||||||||| || ||||| | ||||| | || Sbjct: 2449 aagaatggagcgaaaacgagagactcaacggccataagtttgatcaaaatgttcaatgaa 2390 Query: 432 gggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtg 490 |||||||||||||||||||| ||||| || ||||| ||||| || || || |||||||| Sbjct: 2389 gggcctgaggtgtccttgagtgggtcaccaatggtatcaccaatgactgctgccttgtg 2331
>emb|AJ278019.1|LES278019 Lycopersicon esculentum partial mRNA for vacuolar-type H+-pyrophosphatase (vp1.1 gene) Length = 1335 Score = 69.9 bits (35), Expect = 8e-09 Identities = 95/115 (82%) Strand = Plus / Minus Query: 343 acttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacgg 402 ||||||| || ||||| |||| |||||| |||||||| || |||||||||||||| || | Sbjct: 1063 acttgaagagaagaccaccgtgcgtggcaaagaagggagcaaacacgagggactcgacag 1004 Query: 403 ccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgagggggtc 457 |||| |||||||| || ||||| | || || || || ||||||||||| ||||| Sbjct: 1003 ccatcagcttgataagaatgttcaatgatggtccagatgtgtccttgagagggtc 949
>emb|X83729.1|NTIPTVP31 N.tabacum mRNA for inorganic pyrophosphatase (TVP31 clone) Length = 2867 Score = 69.9 bits (35), Expect = 8e-09 Identities = 119/147 (80%) Strand = Plus / Minus Query: 344 cttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggc 403 |||||| || ||||| |||| ||||| |||||||| |||||||| ||||| || || || Sbjct: 2646 cttgaagagaagaccaccgtgagtggcaaagaagggagcgaacaccagggattcgacagc 2587 Query: 404 catgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgagggggtctccgat 463 ||| ||||||||||| ||||| || || || || || || |||||||| ||||| || | Sbjct: 2586 catcagcttgatgagaatgttcagtgatggtccagatgtatccttgagagggtcaccaac 2527 Query: 464 ggtgtcaccgatcacggcggccttgtg 490 |||||||| ||||| || |||||||| Sbjct: 2526 agtgtcaccaatcacagcagccttgtg 2500
>gb|AY436553.2| Thellungiella salsuginea pyrophosphate-energized vacuolar membrane proton pump (vp1) mRNA, complete cds Length = 2759 Score = 67.9 bits (34), Expect = 3e-08 Identities = 121/150 (80%) Strand = Plus / Minus Query: 341 gtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaac 400 ||||||||| || | ||| |||| ||||| |||||||| || || || || |||||||| Sbjct: 2409 gtacttgaaaaggataccaccgtgggtggcaaagaagggagcaaagacaagagactcaac 2350 Query: 401 ggccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgagggggtctcc 460 |||||||||||||| |||||||| | ||| || ||||| || ||||| | |||||||| Sbjct: 2349 agccatgagcttgatcaggatgttcaacgaaggtcctgaagtatccttcaatgggtctcc 2290 Query: 461 gatggtgtcaccgatcacggcggccttgtg 490 |||||||| || || || || |||||||| Sbjct: 2289 aatggtgtctccaataacagctgccttgtg 2260
>gb|CP000088.1| Thermobifida fusca YX, complete genome Length = 3642249 Score = 56.0 bits (28), Expect = 1e-04 Identities = 49/56 (87%) Strand = Plus / Minus Query: 431 cgggcctgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcct 486 |||||| | ||||||||||| |||||| ||||||||||| ||||| |||| ||||| Sbjct: 158988 cgggcccgcggtgtccttgaaggggtcgccgatggtgtcgccgatgacggtggcct 158933
>gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome Length = 3551823 Score = 56.0 bits (28), Expect = 1e-04 Identities = 73/88 (82%) Strand = Plus / Minus Query: 403 ccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgagggggtctccga 462 |||| ||||||||||||| ||||||||| || |||| |||||||| || ||||| || | Sbjct: 1035895 ccatcagcttgatgaggacgttgagcgagggccctgccgtgtccttcagcgggtcgccca 1035836 Query: 463 tggtgtcaccgatcacggcggccttgtg 490 |||||| || | ||||| ||||||||| Sbjct: 1035835 cggtgtcgcccaccacggaggccttgtg 1035808
>dbj|AK110444.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-166-D10, full insert sequence Length = 2786 Score = 50.1 bits (25), Expect = 0.007 Identities = 52/61 (85%) Strand = Plus / Minus Query: 402 gccatgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgagggggtctccg 461 ||||| |||||||| |||||||| |||| ||||| || ||||||||||| ||||| ||| Sbjct: 2504 gccatcagcttgatcaggatgttcagcgcggggccggacgtgtccttgagcgggtcgccg 2445 Query: 462 a 462 | Sbjct: 2444 a 2444
>gb|U74631.1|RCU74631 Ricinus communis calreticulin gene, complete cds Length = 4975 Score = 50.1 bits (25), Expect = 0.007 Identities = 100/125 (80%) Strand = Plus / Minus Query: 345 ttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggcc 404 ||||||||||||||||||| | || ||||| || || ||||| | ||||| || ||| Sbjct: 183 ttgaacagcagacctccgtgagcagcaaagaatggagcaaacaccaatgactcgactgcc 124 Query: 405 atgagcttgatgaggatgttgagcgacgggcctgaggtgtccttgagggggtctccgatg 464 ||||||||||| ||||| || || || || || || |||||||| || ||||| ||||| Sbjct: 123 atgagcttgatcaggatattaagtgatggacccgaagtgtccttaagagggtcgccgatt 64 Query: 465 gtgtc 469 ||||| Sbjct: 63 gtgtc 59
>gb|AC004695.1|AC004695 Homo sapiens BAC clone CTA-317H1 from 3p13-3p14.2, complete sequence Length = 149572 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Plus Query: 262 gaaggcgggcgggcaggcaggcgg 285 |||||||||||||||||||||||| Sbjct: 102371 gaaggcgggcgggcaggcaggcgg 102394
>gb|AC163640.5| Mus musculus BAC clone RP24-182L3 from chromosome 16, complete sequence Length = 168350 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 264 aggcgggcgggcaggcaggcggg 286 ||||||||||||||||||||||| Sbjct: 151434 aggcgggcgggcaggcaggcggg 151412
>gb|AC160961.3| Mus musculus BAC clone RP24-288N19 from chromosome 16, complete sequence Length = 157144 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 264 aggcgggcgggcaggcaggcggg 286 ||||||||||||||||||||||| Sbjct: 4912 aggcgggcgggcaggcaggcggg 4890
>gb|AC122873.5| Mus musculus BAC clone RP23-110K10 from 8, complete sequence Length = 199474 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 264 aggcgggcgggcaggcaggcggg 286 ||||||||||||||||||||||| Sbjct: 91354 aggcgggcgggcaggcaggcggg 91376
>gb|CP000316.1| Polaromonas sp. JS666, complete genome Length = 5200264 Score = 46.1 bits (23), Expect = 0.11 Identities = 44/51 (86%) Strand = Plus / Plus Query: 440 ggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtg 490 |||||||||| |||||| || | |||||| ||| |||||||||||||||| Sbjct: 2393256 ggtgtccttgtaggggtcgcccacggtgtcgccggtcacggcggccttgtg 2393306
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome Length = 5331656 Score = 46.1 bits (23), Expect = 0.11 Identities = 44/51 (86%) Strand = Plus / Minus Query: 441 gtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtgg 491 ||||||||| |||||| |||| |||||| ||| |||| |||||||||||| Sbjct: 3022880 gtgtccttgtaggggtcgccgacggtgtcgccggtcaccgcggccttgtgg 3022830
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome Length = 4751080 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 368 ggcgaagaagggcgcgaacacga 390 ||||||||||||||||||||||| Sbjct: 972774 ggcgaagaagggcgcgaacacga 972796
>emb|CR956397.19| Pig DNA sequence from clone CH242-259E5 on chromosome 17, complete sequence Length = 177531 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 264 aggcgggcgggcaggcaggcggg 286 ||||||||||||||||||||||| Sbjct: 41128 aggcgggcgggcaggcaggcggg 41150
>gb|AC127258.4| Mus musculus BAC clone RP24-302G16 from 8, complete sequence Length = 163028 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 264 aggcgggcgggcaggcaggcggg 286 ||||||||||||||||||||||| Sbjct: 1135 aggcgggcgggcaggcaggcggg 1113
>ref|NM_001033812.1| Mus musculus RIKEN cDNA F830208F22 gene (F830208F22Rik), mRNA Length = 2892 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 266 gcgggcgggcaggcaggcgggg 287 |||||||||||||||||||||| Sbjct: 1663 gcgggcgggcaggcaggcgggg 1642
>gb|AF109905.1|MMHC213L3 Mus musculus major histocompatibility locus class III regions Hsc70t gene, partial cds; smRNP, G7A, NG23, MutS homolog, CLCP, NG24, NG25, and NG26 genes, complete cds; and unknown genes Length = 135545 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 265 ggcgggcgggcaggcaggcggg 286 |||||||||||||||||||||| Sbjct: 122842 ggcgggcgggcaggcaggcggg 122821
>gb|AC162291.13| Mus musculus chromosome 18, clone RP23-264B14, complete sequence Length = 198736 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 266 gcgggcgggcaggcaggcgggg 287 |||||||||||||||||||||| Sbjct: 77888 gcgggcgggcaggcaggcgggg 77867
>gb|BC056354.1| Mus musculus LUC7-like 2 (S. cerevisiae), mRNA (cDNA clone MGC:73491 IMAGE:6811460), complete cds Length = 2691 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 267 cgggcgggcaggcaggcggggg 288 |||||||||||||||||||||| Sbjct: 377 cgggcgggcaggcaggcggggg 356
>gb|BC056383.1| Mus musculus LUC7-like 2 (S. cerevisiae), mRNA (cDNA clone MGC:73932 IMAGE:6853955), complete cds Length = 4252 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 267 cgggcgggcaggcaggcggggg 288 |||||||||||||||||||||| Sbjct: 358 cgggcgggcaggcaggcggggg 337
>gb|AC132099.3| Mus musculus BAC clone RP24-292F6 from chromosome 16, complete sequence Length = 160650 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 265 ggcgggcgggcaggcaggcggg 286 |||||||||||||||||||||| Sbjct: 7840 ggcgggcgggcaggcaggcggg 7819
>gb|AC083805.17| Homo sapiens 12 BAC RP11-620J15 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 104816 Score = 44.1 bits (22), Expect = 0.44 Identities = 25/26 (96%) Strand = Plus / Minus Query: 265 ggcgggcgggcaggcaggcgggggag 290 ||||||||||||||| |||||||||| Sbjct: 85751 ggcgggcgggcaggctggcgggggag 85726
>gb|BC056970.1| Mus musculus LUC7-like 2 (S. cerevisiae), mRNA (cDNA clone MGC:66790 IMAGE:6811460), complete cds Length = 2691 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 267 cgggcgggcaggcaggcggggg 288 |||||||||||||||||||||| Sbjct: 377 cgggcgggcaggcaggcggggg 356
>gb|AC087117.9| Mus Musculus Strain C57BL6/J chromosome 17 BAC, RP23-349B4, Complete Sequence, complete sequence Length = 221899 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 265 ggcgggcgggcaggcaggcggg 286 |||||||||||||||||||||| Sbjct: 208704 ggcgggcgggcaggcaggcggg 208683
>gb|AC114487.2| Homo sapiens chromosome 1 clone RP4-706L14, complete sequence Length = 160957 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 262 gaaggcgggcgggcaggcaggc 283 |||||||||||||||||||||| Sbjct: 135833 gaaggcgggcgggcaggcaggc 135854
>gb|AE005811.1| Caulobacter crescentus CB15 section 137 of 359 of the complete genome Length = 10363 Score = 44.1 bits (22), Expect = 0.44 Identities = 46/54 (85%) Strand = Plus / Minus Query: 438 gaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtgg 491 |||||||||||| |||||| |||| |||||| ||| | ||||| ||||||||| Sbjct: 8796 gaggtgtccttgtaggggtcgccgacggtgtcgccggtgacggccgccttgtgg 8743
>dbj|AK134191.1| Mus musculus adult male thymus cDNA, RIKEN full-length enriched library, clone:5830469J19 product:LUC7-like 2 (S. cerevisiae), full insert sequence Length = 2071 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 267 cgggcgggcaggcaggcggggg 288 |||||||||||||||||||||| Sbjct: 293 cgggcgggcaggcaggcggggg 272
>dbj|AK147889.1| Mus musculus melanocyte cDNA, RIKEN full-length enriched library, clone:G270081I19 product:LUC7-like 2 (S. cerevisiae), full insert sequence Length = 2861 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 267 cgggcgggcaggcaggcggggg 288 |||||||||||||||||||||| Sbjct: 310 cgggcgggcaggcaggcggggg 289
>dbj|AK156688.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched library, clone:F830037L18 product:unclassifiable, full insert sequence Length = 2892 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 266 gcgggcgggcaggcaggcgggg 287 |||||||||||||||||||||| Sbjct: 1663 gcgggcgggcaggcaggcgggg 1642
>dbj|AK155264.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630212I17 product:LUC7-like 2 (S. cerevisiae), full insert sequence Length = 3394 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 267 cgggcgggcaggcaggcggggg 288 |||||||||||||||||||||| Sbjct: 369 cgggcgggcaggcaggcggggg 348
>dbj|AK163879.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length enriched library, clone:C230006F22 product:unclassifiable, full insert sequence Length = 2357 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 266 gcgggcgggcaggcaggcgggg 287 |||||||||||||||||||||| Sbjct: 1128 gcgggcgggcaggcaggcgggg 1107
>dbj|AK166155.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-length enriched library, clone:G730048C18 product:LUC7-like 2 (S. cerevisiae), full insert sequence Length = 3491 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 267 cgggcgggcaggcaggcggggg 288 |||||||||||||||||||||| Sbjct: 335 cgggcgggcaggcaggcggggg 314
>gb|AC161147.6| Mus musculus BAC clone RP23-357G12 from chromosome 6, complete sequence Length = 225957 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 267 cgggcgggcaggcaggcggggg 288 |||||||||||||||||||||| Sbjct: 204291 cgggcgggcaggcaggcggggg 204312
>dbj|AK172459.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched library, clone:F830208F22 product:hypothetical protein, full insert sequence Length = 2892 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 266 gcgggcgggcaggcaggcgggg 287 |||||||||||||||||||||| Sbjct: 1663 gcgggcgggcaggcaggcgggg 1642
>dbj|AK046307.1| Mus musculus adult male corpora quadrigemina cDNA, RIKEN full-length enriched library, clone:B230368A09 product:similar to CDNA FLJ10657 FIS, CLONE NT2RP2006043, WEAKLY SIMILAR TO SPLICING FACTOR, ARGININE/SERINE-RICH 4 [Homo sapiens], full insert sequence Length = 3145 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 267 cgggcgggcaggcaggcggggg 288 |||||||||||||||||||||| Sbjct: 490 cgggcgggcaggcaggcggggg 469
>dbj|AK038543.1| Mus musculus adult male hypothalamus cDNA, RIKEN full-length enriched library, clone:A230031O05 product:RIKEN cDNA 4930471C18 gene, full insert sequence Length = 2299 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 267 cgggcgggcaggcaggcggggg 288 |||||||||||||||||||||| Sbjct: 293 cgggcgggcaggcaggcggggg 272
>dbj|AK044839.1| Mus musculus 9.5 days embryo parthenogenote cDNA, RIKEN full-length enriched library, clone:B130007I01 product:unclassifiable, full insert sequence Length = 2934 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 267 cgggcgggcaggcaggcggggg 288 |||||||||||||||||||||| Sbjct: 380 cgggcgggcaggcaggcggggg 359
>dbj|AK048581.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched library, clone:C130080B05 product:unclassifiable, full insert sequence Length = 2815 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 267 cgggcgggcaggcaggcggggg 288 |||||||||||||||||||||| Sbjct: 293 cgggcgggcaggcaggcggggg 272
>dbj|AK053863.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched library, clone:E130315L24 product:unclassifiable, full insert sequence Length = 2816 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 267 cgggcgggcaggcaggcggggg 288 |||||||||||||||||||||| Sbjct: 293 cgggcgggcaggcaggcggggg 272
>gb|AF377340.1| Myxococcus xanthus AraC (araC) and serine/threonine kinase associate protein KapC (kapC) genes, complete cds; and unknown genes Length = 7622 Score = 44.1 bits (22), Expect = 0.44 Identities = 46/54 (85%) Strand = Plus / Plus Query: 438 gaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtgg 491 ||||||||||||| ||||| |||| ||||||||| ||||||||||||||| Sbjct: 6872 gaggtgtccttgaacgggtcaccgaccatgtcaccgacgacggcggccttgtgg 6925
>gb|AC073916.41| Homo sapiens 12 BAC RP11-408I18 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 205283 Score = 44.1 bits (22), Expect = 0.44 Identities = 25/26 (96%) Strand = Plus / Plus Query: 265 ggcgggcgggcaggcaggcgggggag 290 ||||||||||||||| |||||||||| Sbjct: 104610 ggcgggcgggcaggcgggcgggggag 104635
>gb|AF318301.1|AF318301 Mus musculus CGI-74-like SR-rich protein mRNA, complete cds Length = 2622 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 267 cgggcgggcaggcaggcggggg 288 |||||||||||||||||||||| Sbjct: 304 cgggcgggcaggcaggcggggg 283
>gb|CP000252.1| Syntrophus aciditrophicus SB, complete genome Length = 3179300 Score = 44.1 bits (22), Expect = 0.44 Identities = 34/38 (89%) Strand = Plus / Minus Query: 438 gaggtgtccttgagggggtctccgatggtgtcaccgat 475 ||||| ||||||| |||||| |||| |||||||||||| Sbjct: 1966579 gaggtatccttgaaggggtcgccgacggtgtcaccgat 1966542
>gb|AC124762.4| Mus musculus BAC clone RP23-155A10 from 6, complete sequence Length = 199207 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 267 cgggcgggcaggcaggcggggg 288 |||||||||||||||||||||| Sbjct: 23344 cgggcgggcaggcaggcggggg 23365
>emb|CR974444.18| Mouse DNA sequence from clone RP23-115O3 on chromosome 17, complete sequence Length = 190041 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 265 ggcgggcgggcaggcaggcggg 286 |||||||||||||||||||||| Sbjct: 36082 ggcgggcgggcaggcaggcggg 36061
>gb|U68299.1|MCU68299 Mouse cytomegalovirus 1 complete genomic sequence Length = 230278 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 265 ggcgggcgggcaggcaggcggg 286 |||||||||||||||||||||| Sbjct: 23591 ggcgggcgggcaggcaggcggg 23612
>gb|AC139573.4| Mus musculus BAC clone RP23-472H13 from 16, complete sequence Length = 189632 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 265 ggcgggcgggcaggcaggcggg 286 |||||||||||||||||||||| Sbjct: 10235 ggcgggcgggcaggcaggcggg 10256
>gb|AC134329.3| Mus musculus BAC clone RP24-310D17 from 10, complete sequence Length = 159173 Score = 44.1 bits (22), Expect = 0.44 Identities = 25/26 (96%) Strand = Plus / Plus Query: 265 ggcgggcgggcaggcaggcgggggag 290 ||||||||||||||| |||||||||| Sbjct: 106316 ggcgggcgggcaggctggcgggggag 106341
>ref|NM_138680.1| Mus musculus LUC7-like 2 (S. cerevisiae) (Luc7l2), mRNA Length = 2622 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 267 cgggcgggcaggcaggcggggg 288 |||||||||||||||||||||| Sbjct: 304 cgggcgggcaggcaggcggggg 283
>emb|AL732613.10| Mouse DNA sequence from clone RP23-193A21 on chromosome 4, complete sequence Length = 204012 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 265 ggcgggcgggcaggcaggcggg 286 |||||||||||||||||||||| Sbjct: 162541 ggcgggcgggcaggcaggcggg 162520
>dbj|D86306.1| Cucurbita moschata mRNA for proton-translocating inorganic pyrophosphatase, complete cds Length = 2704 Score = 44.1 bits (22), Expect = 0.44 Identities = 34/38 (89%) Strand = Plus / Minus Query: 453 gggtctccgatggtgtcaccgatcacggcggccttgtg 490 ||||||||||| ||||||||||| || ||||| ||||| Sbjct: 2293 gggtctccgatcgtgtcaccgataacagcggctttgtg 2256
>gb|BT017471.1| Zea mays clone EL01N0408D01.c mRNA sequence Length = 1159 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 266 gcgggcgggcaggcaggcggg 286 ||||||||||||||||||||| Sbjct: 875 gcgggcgggcaggcaggcggg 855
>gb|AY773965.1| Homo sapiens glutamate-cysteine ligase, modifier subunit (GCLM) gene, complete cds Length = 24112 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 265 ggcgggcgggcaggcaggcgg 285 ||||||||||||||||||||| Sbjct: 2179 ggcgggcgggcaggcaggcgg 2159
>gb|AY382196.1| Homo sapiens glutamate-cysteine ligase modifier subunit gene, promoter region and partial cds Length = 3319 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 265 ggcgggcgggcaggcaggcgg 285 ||||||||||||||||||||| Sbjct: 3221 ggcgggcgggcaggcaggcgg 3201
>ref|NM_002061.2| Homo sapiens glutamate-cysteine ligase, modifier subunit (GCLM), mRNA Length = 3074 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 265 ggcgggcgggcaggcaggcgg 285 ||||||||||||||||||||| Sbjct: 253 ggcgggcgggcaggcaggcgg 233
>gb|AY480047.1| Homo sapiens plectin 6 mRNA, complete cds Length = 15249 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 264 aggcgggcgggcaggcaggcggggg 288 |||||||||||||||||||| |||| Sbjct: 49 aggcgggcgggcaggcaggctgggg 25
>ref|NM_201380.2| Homo sapiens plectin 1, intermediate filament binding protein 500kDa (PLEC1), transcript variant 6, mRNA Length = 15249 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 264 aggcgggcgggcaggcaggcggggg 288 |||||||||||||||||||| |||| Sbjct: 49 aggcgggcgggcaggcaggctgggg 25
>emb|AL117351.12|HSJ837O21 Human DNA sequence from clone RP5-837O21 on chromosome 1p22 Contains the 5' end of the GCLM gene for glutamate-cysteine ligase modifier subunit, a pseudogene similar to part of NADH dehydrogenase 4 (MTND4), a NADH dehydrogenase 3 (MTND3) pseudogene, a cytochrome c oxidase III (MTCO3) pseudogene, a ATP synthase 6 (MTATP6) pseudogene, a cytochrome c oxidase II (MTCO2) pseudogene, a pseudogene similar to part of cytochrome c oxidase I (MTCO1), a pseudogene similar to part of NADH dehydrogenase 2 (MTND2), a coiled-coil-helix-coiled-coil-helix domain containing 2 (CHCHD2) pseudogene and a CpG island, complete sequence Length = 93800 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 265 ggcgggcgggcaggcaggcgg 285 ||||||||||||||||||||| Sbjct: 74262 ggcgggcgggcaggcaggcgg 74242
>gb|BC041809.1| Homo sapiens glutamate-cysteine ligase, modifier subunit, mRNA (cDNA clone MGC:41886 IMAGE:5311598), complete cds Length = 1613 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 265 ggcgggcgggcaggcaggcgg 285 ||||||||||||||||||||| Sbjct: 196 ggcgggcgggcaggcaggcgg 176
>gb|AC109322.16| Homo sapiens chromosome 8, clone CTD-3065J16, complete sequence Length = 215342 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 264 aggcgggcgggcaggcaggcggggg 288 |||||||||||||||||||| |||| Sbjct: 121067 aggcgggcgggcaggcaggctgggg 121043
>emb|BX957342.5| Zebrafish DNA sequence from clone CH211-120P12 in linkage group 13, complete sequence Length = 182888 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 107 tggtctctctcttctactaca 127 ||||||||||||||||||||| Sbjct: 109831 tggtctctctcttctactaca 109851
>emb|BX247887.6| Zebrafish DNA sequence from clone CH211-142L10, complete sequence Length = 143903 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 266 gcgggcgggcaggcaggcggg 286 ||||||||||||||||||||| Sbjct: 54645 gcgggcgggcaggcaggcggg 54625
>gb|U72210.1|HSU72210 Human gamma-glutamylcysteine synthetase light subunit gene, 5'flanking sequence and partial cds Length = 3314 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 265 ggcgggcgggcaggcaggcgg 285 ||||||||||||||||||||| Sbjct: 3217 ggcgggcgggcaggcaggcgg 3197
>gb|AF028815.1|AF028815 Homo sapiens gamma-glutamylcysteine synthetase regulatory subunit (GLCLR) gene, 5' flanking region Length = 1930 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 265 ggcgggcgggcaggcaggcgg 285 ||||||||||||||||||||| Sbjct: 1887 ggcgggcgggcaggcaggcgg 1867
>gb|L35546.1|HUMGCSL Homo sapiens gamma-glutamylcysteine synthetase light subunit mRNA, complete cds Length = 1610 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 265 ggcgggcgggcaggcaggcgg 285 ||||||||||||||||||||| Sbjct: 214 ggcgggcgggcaggcaggcgg 194
>gb|AC160538.8| Mus musculus chromosome 15, clone RP24-156D3, complete sequence Length = 158943 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 224 acattgacaaccaaaaataa 243 |||||||||||||||||||| Sbjct: 66522 acattgacaaccaaaaataa 66503
>gb|AC114649.9| Mus musculus chromosome 5, clone RP24-150M14, complete sequence Length = 154765 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 110 tctctctcttctactacatg 129 |||||||||||||||||||| Sbjct: 137646 tctctctcttctactacatg 137627
>gb|AC146132.3| Pan troglodytes BAC clone RP43-23H13 from 7, complete sequence Length = 164355 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 173 ttcaagaggccaggggaaag 192 |||||||||||||||||||| Sbjct: 84354 ttcaagaggccaggggaaag 84335
>ref|XM_001000399.1| PREDICTED: Mus musculus similar to Protein C1orf77 homolog (LOC622845), mRNA Length = 2049 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 264 aggcgggcgggcaggcaggc 283 |||||||||||||||||||| Sbjct: 1259 aggcgggcgggcaggcaggc 1240
>ref|XM_908936.2| PREDICTED: Mus musculus similar to Protein C1orf77 homolog (LOC634257), mRNA Length = 2053 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 264 aggcgggcgggcaggcaggc 283 |||||||||||||||||||| Sbjct: 1263 aggcgggcgggcaggcaggc 1244
>ref|XM_890379.2| PREDICTED: Mus musculus similar to Protein C1orf77 homolog, transcript variant 1 (LOC622845), mRNA Length = 2049 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 264 aggcgggcgggcaggcaggc 283 |||||||||||||||||||| Sbjct: 1259 aggcgggcgggcaggcaggc 1240
>gb|AC115800.13| Mus musculus chromosome 8, clone RP23-407E22, complete sequence Length = 228513 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 264 aggcgggcgggcaggcaggc 283 |||||||||||||||||||| Sbjct: 31686 aggcgggcgggcaggcaggc 31667
>gb|AC105947.11| Mus musculus chromosome 18, clone RP24-66N1, complete sequence Length = 207139 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 ctctctcttctactacatgg 130 |||||||||||||||||||| Sbjct: 166627 ctctctcttctactacatgg 166608
>gb|AC132255.3| Mus musculus BAC clone RP24-472I15 from chromosome 5, complete sequence Length = 168528 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 264 aggcgggcgggcaggcaggc 283 |||||||||||||||||||| Sbjct: 23756 aggcgggcgggcaggcaggc 23775
>gb|AC140316.3| Mus musculus BAC clone RP23-419L10 from chromosome 18, complete sequence Length = 195911 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 111 ctctctcttctactacatgg 130 |||||||||||||||||||| Sbjct: 178571 ctctctcttctactacatgg 178590
>gb|BC020058.1| Mus musculus LUC7-like 2 (S. cerevisiae), mRNA (cDNA clone IMAGE:4009362), containing frame-shift errors Length = 2411 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 267 cgggcgggcaggcaggcggg 286 |||||||||||||||||||| Sbjct: 20 cgggcgggcaggcaggcggg 1
>gb|AC072039.19| Homo sapiens 3 BAC RP11-305O4 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 154964 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 105 tctggtctctctcttctact 124 |||||||||||||||||||| Sbjct: 108378 tctggtctctctcttctact 108359
>gb|AC084054.12| Mus Musculus Strain C57BL6/J chromosome 5 BAC, RP23-137N6, complete sequence Length = 231589 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 265 ggcgggcgggcaggcaggcg 284 |||||||||||||||||||| Sbjct: 146 ggcgggcgggcaggcaggcg 127
>gb|AC124464.3| Mus musculus BAC clone RP24-155I15 from chromosome 19, complete sequence Length = 188587 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 264 aggcgggcgggcaggcaggc 283 |||||||||||||||||||| Sbjct: 2722 aggcgggcgggcaggcaggc 2741
>gb|AC126266.3| Mus musculus BAC clone RP23-402N17 from chromosome 19, complete sequence Length = 205037 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 264 aggcgggcgggcaggcaggc 283 |||||||||||||||||||| Sbjct: 147742 aggcgggcgggcaggcaggc 147761
>gb|AC113976.13| Mus musculus chromosome 15, clone RP23-146F23, complete sequence Length = 184010 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 224 acattgacaaccaaaaataa 243 |||||||||||||||||||| Sbjct: 38446 acattgacaaccaaaaataa 38465
>gb|AC142299.1| Pan troglodytes BAC clone RP43-121O18 from 7, complete sequence Length = 146878 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 173 ttcaagaggccaggggaaag 192 |||||||||||||||||||| Sbjct: 105556 ttcaagaggccaggggaaag 105575
>emb|AL353621.19| Human DNA sequence from clone RP11-490D19 on chromosome 9 Contains a novel pseudogene, the MRPL50 gene for mitochondrial ribosomal protein L50, the ZNF189 gene for zinc finger protein 189, the ALDOB gene for aldolase B, fructose-bisphosphate, a NADH dehydrogenase (ubiquinone) 1 alpha subcomplex (NDUFA4) pseudogene, three novel genes, the 5' end of the RNF20 gene for ring finger protein 20 and three CpG islands, complete sequence Length = 164115 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 265 ggcgggcgggcaggcaggcg 284 |||||||||||||||||||| Sbjct: 72831 ggcgggcgggcaggcaggcg 72850
>emb|AL035692.10|HS329N18 Human DNA sequence from clone RP3-329N18 on chromosome 6q22.1-22.33, complete sequence Length = 84764 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 105 tctggtctctctcttctact 124 |||||||||||||||||||| Sbjct: 50835 tctggtctctctcttctact 50816
>gb|DQ133470.1| Pan paniscus ribosomal RNA intergenic spacer, partial sequence Length = 4544 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 264 aggcgggcgggcaggcaggc 283 |||||||||||||||||||| Sbjct: 110 aggcgggcgggcaggcaggc 129
>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome Length = 4501104 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 366 gtggcgaagaagggcgcgaa 385 |||||||||||||||||||| Sbjct: 447622 gtggcgaagaagggcgcgaa 447603
>emb|BX572601.1| Rhodopseudomonas palustris CGA009 complete genome; segment 9/16 Length = 348580 Score = 40.1 bits (20), Expect = 6.9 Identities = 44/52 (84%) Strand = Plus / Minus Query: 440 ggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccttgtgg 491 |||||||||| ||| || |||| |||||| ||| |||| |||||||||||| Sbjct: 310723 ggtgtccttgtagggatcgccgacggtgtcgccggtcaccgcggccttgtgg 310672
>gb|AC121765.2| Homo sapiens chromosome 3 clone RP11-767D18, complete sequence Length = 194455 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 224 acattgacaaccaaaaataa 243 |||||||||||||||||||| Sbjct: 77255 acattgacaaccaaaaataa 77274
>emb|CR377210.7| Zebrafish DNA sequence from clone CH211-195C22 in linkage group 5, complete sequence Length = 170134 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 264 aggcgggcgggcaggcaggc 283 |||||||||||||||||||| Sbjct: 77535 aggcgggcgggcaggcaggc 77516
>gb|AC107464.5| Homo sapiens BAC clone RP11-1191J2 from 4, complete sequence Length = 219357 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 264 aggcgggcgggcaggcaggc 283 |||||||||||||||||||| Sbjct: 26460 aggcgggcgggcaggcaggc 26441
>gb|AC105266.2| Homo sapiens chromosome 3 clone RP11-796K6, complete sequence Length = 181462 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 224 acattgacaaccaaaaataa 243 |||||||||||||||||||| Sbjct: 33181 acattgacaaccaaaaataa 33200
>gb|AC080043.5| Homo sapiens chromosome , clone RP11-45M9, complete sequence Length = 161443 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 264 aggcgggcgggcaggcaggc 283 |||||||||||||||||||| Sbjct: 44687 aggcgggcgggcaggcaggc 44668
>gb|AC023566.11| Homo sapiens chromosome 8, clone RP11-660D5, complete sequence Length = 184543 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 264 aggcgggcgggcaggcaggc 283 |||||||||||||||||||| Sbjct: 94243 aggcgggcgggcaggcaggc 94224
>gb|AC093925.5| Genomic sequence for Mus musculus, clone RP23-304H5, complete sequence Length = 227242 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 264 aggcgggcgggcaggcaggc 283 |||||||||||||||||||| Sbjct: 132663 aggcgggcgggcaggcaggc 132644
>gb|AF005042.1|AF005042 Homo sapiens cGMP-phosphodiesterase beta-subunit (PDE6E) gene, complete intron 2 sequence Length = 952 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 264 aggcgggcgggcaggcaggc 283 |||||||||||||||||||| Sbjct: 63 aggcgggcgggcaggcaggc 44
>gb|AF005041.1|AF005041 Homo sapiens cGMP-phosphodiesterase beta-subunit (PDE6E) gene, complete intron 2 sequence Length = 906 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 264 aggcgggcgggcaggcaggc 283 |||||||||||||||||||| Sbjct: 63 aggcgggcgggcaggcaggc 44
>emb|BX571666.10| Zebrafish DNA sequence from clone DKEY-221F8 in linkage group 5, complete sequence Length = 115940 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 264 aggcgggcgggcaggcaggc 283 |||||||||||||||||||| Sbjct: 6671 aggcgggcgggcaggcaggc 6652
>emb|BX005480.12| Mouse DNA sequence from clone RP23-142M12 on chromosome X, complete sequence Length = 196326 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 264 aggcgggcgggcaggcaggc 283 |||||||||||||||||||| Sbjct: 135612 aggcgggcgggcaggcaggc 135593
>gb|AC131664.3| Mus musculus BAC clone RP23-274J16 from chromosome 5, complete sequence Length = 189996 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 264 aggcgggcgggcaggcaggc 283 |||||||||||||||||||| Sbjct: 79800 aggcgggcgggcaggcaggc 79781
>gb|AC113484.14| Mus musculus chromosome 8, clone RP23-343H23, complete sequence Length = 176303 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 264 aggcgggcgggcaggcaggc 283 |||||||||||||||||||| Sbjct: 158826 aggcgggcgggcaggcaggc 158807
>gb|AC009198.8|AC009198 Drosophila melanogaster, chromosome 2L, region 33B-33C, BAC clone BACR19C12, complete sequence Length = 171134 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 334 tctagatgtacttgaacagc 353 |||||||||||||||||||| Sbjct: 76960 tctagatgtacttgaacagc 76941
>gb|DQ164097.1| Callithrix jacchus gamma-glutamylcysteine synthetase regulatory subunit mRNA, complete cds Length = 1202 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 266 gcgggcgggcaggcaggcgg 285 |||||||||||||||||||| Sbjct: 257 gcgggcgggcaggcaggcgg 238
>gb|AC134025.2| Homo sapiens 3 BAC RP11-231I13 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 183111 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 224 acattgacaaccaaaaataa 243 |||||||||||||||||||| Sbjct: 80094 acattgacaaccaaaaataa 80075
>gb|AC016700.8| Homo sapiens BAC clone RP11-175A7 from 2, complete sequence Length = 177995 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 265 ggcgggcgggcaggcaggcg 284 |||||||||||||||||||| Sbjct: 174868 ggcgggcgggcaggcaggcg 174887
>gb|AY148158.1| Mus musculus lamin B receptor gene, partial cds Length = 29007 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 264 aggcgggcgggcaggcaggc 283 |||||||||||||||||||| Sbjct: 15874 aggcgggcgggcaggcaggc 15855
>gb|AC093540.3| Pan troglodytes clone RP43-84M6, complete sequence Length = 171092 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 267 cgggcgggcaggcaggcggg 286 |||||||||||||||||||| Sbjct: 114785 cgggcgggcaggcaggcggg 114766
>gb|AE003635.2| Drosophila melanogaster chromosome 2L, section 44 of 83 of the complete sequence Length = 308012 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 334 tctagatgtacttgaacagc 353 |||||||||||||||||||| Sbjct: 137931 tctagatgtacttgaacagc 137912
>emb|X62693.1|HSCGMP2 H.sapiens DNA for cGMP phosphodiesterase exon 2 Length = 556 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 264 aggcgggcgggcaggcaggc 283 |||||||||||||||||||| Sbjct: 417 aggcgggcgggcaggcaggc 398
>gb|AC105072.9| Mus musculus chromosome 5, clone RP24-167C6, complete sequence Length = 173710 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 265 ggcgggcgggcaggcaggcg 284 |||||||||||||||||||| Sbjct: 17283 ggcgggcgggcaggcaggcg 17302
>emb|AL844566.8| Mouse DNA sequence from clone RP23-173H17 on chromosome 2, complete sequence Length = 229583 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 264 aggcgggcgggcaggcaggc 283 |||||||||||||||||||| Sbjct: 113280 aggcgggcgggcaggcaggc 113299
>gb|AC151735.3| Mus musculus BAC clone RP23-24D16 from 9, complete sequence Length = 201762 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 264 aggcgggcgggcaggcaggc 283 |||||||||||||||||||| Sbjct: 139401 aggcgggcgggcaggcaggc 139382
>emb|AL603706.13| Mouse DNA sequence from clone RP23-407I21 on chromosome 11, complete sequence Length = 220242 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 264 aggcgggcgggcaggcaggc 283 |||||||||||||||||||| Sbjct: 43459 aggcgggcgggcaggcaggc 43478
>emb|AL807399.5| Mouse DNA sequence from clone RP23-382O11 on chromosome 4, complete sequence Length = 181004 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 264 aggcgggcgggcaggcaggc 283 |||||||||||||||||||| Sbjct: 160196 aggcgggcgggcaggcaggc 160177
>emb|AL589870.30| Mouse DNA sequence from clone RP23-118A2 on chromosome 2, complete sequence Length = 202686 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 265 ggcgggcgggcaggcaggcg 284 |||||||||||||||||||| Sbjct: 135217 ggcgggcgggcaggcaggcg 135236
>dbj|AB044479.1| Volvox rousseletii chloroplast psbC gene for photosystem II CP43 apoprotein, strain:UTEX 1862 Length = 780 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 232 aaccaaaaataacagcagcg 251 |||||||||||||||||||| Sbjct: 370 aaccaaaaataacagcagcg 351
>dbj|AB044478.1| Volvox globator chloroplast psbC gene for photosystem II CP43 apoprotein, strain:UTEX 955 Length = 780 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 232 aaccaaaaataacagcagcg 251 |||||||||||||||||||| Sbjct: 370 aaccaaaaataacagcagcg 351
>dbj|AB044477.1| Volvox barberi chloroplast psbC gene for photosystem II CP43 apoprotein, strain:UTEX 804 Length = 780 Score = 40.1 bits (20), Expect = 6.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 232 aaccaaaaataacagcagcg 251 |||||||||||||||||||| Sbjct: 370 aaccaaaaataacagcagcg 351 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,616,594 Number of Sequences: 3902068 Number of extensions: 3616594 Number of successful extensions: 68870 Number of sequences better than 10.0: 187 Number of HSP's better than 10.0 without gapping: 189 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 68119 Number of HSP's gapped (non-prelim): 725 length of query: 508 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 486 effective length of database: 17,147,199,772 effective search space: 8333539089192 effective search space used: 8333539089192 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
