ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl03b02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BC015210.1| Homo sapiens chromosome 3 open reading frame 49, ... 42 1.7
2gb|AC104162.2| Homo sapiens chromosome 3 clone RP11-50F24, compl... 42 1.7
3gb|AC012557.23| Homo sapiens 3 BAC RP11-245J9 (Roswell Park Canc... 42 1.7
4gb|AC126424.12| Mus musculus chromosome 17, clone RP23-19K10, co... 40 6.8
5gb|AC117624.10| Mus musculus chromosome 8, clone RP23-114M9, com... 40 6.8
6emb|AL161629.10| Human DNA sequence from clone RP11-406A20 on ch... 40 6.8
7gb|AC079385.18| Homo sapiens 12q BAC RP11-482D24 (Roswell Park C... 40 6.8
8gb|DQ080948.1| Uncultured Bacteroidetes bacterium isolate DGGE b... 40 6.8
9gb|AC119902.12| Mus musculus chromosome 8, clone RP24-235G23, co... 40 6.8
10emb|CT033750.18| Mouse DNA sequence from clone RP23-263M5 on chr... 40 6.8

>gb|BC015210.1| Homo sapiens chromosome 3 open reading frame 49, mRNA (cDNA clone
            MGC:17310 IMAGE:3885216), complete cds
          Length = 1275

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 234  attaccaatcagaaaatcgac 254
            |||||||||||||||||||||
Sbjct: 1009 attaccaatcagaaaatcgac 1029



to top

>gb|AC104162.2| Homo sapiens chromosome 3 clone RP11-50F24, complete sequence
          Length = 178337

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 234   attaccaatcagaaaatcgac 254
             |||||||||||||||||||||
Sbjct: 53079 attaccaatcagaaaatcgac 53059



to top

>gb|AC012557.23| Homo sapiens 3 BAC RP11-245J9 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 189220

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 234  attaccaatcagaaaatcgac 254
            |||||||||||||||||||||
Sbjct: 5577 attaccaatcagaaaatcgac 5597



to top

>gb|AC126424.12| Mus musculus chromosome 17, clone RP23-19K10, complete sequence
          Length = 182696

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 162    gttgtgttagaaggagcggggatt 185
              ||||| ||||||||||||||||||
Sbjct: 123745 gttgttttagaaggagcggggatt 123768



to top

>gb|AC117624.10| Mus musculus chromosome 8, clone RP23-114M9, complete sequence
          Length = 207159

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 255   aatgcagaatgtctcagatc 274
             ||||||||||||||||||||
Sbjct: 38275 aatgcagaatgtctcagatc 38256



to top

>emb|AL161629.10| Human DNA sequence from clone RP11-406A20 on chromosome 9q21.33-22.2
              Contains two novel genes and a  interleukin 6 receptor
              (IL6R) pseudogene, complete sequence
          Length = 160341

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 204    gggttattttgttcttaaca 223
              ||||||||||||||||||||
Sbjct: 124302 gggttattttgttcttaaca 124321



to top

>gb|AC079385.18| Homo sapiens 12q BAC RP11-482D24 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 181609

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 456    gcatgaatctaaaatgaaca 475
              ||||||||||||||||||||
Sbjct: 161125 gcatgaatctaaaatgaaca 161106



to top

>gb|DQ080948.1| Uncultured Bacteroidetes bacterium isolate DGGE band GWS-c11-PA 16S
           ribosomal RNA gene, partial sequence
          Length = 502

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 393 ccaacggcagtcctctacgt 412
           ||||||||||||||||||||
Sbjct: 345 ccaacggcagtcctctacgt 364



to top

>gb|AC119902.12| Mus musculus chromosome 8, clone RP24-235G23, complete sequence
          Length = 146712

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 255   aatgcagaatgtctcagatc 274
             ||||||||||||||||||||
Sbjct: 14484 aatgcagaatgtctcagatc 14503



to top

>emb|CT033750.18| Mouse DNA sequence from clone RP23-263M5 on chromosome 17, complete
              sequence
          Length = 268616

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 162    gttgtgttagaaggagcggggatt 185
              ||||| ||||||||||||||||||
Sbjct: 209276 gttgttttagaaggagcggggatt 209299


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,759,144
Number of Sequences: 3902068
Number of extensions: 3759144
Number of successful extensions: 61448
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 61425
Number of HSP's gapped (non-prelim): 23
length of query: 501
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 479
effective length of database: 17,147,199,772
effective search space: 8213508690788
effective search space used: 8213508690788
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top