Clone Name | rbastl03b02 |
---|---|
Clone Library Name | barley_pub |
>gb|BC015210.1| Homo sapiens chromosome 3 open reading frame 49, mRNA (cDNA clone MGC:17310 IMAGE:3885216), complete cds Length = 1275 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 234 attaccaatcagaaaatcgac 254 ||||||||||||||||||||| Sbjct: 1009 attaccaatcagaaaatcgac 1029
>gb|AC104162.2| Homo sapiens chromosome 3 clone RP11-50F24, complete sequence Length = 178337 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 234 attaccaatcagaaaatcgac 254 ||||||||||||||||||||| Sbjct: 53079 attaccaatcagaaaatcgac 53059
>gb|AC012557.23| Homo sapiens 3 BAC RP11-245J9 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 189220 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 234 attaccaatcagaaaatcgac 254 ||||||||||||||||||||| Sbjct: 5577 attaccaatcagaaaatcgac 5597
>gb|AC126424.12| Mus musculus chromosome 17, clone RP23-19K10, complete sequence Length = 182696 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 162 gttgtgttagaaggagcggggatt 185 ||||| |||||||||||||||||| Sbjct: 123745 gttgttttagaaggagcggggatt 123768
>gb|AC117624.10| Mus musculus chromosome 8, clone RP23-114M9, complete sequence Length = 207159 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 255 aatgcagaatgtctcagatc 274 |||||||||||||||||||| Sbjct: 38275 aatgcagaatgtctcagatc 38256
>emb|AL161629.10| Human DNA sequence from clone RP11-406A20 on chromosome 9q21.33-22.2 Contains two novel genes and a interleukin 6 receptor (IL6R) pseudogene, complete sequence Length = 160341 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 204 gggttattttgttcttaaca 223 |||||||||||||||||||| Sbjct: 124302 gggttattttgttcttaaca 124321
>gb|AC079385.18| Homo sapiens 12q BAC RP11-482D24 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 181609 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 456 gcatgaatctaaaatgaaca 475 |||||||||||||||||||| Sbjct: 161125 gcatgaatctaaaatgaaca 161106
>gb|DQ080948.1| Uncultured Bacteroidetes bacterium isolate DGGE band GWS-c11-PA 16S ribosomal RNA gene, partial sequence Length = 502 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 393 ccaacggcagtcctctacgt 412 |||||||||||||||||||| Sbjct: 345 ccaacggcagtcctctacgt 364
>gb|AC119902.12| Mus musculus chromosome 8, clone RP24-235G23, complete sequence Length = 146712 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 255 aatgcagaatgtctcagatc 274 |||||||||||||||||||| Sbjct: 14484 aatgcagaatgtctcagatc 14503
>emb|CT033750.18| Mouse DNA sequence from clone RP23-263M5 on chromosome 17, complete sequence Length = 268616 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 162 gttgtgttagaaggagcggggatt 185 ||||| |||||||||||||||||| Sbjct: 209276 gttgttttagaaggagcggggatt 209299 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,759,144 Number of Sequences: 3902068 Number of extensions: 3759144 Number of successful extensions: 61448 Number of sequences better than 10.0: 10 Number of HSP's better than 10.0 without gapping: 10 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 61425 Number of HSP's gapped (non-prelim): 23 length of query: 501 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 479 effective length of database: 17,147,199,772 effective search space: 8213508690788 effective search space used: 8213508690788 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)