>emb|Z98743.1|HS181C9 Human DNA sequence from clone RP1-181C9 on chromosome 22q13.2-13.33,
             complete sequence
          Length = 92472

 Score = 44.1 bits (22), Expect = 0.42
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 382   aagatgccccagacccagagca 403
             ||||||||||||||||||||||
Sbjct: 76670 aagatgccccagacccagagca 76691

>gb|AC007546.6| Homo sapiens 12 BAC RP11-946P6 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 168396

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 396   ccagagcatgtcatttcagaa 416
             |||||||||||||||||||||
Sbjct: 77625 ccagagcatgtcatttcagaa 77605

>gb|AC119269.9| Mus musculus chromosome 5, clone RP24-324B22, complete sequence
          Length = 172282

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 400   agcatgtcatttcagaattcagat 423
             |||||||||||||||||| |||||
Sbjct: 54901 agcatgtcatttcagaatgcagat 54924

>gb|AC102454.7| Mus musculus chromosome 5, clone RP24-296L13, complete sequence
          Length = 149588

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 151  gaatgcattccaatccatcc 170
            ||||||||||||||||||||
Sbjct: 2571 gaatgcattccaatccatcc 2552

>gb|AC144522.12| Homo sapiens 12 BAC RP11-481J8 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 163515

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 372   ctgagcctgcaagatgccccagacccag 399
             ||||||||||||||| ||||| ||||||
Sbjct: 74477 ctgagcctgcaagatcccccacacccag 74504

>gb|AC117206.3| Mus musculus BAC clone RP23-260L17 from 5, complete sequence
          Length = 183385

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 151    gaatgcattccaatccatcc 170
              ||||||||||||||||||||
Sbjct: 156496 gaatgcattccaatccatcc 156477

>gb|BC032672.2| Homo sapiens hydrogen voltage-gated channel 1, mRNA (cDNA clone
           MGC:44899 IMAGE:5577070), complete cds
          Length = 2196

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 372 ctgagcctgcaagatgccccagacccag 399
           ||||||||||||||| ||||| ||||||
Sbjct: 431 ctgagcctgcaagatcccccacacccag 404

>emb|Z97989.1|HS66H14 Human DNA sequence from clone RP1-66H14 on chromosome 6q21-22 Contains
             the 3' end of the FYN gene for the FYN oncogene related to
             SRC, FGR, YES and the 5' end of the C6orf5 gene for
             chromosome 6 open reading frame 5 (NFkB-activating protein
             ACT1, connection to IKK and SAPK/JNK, chromosome 6 open
             reading frame 6) (C6orf5)(ACT1, CIKS, C6ORF6,
             DKFZP586G0522)(contains FLJ22949), complete sequence
          Length = 155937

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 66    cctgttgttgaaaaccatac 85
             ||||||||||||||||||||
Sbjct: 74644 cctgttgttgaaaaccatac 74663

>emb|BX571708.4| Zebrafish DNA sequence from clone DKEYP-74B2, complete sequence
          Length = 193197

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 249    gtagagtatatgcatgcatc 268
              ||||||||||||||||||||
Sbjct: 146680 gtagagtatatgcatgcatc 146661

>dbj|AB204937.1| Gryllus bimaculatus satellite DNA, clone: pUGBH-95
          Length = 535

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 365 tatttttctgagcctgcaagatgc 388
           ||||||||||||| ||||||||||
Sbjct: 502 tatttttctgagcttgcaagatgc 525

>dbj|AB204920.1| Gryllus bimaculatus satellite DNA, clone: pUGBH-24
          Length = 535

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 365 tatttttctgagcctgcaagatgc 388
           ||||||||||||| ||||||||||
Sbjct: 502 tatttttctgagcttgcaagatgc 525

>gb|AC073427.7| Homo sapiens BAC clone RP11-746K19 from 4, complete sequence
          Length = 157152

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 244   gcaaagtagagtatatgcat 263
             ||||||||||||||||||||
Sbjct: 62713 gcaaagtagagtatatgcat 62694

>dbj|AK042265.1| Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched
            library, clone:A630076K24 product:retinoblastoma binding
            protein 7, full insert sequence
          Length = 1801

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  ttttctgagcctgcaagatg 387
            ||||||||||||||||||||
Sbjct: 1578 ttttctgagcctgcaagatg 1559

>emb|BX247887.6| Zebrafish DNA sequence from clone CH211-142L10, complete sequence
          Length = 143903

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 73    ttgaaaaccatacaaaattc 92
             ||||||||||||||||||||
Sbjct: 77084 ttgaaaaccatacaaaattc 77065

>gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome
          Length = 3052398

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 261     catgcatcacggggtccggcttgagctg 288
               |||||||||||||| |||||| ||||||
Sbjct: 2472283 catgcatcacggggcccggctcgagctg 2472256

>emb|AL929457.12| Zebrafish DNA sequence from clone CH211-153I8 in linkage group 14,
             complete sequence
          Length = 164299

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 249   gtagagtatatgcatgcatc 268
             ||||||||||||||||||||
Sbjct: 64354 gtagagtatatgcatgcatc 64335

>emb|AL672123.16| Mouse DNA sequence from clone RP23-436I3 on chromosome X, complete
              sequence
          Length = 219385

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 368    ttttctgagcctgcaagatg 387
              ||||||||||||||||||||
Sbjct: 162191 ttttctgagcctgcaagatg 162210


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,549,553
Number of Sequences: 3902068
Number of extensions: 4549553
Number of successful extensions: 86324
Number of sequences better than 10.0: 17
Number of HSP's better than 10.0 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 86294
Number of HSP's gapped (non-prelim): 30
length of query: 484
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 462
effective length of database: 17,147,199,772
effective search space: 7922006294664
effective search space used: 7922006294664
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)