ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl02g09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|U13876.3| Caenorhabditis elegans cosmid F57B9, complete sequence 42 0.42
2gb|AY648725.1| Danio rerio Opa-interacting protein 2 mRNA, compl... 40 1.7
3emb|AL627210.1| Human DNA sequence from clone RP11-355K23 on chr... 40 1.7
4emb|BX465844.25| Zebrafish DNA sequence from clone CH211-106I3 i... 40 1.7
5gb|AC094020.2| Homo sapiens chromosome 3 clone RP11-425J9, compl... 40 1.7
6ref|NM_001002865.1| Danio rerio exosome component 8 (exosc8), mRNA 40 1.7
7gb|BC095236.1| Danio rerio exosome component 8, mRNA (cDNA clone... 40 1.7
8gb|AC068284.5| Homo sapiens BAC clone RP11-473K18 from 2, comple... 40 1.7
9emb|CT009602.4| PTB-121B21, complete sequence 40 1.7
10gb|AC165253.2| Mus musculus BAC clone RP23-413P10 from chromosom... 38 6.6
11gb|AC007255.4| Homo sapiens BAC clone RP11-550A18 from 7, comple... 38 6.6
12gb|AC121795.3| Mus musculus BAC clone RP23-421P13 from chromosom... 38 6.6
13gb|AC073311.7| Homo sapiens BAC clone RP11-61D3 from 7, complete... 38 6.6
14gb|AC118543.30| Mus musculus strain C57BL/6J clone rp23-254b17 m... 38 6.6
15gb|AC099305.5| Rattus norvegicus 2 BAC CH230-172K3 (Children's H... 38 6.6
16dbj|AK173840.1| Ciona intestinalis cDNA, clone:cicl010e21, full ... 38 6.6
17gb|AC167698.2| Reniera sp. JGI-2005 clone JGIBAYC-5G3, complete ... 38 6.6
18gb|AC154200.1| Mus musculus BAC clone RP24-81G10 from 17, comple... 38 6.6
19gb|AC158530.2| Mus musculus BAC clone RP23-255H12 from chromosom... 38 6.6

>gb|U13876.3| Caenorhabditis elegans cosmid F57B9, complete sequence
          Length = 39112

 Score = 42.1 bits (21), Expect = 0.42
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 34   cgaaatacagtatctcaatcc 54
            |||||||||||||||||||||
Sbjct: 5828 cgaaatacagtatctcaatcc 5808



to top

>gb|AY648725.1| Danio rerio Opa-interacting protein 2 mRNA, complete cds
          Length = 987

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 118 atggaagggagttgggagag 137
           ||||||||||||||||||||
Sbjct: 98  atggaagggagttgggagag 117



to top

>emb|AL627210.1| Human DNA sequence from clone RP11-355K23 on chromosome X Contains a
             novel pseudogene, complete sequence
          Length = 51288

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 101   tcataaaaggcctcatcatg 120
             ||||||||||||||||||||
Sbjct: 45476 tcataaaaggcctcatcatg 45457



to top

>emb|BX465844.25| Zebrafish DNA sequence from clone CH211-106I3 in linkage group 10,
            complete sequence
          Length = 167771

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 118  atggaagggagttgggagag 137
            ||||||||||||||||||||
Sbjct: 2324 atggaagggagttgggagag 2343



to top

>gb|AC094020.2| Homo sapiens chromosome 3 clone RP11-425J9, complete sequence
          Length = 194729

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 71     tcacatctattcttacacca 90
              ||||||||||||||||||||
Sbjct: 114772 tcacatctattcttacacca 114791



to top

>ref|NM_001002865.1| Danio rerio exosome component 8 (exosc8), mRNA
          Length = 987

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 118 atggaagggagttgggagag 137
           ||||||||||||||||||||
Sbjct: 98  atggaagggagttgggagag 117



to top

>gb|BC095236.1| Danio rerio exosome component 8, mRNA (cDNA clone MGC:110381
           IMAGE:7410517), complete cds
          Length = 968

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 118 atggaagggagttgggagag 137
           ||||||||||||||||||||
Sbjct: 81  atggaagggagttgggagag 100



to top

>gb|AC068284.5| Homo sapiens BAC clone RP11-473K18 from 2, complete sequence
          Length = 110512

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 64    acaaacttcacatctattct 83
             ||||||||||||||||||||
Sbjct: 22462 acaaacttcacatctattct 22481



to top

>emb|CT009602.4| PTB-121B21, complete sequence
          Length = 236109

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 101    tcataaaaggcctcatcatg 120
              ||||||||||||||||||||
Sbjct: 129071 tcataaaaggcctcatcatg 129090



to top

>gb|AC165253.2| Mus musculus BAC clone RP23-413P10 from chromosome 9, complete sequence
          Length = 200549

 Score = 38.2 bits (19), Expect = 6.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 118    atggaagggagttgggaga 136
              |||||||||||||||||||
Sbjct: 148279 atggaagggagttgggaga 148261



to top

>gb|AC007255.4| Homo sapiens BAC clone RP11-550A18 from 7, complete sequence
          Length = 157092

 Score = 38.2 bits (19), Expect = 6.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 97     tttgtcataaaaggcctcatcat 119
              ||||||| |||||||||||||||
Sbjct: 125015 tttgtcagaaaaggcctcatcat 124993



to top

>gb|AC121795.3| Mus musculus BAC clone RP23-421P13 from chromosome 17, complete
            sequence
          Length = 204354

 Score = 38.2 bits (19), Expect = 6.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 120  ggaagggagttgggagagg 138
            |||||||||||||||||||
Sbjct: 3710 ggaagggagttgggagagg 3692



to top

>gb|AC073311.7| Homo sapiens BAC clone RP11-61D3 from 7, complete sequence
          Length = 105138

 Score = 38.2 bits (19), Expect = 6.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 98    ttgtcataaaaggcctcat 116
             |||||||||||||||||||
Sbjct: 54499 ttgtcataaaaggcctcat 54517



to top

>gb|AC118543.30| Mus musculus strain C57BL/6J clone rp23-254b17 map 17, complete sequence
          Length = 241570

 Score = 38.2 bits (19), Expect = 6.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 117    catggaagggagttgggag 135
              |||||||||||||||||||
Sbjct: 100577 catggaagggagttgggag 100595



to top

>gb|AC099305.5| Rattus norvegicus 2 BAC CH230-172K3 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 92339

 Score = 38.2 bits (19), Expect = 6.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 1     gaaagacaaaagcatgaga 19
             |||||||||||||||||||
Sbjct: 31609 gaaagacaaaagcatgaga 31591



to top

>dbj|AK173840.1| Ciona intestinalis cDNA, clone:cicl010e21, full insert sequence
          Length = 1392

 Score = 38.2 bits (19), Expect = 6.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 101 tcataaaaggcctcatcat 119
           |||||||||||||||||||
Sbjct: 709 tcataaaaggcctcatcat 691



to top

>gb|AC167698.2| Reniera sp. JGI-2005 clone JGIBAYC-5G3, complete sequence
          Length = 32105

 Score = 38.2 bits (19), Expect = 6.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 13    catgagacattaaaaggga 31
             |||||||||||||||||||
Sbjct: 19009 catgagacattaaaaggga 19027



to top

>gb|AC154200.1| Mus musculus BAC clone RP24-81G10 from 17, complete sequence
          Length = 216721

 Score = 38.2 bits (19), Expect = 6.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 120    ggaagggagttgggagagg 138
              |||||||||||||||||||
Sbjct: 146139 ggaagggagttgggagagg 146121



to top

>gb|AC158530.2| Mus musculus BAC clone RP23-255H12 from chromosome 17, complete sequence
          Length = 154287

 Score = 38.2 bits (19), Expect = 6.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 117    catggaagggagttgggag 135
              |||||||||||||||||||
Sbjct: 132912 catggaagggagttgggag 132930


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,268,347
Number of Sequences: 3902068
Number of extensions: 1268347
Number of successful extensions: 90541
Number of sequences better than 10.0: 19
Number of HSP's better than 10.0 without gapping: 19
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 90512
Number of HSP's gapped (non-prelim): 29
length of query: 139
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 118
effective length of database: 17,151,101,840
effective search space: 2023830017120
effective search space used: 2023830017120
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top