>gb|AE016795.2| Vibrio vulnificus CMCP6 chromosome I complete sequence
          Length = 3281944

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 142    tgccagctcagtcggtatcaagtgaacaaa 171
              ||||| |||||||| |||||||||||||||
Sbjct: 406199 tgccaactcagtcgttatcaagtgaacaaa 406228



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 336    cttgatcaactttgaacagagtagt 360
              ||||||||||||||||| |||||||
Sbjct: 891917 cttgatcaactttgaactgagtagt 891941

>dbj|BA000037.2| Vibrio vulnificus YJ016 DNA, chromosome I, complete sequence
          Length = 3354505

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 142    tgccagctcagtcggtatcaagtgaacaaa 171
              ||||| |||||||| |||||||||||||||
Sbjct: 789311 tgccaactcagtcgttatcaagtgaacaaa 789282



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 336    cttgatcaactttgaacagagtagt 360
              ||||||||||||||||| |||||||
Sbjct: 219713 cttgatcaactttgaactgagtagt 219689

>gb|AC166324.1| Mus musculus BAC clone RP24-500J7 from chromosome 9, complete sequence
          Length = 168018

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 19    gatatacaactgtttctgtaa 39
             |||||||||||||||||||||
Sbjct: 71012 gatatacaactgtttctgtaa 71032

>emb|AL049746.1|ATT23J7 Arabidopsis thaliana DNA chromosome 3, BAC clone T23J7
          Length = 92493

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 362   tatttctttctctttaccttg 382
             |||||||||||||||||||||
Sbjct: 82513 tatttctttctctttaccttg 82533

>gb|AC113619.5| Drosophila melanogaster X BAC RP98-22D21 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 160001

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 67     agtttacttaatcaacaaaaa 87
              |||||||||||||||||||||
Sbjct: 158325 agtttacttaatcaacaaaaa 158345

>gb|AC023682.4| Drosophila melanogaster X BAC RP98-7F10 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 179236

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 67    agtttacttaatcaacaaaaa 87
             |||||||||||||||||||||
Sbjct: 41601 agtttacttaatcaacaaaaa 41621

>gb|AE003436.3| Drosophila melanogaster chromosome X, section 20 of 74 of the complete
              sequence
          Length = 317322

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 67     agtttacttaatcaacaaaaa 87
              |||||||||||||||||||||
Sbjct: 235032 agtttacttaatcaacaaaaa 235012

>emb|CT030659.8| Mouse DNA sequence from clone RP23-125F8 on chromosome 9, complete
              sequence
          Length = 199662

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 19     gatatacaactgtttctgtaa 39
              |||||||||||||||||||||
Sbjct: 155043 gatatacaactgtttctgtaa 155063

>gb|AC124977.8| Mus musculus chromosome 7, clone RP24-89J20, complete sequence
          Length = 239915

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 107    cataggtactgtgccaaaaa 126
              ||||||||||||||||||||
Sbjct: 130412 cataggtactgtgccaaaaa 130393

>ref|XM_602426.2| PREDICTED: Bos taurus similar to zinc finger protein 354A,
           transcript variant 1 (LOC524106), mRNA
          Length = 2152

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 64  ttcagtttacttaatcaacaaaaa 87
           ||||||||| ||||||||||||||
Sbjct: 855 ttcagtttatttaatcaacaaaaa 878

>gb|AC147091.2| Pan troglodytes BAC clone RP43-57O16 from 7, complete sequence
          Length = 170233

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 319   ctgcaagttctgaacctctt 338
             ||||||||||||||||||||
Sbjct: 23023 ctgcaagttctgaacctctt 23042

>gb|AC125268.10| Mus musculus chromosome 1, clone RP23-127L7, complete sequence
          Length = 233529

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 366   tctttctctttaccttgaca 385
             ||||||||||||||||||||
Sbjct: 29744 tctttctctttaccttgaca 29763

>gb|AC002433.2| Homo sapiens BAC clone CTA-317M2 from 7, complete sequence
          Length = 139919

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 319   ctgcaagttctgaacctctt 338
             ||||||||||||||||||||
Sbjct: 56747 ctgcaagttctgaacctctt 56728

>gb|AC140294.3| Mus musculus BAC clone RP23-359G16 from chromosome 19, complete
             sequence
          Length = 190551

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 70    ttacttaatcaacaaaaata 89
             ||||||||||||||||||||
Sbjct: 51643 ttacttaatcaacaaaaata 51662

>gb|AC125122.4| Mus musculus BAC clone RP24-269O4 from chromosome 18, complete sequence
          Length = 173614

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 360    tctatttctttctctttacc 379
              ||||||||||||||||||||
Sbjct: 139974 tctatttctttctctttacc 139955

>gb|AC121983.3| Mus musculus BAC clone RP24-292F8 from chromosome 5, complete sequence
          Length = 161350

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 189    gccgatcaccagaagccctggaaa 212
              |||||||| |||||||||||||||
Sbjct: 156604 gccgatcaacagaagccctggaaa 156627

>emb|Z66497.1|CEK08F8 Caenorhabditis elegans Cosmid K08F8, complete sequence
          Length = 41246

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 369  ttctctttaccttgacaatt 388
            ||||||||||||||||||||
Sbjct: 3702 ttctctttaccttgacaatt 3683

>gb|AC005029.1| Homo sapiens BAC clone GS1-588G18 from 7, complete sequence
          Length = 184949

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 193   atcaccagaagccctggaaa 212
             ||||||||||||||||||||
Sbjct: 16581 atcaccagaagccctggaaa 16600

>gb|AC145920.1| Pan troglodytes BAC clone RP43-10C15 from 7, complete sequence
          Length = 188373

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 319    ctgcaagttctgaacctctt 338
              ||||||||||||||||||||
Sbjct: 111935 ctgcaagttctgaacctctt 111916

>emb|AL049694.9|HSDJ99E18 Human DNA sequence from clone RP1-99E18 on chromosome 6q25.1-26
             Contains part of the gene for a novel protein similar to
             C1-tetrahydrofolate synthases (contains DKFZP586G1517
             protein and FLJ21145, contains a tetrahydrofolate
             dehydrogenase/cyclohydrolase domain) and an
             ADP-riboslyation factor-like 4 (ARL4) pseudogene, complete
             sequence
          Length = 123296

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 207   tggaaaccaagatcaatttg 226
             ||||||||||||||||||||
Sbjct: 52601 tggaaaccaagatcaatttg 52620

>gb|AC155261.3| Mus musculus BAC clone RP24-66D10 from chromosome 18, complete sequence
          Length = 207400

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 360    tctatttctttctctttacc 379
              ||||||||||||||||||||
Sbjct: 200236 tctatttctttctctttacc 200255

>emb|BX927184.5| Zebrafish DNA sequence from clone DKEY-125I20 in linkage group 5,
             complete sequence
          Length = 160345

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 50    gggaatagacaaaattcagtttac 73
             |||||||||||||||||| |||||
Sbjct: 40674 gggaatagacaaaattcattttac 40651

>gb|AC110781.3| Homo sapiens BAC clone RP11-383A19 from 7, complete sequence
          Length = 44985

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 8     aacattactatgatatacaa 27
             ||||||||||||||||||||
Sbjct: 35369 aacattactatgatatacaa 35388

>dbj|AK046915.1| Mus musculus 10 days neonate cerebellum cDNA, RIKEN full-length
            enriched library, clone:B930002G13
            product:unclassifiable, full insert sequence
          Length = 2594

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 189  gccgatcaccagaagccctggaaa 212
            |||||||| |||||||||||||||
Sbjct: 1198 gccgatcaacagaagccctggaaa 1221

>emb|BX324205.5| Zebrafish DNA sequence from clone CH211-10K1 in linkage group 14,
             complete sequence
          Length = 168546

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 362   tatttctttctctttaccttgaca 385
             ||||||||| ||||||||||||||
Sbjct: 21444 tatttctttgtctttaccttgaca 21467

>gb|AC079226.7| Homo sapiens BAC clone RP11-18D7 from 4, complete sequence
          Length = 184032

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 357   tagtctatttctttctcttt 376
             ||||||||||||||||||||
Sbjct: 85691 tagtctatttctttctcttt 85672

>gb|AC108443.18| Mus musculus chromosome 7, clone RP23-13J9, complete sequence
          Length = 198138

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 107   cataggtactgtgccaaaaa 126
             ||||||||||||||||||||
Sbjct: 49409 cataggtactgtgccaaaaa 49390

>gb|AC172745.4| Mus musculus chromosome 5, clone wi1-1010L24, complete sequence
          Length = 38758

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 189   gccgatcaccagaagccctggaaa 212
             |||||||| |||||||||||||||
Sbjct: 31994 gccgatcaacagaagccctggaaa 31971

>gb|AE017126.1| Prochlorococcus marinus subsp. marinus str. CCMP1375 complete genome
          Length = 1751080

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 372     tctttaccttgacaattctt 391
               ||||||||||||||||||||
Sbjct: 1115724 tctttaccttgacaattctt 1115743

>dbj|AP000344.1| Homo sapiens genomic DNA, chromosome 22q11.2, clone KB1269D1
          Length = 186421

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 8      aacattactatgatatacaa 27
              ||||||||||||||||||||
Sbjct: 118357 aacattactatgatatacaa 118338


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,338,174
Number of Sequences: 3902068
Number of extensions: 4338174
Number of successful extensions: 92622
Number of sequences better than 10.0: 30
Number of HSP's better than 10.0 without gapping: 30
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 92538
Number of HSP's gapped (non-prelim): 84
length of query: 405
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 383
effective length of database: 17,147,199,772
effective search space: 6567377512676
effective search space used: 6567377512676
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)