ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl02g01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 258 1e-65
2dbj|AP002854.2| Oryza sativa (japonica cultivar-group) genomic D... 258 1e-65
3dbj|AK060583.1| Oryza sativa (japonica cultivar-group) cDNA clon... 258 1e-65
4gb|AY106443.1| Zea mays PCO068394 mRNA sequence 254 2e-64
5gb|BT017988.1| Zea mays clone EL01N0526A01.c mRNA sequence 246 5e-62
6gb|AY108153.1| Zea mays PCO068393 mRNA sequence 242 8e-61
7dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 226 5e-56
8dbj|AP004240.3| Oryza sativa (japonica cultivar-group) genomic D... 226 5e-56
9dbj|AP005056.2| Oryza sativa (japonica cultivar-group) genomic D... 226 5e-56
10dbj|AP006400.1| Lotus japonicus genomic DNA, chromosome 4, clone... 149 9e-33
11gb|AY109694.1| Zea mays CL7222_2 mRNA sequence 131 2e-27
12ref|NM_127533.1| Arabidopsis thaliana structural constituent of ... 82 2e-12
13gb|AC007772.6| Drosophila melanogaster clone BACR19P12, complete... 82 2e-12
14emb|CR931740.2| Medicago truncatula chromosome 5 clone mth2-67g1... 82 2e-12
15gb|AY071683.2| Drosophila melanogaster RH08962 full insert cDNA 82 2e-12
16ref|NM_169933.1| Drosophila melanogaster Ribosomal protein S30 C... 82 2e-12
17ref|NM_142665.1| Drosophila melanogaster Ribosomal protein S30 C... 82 2e-12
18gb|AY061910.1| Arabidopsis thaliana At2g19750/F6F22.22 mRNA, com... 82 2e-12
19gb|AY052341.1| Arabidopsis thaliana At2g19750/F6F22.22 mRNA, com... 82 2e-12
20emb|BX822051.1|CNS0AA4U Arabidopsis thaliana Full-length cDNA Co... 82 2e-12
21gb|AY088766.1| Arabidopsis thaliana clone 9466 mRNA, complete se... 82 2e-12
22gb|AE003732.3| Drosophila melanogaster chromosome 3R, section 70... 82 2e-12
23ref|NM_119084.2| Arabidopsis thaliana structural constituent of ... 76 1e-10
24gb|BT012137.1| Arabidopsis thaliana At4g29390 mRNA, complete cds 76 1e-10
25gb|BT011203.1| Arabidopsis thaliana At4g29390 gene, complete cds 76 1e-10
26emb|BX828921.1|CNS0A2HH Arabidopsis thaliana Full-length cDNA Co... 76 1e-10
27gb|AY232248.1| Drosophila yakuba clone yak-ad_CG15697 mRNA sequence 74 4e-10
28gb|AY231796.1| Drosophila yakuba clone yak-em_CG15697 mRNA sequence 74 4e-10
29emb|BX821809.1|CNS0A8DZ Arabidopsis thaliana Full-length cDNA Co... 74 4e-10
30gb|DQ066328.1| Ixodes scapularis isolate IS-6-12L-102 40S riboso... 70 6e-09
31emb|BX819364.1|CNS0AA8V Arabidopsis thaliana Full-length cDNA Co... 68 3e-08
32gb|AY357069.1| Hippocampus comes 40S ribosomal protein S30 mRNA,... 66 1e-07
33gb|AC138087.17| Medicago truncatula clone mth2-22p8, complete se... 64 4e-07
34gb|AC005169.3| Arabidopsis thaliana chromosome 2 clone F6F22 map... 64 4e-07
35gb|CP000069.1| Trypanosoma brucei chromosome 6, complete sequence 60 6e-06
36gb|AC074259.14| Trypanosoma brucei chromosome 6 clone RPCI93-4M1... 60 6e-06
37ref|XM_821669.1| Trypanosoma brucei TREU927 clone RPCI93-4M18 40... 58 2e-05
38gb|AY674244.1| Ixodes pacificus clone IP_7_60_92_99_CLU 40S ribo... 52 0.001
39ref|XM_753132.1| Ustilago maydis 521 hypothetical protein (UM020... 50 0.006
40ref|XM_821618.1| Trypanosoma brucei TREU927 clone RPCI93-4M18 40... 50 0.006
41emb|BX064327.1|CNS09LSR Single read from an extremity of a full-... 50 0.006
42emb|BX048818.1|CNS099TY Single read from an extremity of a full-... 50 0.006
43emb|BX044197.1|CNS0969L Single read from an extremity of a full-... 50 0.006
44emb|BX040902.1|CNS093Q2 Single read from an extremity of a full-... 50 0.006
45emb|BX034577.1|CNS08YUD Single read from an extremity of a full-... 50 0.006
46emb|BX030335.1|CNS08VKJ Single read from an extremity of a full-... 50 0.006
47emb|BX026461.1|CNS08SKX Single read from an extremity of a full-... 50 0.006
48emb|BX025808.1|CNS08S2S Single read from an extremity of a full-... 50 0.006
49emb|BX025321.1|CNS08RP9 Single read from an extremity of a full-... 50 0.006
50emb|BX025277.1|CNS08RO1 Single read from an extremity of a full-... 50 0.006
51emb|BX024620.1|CNS08R5S Single read from an extremity of a full-... 50 0.006
52emb|BX015266.1|CNS08JXY Single read from an extremity of a full-... 50 0.006
53emb|BX011328.1|CNS08GWK Single read from an extremity of a full-... 50 0.006
54emb|BX009900.1|CNS08FSW Single read from an extremity of a full-... 50 0.006
55emb|BX009795.1|CNS08FPZ Single read from an extremity of a full-... 50 0.006
56ref|XM_311180.2| Anopheles gambiae str. PEST ENSANGP00000019081 ... 50 0.006
57gb|AC007993.15|AC007993 Homo sapiens chromosome 17, clone RP11-5... 50 0.006
58gb|AC139317.4| Mus musculus BAC clone RP24-495N6 from 15, comple... 50 0.006
59gb|AC115881.8| Mus musculus chromosome 6, clone RP24-365K16, com... 48 0.023
60gb|AC125321.4| Mus musculus BAC clone RP23-371B13 from chromosom... 48 0.023
61emb|AL731561.12| Human DNA sequence from clone RP11-463P17 on ch... 48 0.023
62emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chr... 48 0.023
63gb|AC079822.13| Homo sapiens 3 BAC RP11-413G22 (Roswell Park Can... 48 0.023
64emb|BX571955.15| Zebrafish DNA sequence from clone DKEY-27B3 in ... 48 0.023
65gb|AC155727.6| Mus musculus 6 BAC RP24-194N1 (Roswell Park Cance... 48 0.023
66gb|AC160399.6| Mus musculus 6 BAC RP23-218B15 (Roswell Park Canc... 48 0.023
67emb|BX820425.1|CNS0AA74 Arabidopsis thaliana Full-length cDNA Co... 48 0.023
68gb|AC154840.2| Mus musculus BAC clone RP23-61I7 from chromosome ... 48 0.023
69gb|AC090963.32| Mus musculus strain C57BL/6J chromosome 17 clone... 48 0.023
70gb|AC170804.2| Mus musculus BAC clone RP24-435B12 from chromosom... 46 0.092
71gb|AC120397.7| Mus musculus chromosome 18, clone RP24-332E21, co... 46 0.092
72gb|BC091402.1| Rattus norvegicus Finkel-Biskis-Reilly murine sar... 46 0.092
73ref|NM_001012739.1| Rattus norvegicus Finkel-Biskis-Reilly murin... 46 0.092
74emb|X62671.1|RRFUSP Rattus rattus mRNA for hybrid protein (ubiqu... 46 0.092
75emb|AL603702.14| Mouse DNA sequence from clone RP23-406A14 on ch... 46 0.092
76gb|AC164162.2| Mus musculus BAC clone RP23-253E17 from chromosom... 46 0.092
77gb|AC026130.15| Homo sapiens chromosome 17, clone RP11-801J18, c... 46 0.092
78gb|AC087330.6| Mus Musculus Strain C57BL6/J chromosome 5 BAC, RP... 46 0.092
79gb|BC102873.1| Bos taurus Finkel-Biskis-Reilly murine sarcoma vi... 46 0.092
80emb|BX548012.11| Zebrafish DNA sequence from clone DKEY-271O4 in... 46 0.092
81gb|AC013449.8| Homo sapiens BAC clone RP11-558C24 from 2, comple... 46 0.092
82gb|AC154537.3| Mus musculus BAC clone RP23-451F20 from chromosom... 46 0.092
83ref|NM_213937.1| Sus scrofa ubiquitin-like/S30 ribosomal fusion ... 46 0.092
84ref|XM_574605.1| PREDICTED: Rattus norvegicus similar to Finkel-... 46 0.092
85gb|AF520959.1| Bos taurus ubiquitin-like/S30 ribosomal fusion pr... 46 0.092
86gb|AY911375.1| Bos taurus clone IMAGE:7961514 ubiquitin-like/S30... 46 0.092
87gb|U72543.1|SSU72543 Sus scrofa ubiquitin-like/S30 ribosomal fus... 46 0.092
88ref|NM_174731.3| Bos taurus Finkel-Biskis-Reilly murine sarcoma ... 46 0.092
89emb|AL845171.5| Mouse DNA sequence from clone RP23-38N8 on chrom... 46 0.092
90gb|AC155166.4| Mus musculus BAC clone RP24-69M8 from chromosome ... 44 0.36
91gb|AE014832.1| Plasmodium falciparum 3D7 chromosome 10 section 4... 44 0.36
92gb|CP000081.1| Leishmania major chromosome 35, complete sequence 44 0.36
93gb|AC159435.1| Trypanosoma brucei chromosome 8 clone RPCI93-29H2... 44 0.36
94gb|CP000071.1| Trypanosoma brucei chromosome 8, complete sequence 44 0.36
95gb|AC155164.5| Mus musculus BAC clone RP24-74L7 from chromosome ... 44 0.36
96gb|AC168205.7| Mus musculus chromosome 8, clone RP23-478P10, com... 44 0.36
97gb|AC139758.3| Mus musculus BAC clone RP23-367E7 from chromosome... 44 0.36
98gb|BT013797.1| Lycopersicon esculentum clone 132717F, mRNA sequence 44 0.36
99gb|AC091276.7| Mus musculus chromosome 15, clone RP23-167B4, com... 44 0.36
100gb|AC163616.3| Mus musculus BAC clone RP23-114P22 from chromosom... 44 0.36
101gb|AC110164.26| Mus musculus chromosome 3, clone RP23-167C5, com... 44 0.36
102gb|AC132377.3| Mus musculus BAC clone RP24-81F14 from chromosome... 44 0.36
103gb|AC113011.9| Mus musculus chromosome 16, clone RP23-173D22, co... 44 0.36
104gb|AC122485.3| Mus musculus BAC clone RP24-377J10 from chromosom... 44 0.36
105gb|AC124408.4| Mus musculus BAC clone RP24-262E22 from chromosom... 44 0.36
106gb|AC122383.4| Mus musculus BAC clone RP23-479O8 from chromosome... 44 0.36
107gb|AC121571.4| Mus musculus BAC clone RP23-231J6 from 3, complet... 44 0.36
108gb|AC122919.3| Mus musculus BAC clone RP23-30C12 from 10, comple... 44 0.36
109gb|AC122434.2| Mus musculus BAC clone RP24-198G2 from chromosome... 44 0.36
110gb|AC127332.3| Mus musculus BAC clone RP23-136I1 from 5, complet... 44 0.36
111gb|AC124578.4| Mus musculus BAC clone RP23-166C2 from 18, comple... 44 0.36
112gb|AC115304.3| Mus musculus BAC clone RP24-156K1 from 15, comple... 44 0.36
113gb|AC113003.9| Mus musculus chromosome 18, clone RP23-246G4, com... 44 0.36
114gb|AC141325.1| Pan troglodytes BAC clone RP43-168D7 from 7, comp... 44 0.36
115emb|CR753843.8| Zebrafish DNA sequence from clone DKEY-169H1 in ... 44 0.36
116emb|Z86062.1|HS121G13 Human DNA sequence from clone RP1-121G13 o... 44 0.36
117emb|AL451074.13| Human DNA sequence from clone RP11-466F5 on chr... 44 0.36
118emb|AL391865.9| Human DNA sequence from clone RP13-40J16 on chro... 44 0.36
119emb|AL357117.20| Human DNA sequence from clone RP11-436I24 on ch... 44 0.36
120emb|AL356776.21| Human DNA sequence from clone RP11-477E3 on chr... 44 0.36
121emb|AL355985.18| Human DNA sequence from clone RP11-98O17 on chr... 44 0.36
122emb|AL158154.28| Human DNA sequence from clone RP11-383M4 on chr... 44 0.36
123gb|AC113194.8| Homo sapiens chromosome 8, clone RP11-1070A24, co... 44 0.36
124gb|AC158926.4| Mus musculus chromosome 3, clone RP24-93J4, compl... 44 0.36
125emb|AL022717.2|HS201D7 Human DNA sequence from clone RP1-201D7 o... 44 0.36
126gb|AC163678.3| Mus musculus BAC clone RP24-104D14 from chromosom... 44 0.36
127emb|AL591496.13| Mouse DNA sequence from clone RP23-384C18 on ch... 44 0.36
128gb|AC002121.1| Genomic sequence from Mouse 11, complete sequence 44 0.36
129gb|AC063968.5| Genomic sequence for Mus musculus, clone RP23-105... 44 0.36
130gb|AC021649.18| Homo sapiens 3 BAC RP11-321F19 (Roswell Park Can... 44 0.36
131gb|AC121255.2| Homo sapiens chromosome 3 clone RP11-669E5, compl... 44 0.36
132gb|AC010296.6| Homo sapiens chromosome 5 clone CTB-155H23, compl... 44 0.36
133gb|AC117379.3| Homo sapiens 3 BAC RP11-392C7 (Roswell Park Cance... 44 0.36
134gb|AC090448.5| Homo sapiens chromosome 8, clone RP11-142M8, comp... 44 0.36
135gb|AC078813.13| Homo sapiens 3q BAC RP11-149B11 (Roswell Park Ca... 44 0.36
136gb|AC099775.2| Homo sapiens chromosome 3 clone RP11-169G24, comp... 44 0.36
137gb|AC092042.2| Homo sapiens chromosome 3 clone RP11-136C24, comp... 44 0.36
138gb|AC101979.13| Mus musculus chromosome 3, clone RP24-338A7, com... 44 0.36
139emb|CR406246.1| Gallus gallus finished cDNA, clone ChEST877h12 44 0.36
140gb|AC150899.3| Mus musculus BAC clone RP23-179F8 from chromosome... 44 0.36
141dbj|AK080271.1| Mus musculus 3 days neonate thymus cDNA, RIKEN f... 44 0.36
142gb|AC007351.40|AC007351 Homo sapiens 12 BAC RP11-492N15 (Roswell... 44 0.36
143gb|AC021001.5|AC021001 Homo sapiens chromosome 8, clone RP11-419... 44 0.36
144gb|AC015982.9| Homo sapiens BAC clone RP11-554J4 from 2, complet... 44 0.36
145gb|AC152159.6| Mus musculus chromosome 15, clone RP23-10O8, comp... 44 0.36
146gb|AC154322.1| Mus musculus BAC clone RP23-299P17 from chromosom... 44 0.36
147gb|AC145987.2| Pan troglodytes BAC clone RP43-165D6 from chromos... 44 0.36
148gb|AC155816.3| Mus musculus BAC clone RP23-435J8 from chromosome... 44 0.36
149gb|AC017033.5| Homo sapiens BAC clone RP11-297J22 from 2, comple... 44 0.36
150gb|AC020594.6| Homo sapiens BAC clone RP11-322P19 from 2, comple... 44 0.36
151gb|AC008431.5|AC008431 Homo sapiens chromosome 5 clone CTC-311C2... 44 0.36
152gb|AC108039.4| Homo sapiens BAC clone RP11-210C5 from 2, complet... 44 0.36
153gb|AC132445.3| Mus musculus BAC clone RP23-173F23 from chromosom... 44 0.36
154gb|AC133184.3| Mus musculus BAC clone RP24-186A17 from chromosom... 44 0.36
155gb|AC092573.2| Homo sapiens BAC clone RP11-1O7 from 2, complete ... 44 0.36
156gb|AC018752.4|AC018752 Homo sapiens chromosome 5 clone CTC-339F2... 44 0.36
157gb|AF157330.1|MMPRXI3 Mus musculus peroxiredoxin I (PrxI) gene, ... 44 0.36
158gb|AC149589.2| Mus musculus BAC clone RP23-356I2 from 18, comple... 44 0.36
159gb|AC007751.3|AC007751 Homo sapiens, clone 5_A_11, complete sequ... 44 0.36
160gb|AC152984.2| Mus musculus 6 BAC RP23-462B3 (Roswell Park Cance... 44 0.36
161gb|AC155637.4| Mus musculus 10 BAC RP24-227O16 (Roswell Park Can... 44 0.36
162gb|AC108782.9| Mus musculus chromosome 8, clone RP23-350C11, com... 44 0.36
163dbj|AP000427.3| Homo sapiens genomic DNA, chromosome 8q23, clone... 44 0.36
164emb|AL627212.21| Mouse DNA sequence from clone RP23-145E1 on chr... 44 0.36
165emb|AL672268.18| Mouse DNA sequence from clone RP23-171J18 on ch... 44 0.36
166emb|BX005233.10| Mouse DNA sequence from clone RP23-214I11 on ch... 44 0.36
167gb|AC133497.4| Mus musculus BAC clone RP24-390A22 from 8, comple... 44 0.36
168gb|AC147366.5| Mus musculus BAC clone RP23-386J3 from 15, comple... 44 0.36
169emb|CT033847.5| Mouse DNA sequence from clone RP24-225N8 on chro... 44 0.36
170emb|CT030683.6| Mouse DNA sequence from clone RP23-22O8 on chrom... 44 0.36
171gb|AC002109.1|AC002109 Genomic sequence from Mouse 9, complete s... 44 0.36
172gb|AC069561.37| Mus musculus strain C57BL/6J chromosome 9 clone ... 44 0.36
173emb|AL831786.7| Mouse DNA sequence from clone RP23-177C18 on chr... 44 0.36
174emb|AL683810.10| Mouse DNA sequence from clone RP23-10L18 on chr... 44 0.36
175emb|AL671672.4| Mouse DNA sequence from clone RP23-461E2 on chro... 44 0.36
176emb|AL451076.14| Mouse DNA sequence from clone RP23-43O20 on chr... 44 0.36
177emb|AL670231.7| Mouse DNA sequence from clone RP23-329G7 on chro... 44 0.36
178emb|AL929375.5| Mouse DNA sequence from clone RP23-49G18 on chro... 44 0.36
179emb|AL731717.11| Mouse DNA sequence from clone RP23-92C4 on chro... 44 0.36
180emb|AL833775.7| Mouse DNA sequence from clone RP23-135L5 on chro... 44 0.36
181dbj|AP004288.2| Homo sapiens genomic DNA, chromosome 8q23, clone... 44 0.36
182emb|AL732428.7| Mouse DNA sequence from clone RP23-347P2 on chro... 44 0.36
183emb|AL627078.10| Mouse DNA sequence from clone RP23-138K13 on ch... 44 0.36
184gb|AC117731.14| Mus musculus chromosome 8, clone RP24-128L11, co... 42 1.4
185gb|AC153080.4| Colobus guereza clone CH272-279A15, complete sequ... 42 1.4
186gb|AC162384.6| Mus musculus 10 BAC RP24-292K6 (Roswell Park Canc... 42 1.4
187gb|AC102039.8| Mus musculus chromosome 5, clone RP23-262L7, comp... 42 1.4
188gb|AC102612.14| Mus musculus chromosome 9, clone RP23-417D20, co... 42 1.4
189gb|AC165229.7| Mus musculus chromosome 1, clone RP23-47K10, comp... 42 1.4
190gb|AC153380.1| Mus musculus BAC RP23-256G5 (Roswell Park Cancer... 42 1.4
191gb|AC123629.10| Mus musculus chromosome 13, clone RP24-344N4, co... 42 1.4
192gb|AC152753.1| Mus musculus chromosome 17 clone RP23-65L9, compl... 42 1.4
193gb|AC121261.9| Mus musculus chromosome 7, clone RP24-69L13, comp... 42 1.4
194gb|AC110525.10| Mus musculus chromosome 8, clone RP23-82N11, com... 42 1.4
195gb|AC154387.2| Mus musculus BAC clone RP23-10K1 from chromosome ... 42 1.4
196gb|AC160992.2| Mus musculus BAC clone RP23-147I23 from chromosom... 42 1.4
197gb|AC145600.6| Mus musculus BAC clone RP24-220P24 from chromosom... 42 1.4
198gb|AC167812.4| Mus musculus BAC clone RP24-299F5 from chromosome... 42 1.4
199ref|NM_001031595.1| Gallus gallus zinc finger protein, subfamily... 42 1.4
200gb|AC168308.2| Mus musculus chromosome 18, clone wi1-1401I7, com... 42 1.4
201ref|NM_020443.2| Homo sapiens neuron navigator 1 (NAV1), mRNA 42 1.4
202gb|AC163447.5| Mus musculus chromosome 7, clone RP24-314E16, com... 42 1.4
203gb|AC102794.8| Mus musculus chromosome 3, clone RP23-235G13, com... 42 1.4
204gb|AC107634.8| Mus musculus chromosome 5, clone RP23-19G21, comp... 42 1.4
205gb|AC113177.16| Mus musculus chromosome 15, clone RP23-447G7, co... 42 1.4
206gb|AC138278.9| Mus musculus chromosome 8, clone RP23-378E4, comp... 42 1.4
207gb|AC102168.9| Mus musculus chromosome 7, clone RP23-452N21, com... 42 1.4
208gb|AC158499.5| Mus musculus chromosome 18, clone RP23-466O5, com... 42 1.4
209gb|AC124228.16| Mus musculus chromosome 5, clone RP23-345O14, co... 42 1.4
210gb|AC161809.3| Mus musculus chromosome 1, clone RP23-114N13, com... 42 1.4
211gb|AC146536.3| Dasypus novemcinctus clone VMRC5-215B23, complete... 42 1.4
212gb|AC005213.1| Homo sapiens chromosome 5, BAC clone 84E9 (LBNL H... 42 1.4
213gb|AC093481.8| Mus musculus chromosome 18, clone RP23-62E19, com... 42 1.4
214gb|AC101715.8| Mus musculus chromosome 1, clone RP23-283P17, com... 42 1.4
215gb|AC161262.2| Mus musculus BAC clone RP23-325G1 from chromosome... 42 1.4
216gb|AC161416.2| Mus musculus BAC clone RP23-306A2 from chromosome... 42 1.4
217gb|AC159635.2| Mus musculus BAC clone RP24-111I3 from chromosome... 42 1.4
218gb|AC153977.4| Mus musculus 10 BAC RP24-270K22 (Roswell Park Can... 42 1.4
219gb|AC102654.7| Mus musculus chromosome 1, clone RP23-2K13, compl... 42 1.4
220gb|AC151571.1| Latimeria menadoensis clone VMRC4-140H19, complet... 42 1.4
221gb|AC120875.12| Mus musculus chromosome 1, clone RP23-317M5, com... 42 1.4
222gb|AY267034.1| Mus musculus cadherin 7 precursor, mRNA, complete... 42 1.4
223gb|AC124323.10| Mus musculus chromosome 19, clone RP24-444B6, co... 42 1.4
224gb|AC137978.8| Mus musculus chromosome 1, clone RP24-468M12, com... 42 1.4
225gb|AC113104.15| Mus musculus chromosome 18, clone RP23-321L15, c... 42 1.4
226gb|AC105968.14| Mus musculus chromosome 18, clone RP23-265P4, co... 42 1.4
227gb|AC117994.12| Mus musculus chromosome 6, clone RP23-25K2, comp... 42 1.4
228gb|AC091333.6| Mus musculus chromosome 7, clone RP23-325M1, comp... 42 1.4
229gb|AC117570.11| Mus musculus chromosome 9, clone RP23-18M12, com... 42 1.4
230gb|AC102342.10| Mus musculus chromosome 18, clone RP23-250K3, co... 42 1.4
231ref|XM_429676.1| PREDICTED: Gallus gallus LOC419550 (LOC419550),... 42 1.4
232gb|AC166334.8| Mus musculus chromosome 7, clone RP23-470P9, comp... 42 1.4
233gb|AF241726.3| Homo sapiens chromosome X, clones RP5-819E23 and ... 42 1.4
234gb|AC101983.16| Mus musculus chromosome 6, clone RP24-352A8, com... 42 1.4
235gb|AC101794.5| Mus musculus chromosome 1, clone RP24-188N24, com... 42 1.4
236gb|AC118047.7| Mus musculus chromosome 3, clone RP24-219P20, com... 42 1.4
237gb|AC135672.4| Mus musculus BAC clone RP23-449K22 from chromosom... 42 1.4
238gb|AC140364.4| Mus musculus BAC clone RP24-75K5 from chromosome ... 42 1.4
239ref|NM_204181.1| Gallus gallus cholinergic receptor, nicotinic, ... 42 1.4
240gb|AC123747.26| Mus musculus chromosome 3, clone RP24-123I12, co... 42 1.4
241gb|AC102497.7| Mus musculus chromosome 18, clone RP24-570C15, co... 42 1.4
242gb|AC111059.9| Mus musculus chromosome 15, clone RP24-495D8, com... 42 1.4
243gb|AC100212.8| Mus musculus chromosome 18, clone RP23-60D22, com... 42 1.4
244gb|AC107274.11| Rattus norvegicus 18 BAC CH230-207M17 (Children'... 42 1.4
245ref|NG_000008.6| Homo sapiens cytochrome P450, family 2, subfami... 42 1.4
246gb|AC112938.11| Mus musculus chromosome 5, clone RP24-72E12, com... 42 1.4
247gb|AC121785.3| Mus musculus BAC clone RP23-382K4 from chromosome... 42 1.4
248gb|AC127546.4| Mus musculus BAC clone RP24-485N8 from chromosome... 42 1.4
249gb|AC139376.3| Mus musculus BAC clone RP24-420A20 from chromosom... 42 1.4
250gb|AC127572.3| Mus musculus BAC clone RP24-231A11 from chromosom... 42 1.4
251gb|AC147382.3| Pan troglodytes BAC clone RP43-171M24 from 7, com... 42 1.4
252gb|AC147329.2| Pan troglodytes BAC clone RP43-21F14 from 7, comp... 42 1.4
253gb|AC146385.4| Pan troglodytes BAC clone RP43-126C6 from 7, comp... 42 1.4
254gb|AC146098.3| Pan troglodytes BAC clone RP43-51J12 from 7, comp... 42 1.4
255gb|AC122204.3| Mus musculus BAC clone RP23-73N8 from chromosome ... 42 1.4
256gb|AC147557.4| Mus musculus BAC clone RP23-452M8 from chromosome... 42 1.4
257gb|AC140196.3| Mus musculus BAC clone RP24-267C3 from chromosome... 42 1.4
258gb|AC140317.2| Mus musculus BAC clone RP23-396O18 from chromosom... 42 1.4
259gb|AC144630.2| Mus musculus BAC clone RP23-284O15 from chromosom... 42 1.4
260gb|DQ481669.1| Takifugu rubripes HoxDb gene cluster, complete se... 42 1.4
261gb|AC158214.4| Mus musculus chromosome 7, clone RP24-208N15, com... 42 1.4
262gb|AC158987.3| Mus musculus BAC clone RP23-366K1 from chromosome... 42 1.4
263gb|AC091324.10| Mus musculus chromosome 7, clone RP23-7G1, compl... 42 1.4
264gb|AC165944.3| Mus musculus chromosome 3, clone RP24-134A8, comp... 42 1.4
265gb|AC122118.7| Mus musculus chromosome 18, clone RP24-225P17, co... 42 1.4
266gb|AC123665.9| Mus musculus chromosome 14, clone RP23-226A4, com... 42 1.4
267gb|AC164300.3| Mus musculus BAC clone RP23-310J6 from chromosome... 42 1.4
268gb|AC154597.2| Mus musculus BAC clone RP23-355G2 from chromosome... 42 1.4
269gb|AC165155.2| Mus musculus BAC clone RP23-293N22 from chromosom... 42 1.4
270gb|AC165366.2| Mus musculus BAC clone RP23-51H15 from chromosome... 42 1.4
271gb|AC163995.4| Mus musculus chromosome 5, clone RP24-242C19, com... 42 1.4
272gb|AC113599.10| Mus musculus chromosome 18, clone RP23-5D23, com... 42 1.4
273gb|AC137905.8| Mus musculus chromosome 15, clone RP23-334B11, co... 42 1.4
274gb|AC110235.13| Mus musculus chromosome 9, clone RP23-100M12, co... 42 1.4
275gb|AC109308.8| Mus musculus chromosome 3, clone RP24-459K16, com... 42 1.4
276gb|AC124980.7| Mus musculus chromosome 13, clone RP24-133J11, co... 42 1.4
277gb|AC122399.4| Mus musculus BAC clone RP24-92B2 from chromosome ... 42 1.4
278gb|AC175390.2| Mus musculus BAC clone RP24-108F5 from chromosome... 42 1.4
279gb|AC140433.3| Mus musculus BAC clone RP23-96L16 from chromosome... 42 1.4
280gb|AC004417.1| Homo sapiens BAC clone CTA-325M7 from 7, complete... 42 1.4
281gb|AC005103.3| Homo sapiens BAC clone CTA-357J21 from 7, complet... 42 1.4
282gb|AC011894.3| Homo sapiens BAC clone RP11-52M17 from 7, complet... 42 1.4
283gb|AC115900.11| Mus musculus chromosome 6, clone RP24-464A7, com... 42 1.4
284gb|AC123985.10| Mus musculus chromosome 14, clone RP23-154G18, c... 42 1.4
285gb|AC004864.1| Homo sapiens PAC clone RP4-721B17 from 7, complet... 42 1.4
286gb|AY375532.1| Homo sapiens insulin-like growth factor 2, antise... 42 1.4
287gb|AC146039.2| Pan troglodytes BAC clone RP43-97H7 from 7, compl... 42 1.4
288gb|AC109495.4| Homo sapiens chromosome 16 clone RP11-916L7, comp... 42 1.4
289gb|AC124600.5| Mus musculus BAC clone RP23-25H7 from chromosome ... 42 1.4
290gb|AC127317.3| Mus musculus BAC clone RP23-227H18 from chromosom... 42 1.4
291gb|AC132458.3| Mus musculus BAC clone RP23-152C8 from chromosome... 42 1.4
292gb|AC132253.5| Mus musculus BAC clone RP24-456H22 from chromosom... 42 1.4
293gb|AC133185.4| Mus musculus BAC clone RP23-297B16 from chromosom... 42 1.4
294emb|CT010480.10| Mouse DNA sequence from clone RP23-313E11 on ch... 42 1.4
295gb|AC145901.2| Pan troglodytes BAC clone RP43-9F20 from 7, compl... 42 1.4
296gb|AC145877.3| Pan troglodytes BAC clone RP43-20I7 from 7, compl... 42 1.4
297gb|AC146232.2| Pan troglodytes BAC clone RP43-27C6 from 7, compl... 42 1.4
298gb|AC146213.2| Pan troglodytes BAC clone RP43-33O10 from 7, comp... 42 1.4
299gb|AC145868.2| Pan troglodytes BAC clone RP43-39F11 from 7, comp... 42 1.4
300emb|CR956650.4| Pig DNA sequence from clone CH242-171I16 on chro... 42 1.4
301gb|AC007610.10| Homo sapiens chromosome 16 clone RP11-429P3, com... 42 1.4
302emb|AL669948.8| Mouse DNA sequence from clone RP23-248K2 on chro... 42 1.4
303gb|AC125110.4| Mus musculus BAC clone RP24-235E14 from chromosom... 42 1.4
304gb|AC132120.3| Mus musculus BAC clone RP23-479B19 from chromosom... 42 1.4
305gb|AC121833.3| Mus musculus BAC clone RP24-69C16 from chromosome... 42 1.4
306gb|AC129078.6| Mus musculus BAC clone RP24-71C5 from chromosome ... 42 1.4
307gb|AC133172.4| Mus musculus BAC clone RP24-273H5 from chromosome... 42 1.4
308gb|AC115302.4| Mus musculus BAC clone RP24-107D24 from chromosom... 42 1.4
309gb|AC123817.4| Mus musculus BAC clone RP24-255D13 from chromosom... 42 1.4
310gb|AC134834.3| Mus musculus BAC clone RP24-320P15 from chromosom... 42 1.4
311gb|AC126042.3| Mus musculus BAC clone RP24-303J10 from chromosom... 42 1.4
312gb|AC122483.5| Mus musculus BAC clone RP24-366B4 from chromosome... 42 1.4
313gb|AC134535.4| Mus musculus BAC clone RP24-371E20 from chromosom... 42 1.4
314gb|AC122036.3| Mus musculus BAC clone RP24-420C18 from chromosom... 42 1.4
315gb|AC146502.2| Danio rerio clone CH211-262M17, complete sequence 42 1.4
316gb|AC127594.3| Mus musculus BAC clone RP23-44G8 from chromosome ... 42 1.4
317gb|AC122255.2| Mus musculus BAC clone RP23-178F22 from chromosom... 42 1.4
318gb|AC138549.3| Mus musculus BAC clone RP23-173C1 from chromosome... 42 1.4
319gb|AC124550.4| Mus musculus BAC clone RP23-211F21 from chromosom... 42 1.4
320gb|AC116319.4| Mus musculus BAC clone RP23-265J2 from chromosome... 42 1.4
321gb|AC124748.5| Mus musculus BAC clone RP23-261I7 from chromosome... 42 1.4
322gb|AC138619.4| Mus musculus BAC clone RP23-278M16 from chromosom... 42 1.4
323gb|AC125188.4| Mus musculus BAC clone RP23-303O19 from chromosom... 42 1.4
324gb|AC133186.4| Mus musculus BAC clone RP23-320D8 from chromosome... 42 1.4
325gb|AC116586.6| Mus musculus BAC clone RP23-402K15 from chromosom... 42 1.4
326gb|AC127358.3| Mus musculus BAC clone RP23-109B9 from chromosome... 42 1.4
327gb|AC133204.3| Mus musculus BAC clone RP23-106N3 from chromosome... 42 1.4
328gb|AC125359.4| Mus musculus BAC clone RP23-102I17 from chromosom... 42 1.4
329gb|AC099057.3| Homo sapiens chromosome 3 clone RP11-655N11, comp... 42 1.4
330gb|AC004158.1|HUAC004158 Homo sapiens Chromosome 16 BAC clone CI... 42 1.4
331emb|CR974452.4| Pig DNA sequence from clone PigE-201A17 on chrom... 42 1.4
332gb|AC113307.12| Mus musculus chromosome 3, clone RP23-437A2, com... 42 1.4
333gb|AC124426.4| Mus musculus BAC clone RP24-231B8 from chromosome... 42 1.4
334gb|AC127678.9| Mus musculus BAC clone RP24-233M12 from chromosom... 42 1.4
335gb|AC125135.5| Mus musculus BAC clone RP24-321M1 from chromosome... 42 1.4
336gb|AC122797.3| Mus musculus BAC clone RP24-392D22 from chromosom... 42 1.4
337gb|U52111.3| Homo sapiens chromosome X clone Qc-7G6, QLL-F1720, ... 42 1.4
338gb|AC126248.3| Mus musculus BAC clone RP24-422C6 from chromosome... 42 1.4
339gb|AC124384.4| Mus musculus BAC clone RP24-413G2 from chromosome... 42 1.4
340emb|Z29443.1|CET07C4 Caenorhabditis elegans Cosmid T07C4, comple... 42 1.4
341gb|AC121804.3| Mus musculus BAC clone RP23-442I5 from chromosome... 42 1.4
342gb|AC122381.2| Mus musculus BAC clone RP23-477C4 from chromosome... 42 1.4
343gb|AC132600.3| Mus musculus BAC clone RP24-134A5 from chromosome... 42 1.4
344gb|AC124740.4| Mus musculus BAC clone RP23-356M1 from chromosome... 42 1.4
345gb|AC127587.4| Mus musculus BAC clone RP24-143O1 from chromosome... 42 1.4
346gb|AC125091.3| Mus musculus BAC clone RP24-165P5 from chromosome... 42 1.4
347gb|AC127293.3| Mus musculus BAC clone RP23-385B3 from chromosome... 42 1.4
348gb|AC129314.4| Mus musculus BAC clone RP23-365D12 from chromosom... 42 1.4
349gb|AC112257.5| Mus musculus BAC clone RP23-43A18 from 16, comple... 42 1.4
350gb|AC128673.4| Homo sapiens BAC clone RP11-1195P3 from UL, compl... 42 1.4
351gb|AC125229.3| Mus musculus BAC clone RP23-45P1 from 5, complete... 42 1.4
352gb|AC122864.3| Mus musculus BAC clone RP23-142M19 from 6, comple... 42 1.4
353gb|AC122850.4| Mus musculus BAC clone RP23-167J19 from 10, compl... 42 1.4
354gb|AC122276.4| Mus musculus BAC clone RP23-230D23 from 6, comple... 42 1.4
355gb|AC116325.5| Mus musculus BAC clone RP23-295K3 from 10, comple... 42 1.4
356emb|CR407547.14| Zebrafish DNA sequence from clone DKEY-62A12 in... 42 1.4
357gb|AC099413.3| Mus musculus BAC clone RP23-2O10 from 4, complete... 42 1.4
358gb|AC131941.1| Mus musculus BAC clone RP23-109A19 from 1, comple... 42 1.4
359gb|AC116383.11| Mus musculus chromosome 5, clone RP23-15P21, com... 42 1.4
360gb|AC098725.3| Mus musculus BAC clone RP23-3D20 from 3, complete... 42 1.4
361gb|AC098742.4| Mus musculus BAC clone RP23-122N2 from 14, comple... 42 1.4
362gb|AC108430.11| Mus musculus chromosome 14, clone RP23-166L19, c... 42 1.4
363gb|AC111131.8| Mus musculus, clone RP23-340N7, complete sequence 42 1.4
364gb|AF547167.1| Rattus norvegicus Cx3cr1 gene, promoter region 42 1.4
365gb|AC073048.7| Homo sapiens BAC clone RP11-54E21 from 7, complet... 42 1.4
366gb|AC007384.3| Homo sapiens BAC clone RP11-325F22 from 7, comple... 42 1.4
367gb|AC093655.4| Homo sapiens BAC clone RP11-424F6 from 7, complet... 42 1.4
368gb|AC092647.2| Homo sapiens BAC clone RP11-419M24 from 7, comple... 42 1.4
369gb|AC098592.5| Homo sapiens BAC clone RP11-403N12 from 7, comple... 42 1.4
370gb|AC073216.7| Homo sapiens BAC clone RP11-521C10 from 7, comple... 42 1.4
371gb|AC114501.1| Homo sapiens BAC clone RP11-667F9 from 7, complet... 42 1.4
372gb|AC079763.7| Homo sapiens BAC clone RP11-153N17 from 7, comple... 42 1.4
373gb|AC113527.8| Mus musculus chromosome 9, clone RP23-314E23, com... 42 1.4
374gb|AC004981.2| Homo sapiens PAC clone RP5-1159C10 from 7, comple... 42 1.4
375gb|AC119805.6| Mus musculus chromosome 16, clone RP23-144H22, co... 42 1.4
376gb|AC101811.3| Mus musculus chromosome 19, clone RP24-295O9, com... 42 1.4
377gb|AC121524.6| Mus musculus chromosome 18, clone RP24-342F19, co... 42 1.4
378gb|AC102339.16| Mus musculus chromosome 18, clone RP24-573J7, co... 42 1.4
379gb|AC164089.4| Mus musculus BAC clone RP23-70G12 from chromosome... 42 1.4
380gb|AC104897.7| Mus musculus chromosome 12, clone RP23-300E12, co... 42 1.4
381gb|AC104871.8| Mus musculus chromosome 13, clone RP23-281C23, co... 42 1.4
382gb|AC091507.2| Sus scrofa clone RP44-397B10, complete sequence 42 1.4
383gb|AC146057.2| Pan troglodytes BAC clone RP43-90E18 from 7, comp... 42 1.4
384gb|AC139154.3| Mus musculus chromosome 7 clone RP24-356B8, compl... 42 1.4
385gb|AC162444.2| Mus musculus chromosome 19, clone RP24-75M1, comp... 42 1.4
386gb|AC124973.8| Mus musculus strain C57BL/6J clone rp23-329l13 ma... 42 1.4
387gb|AC012184.7| Homo sapiens chromosome 16 clone RP11-529K1, comp... 42 1.4
388gb|AC161366.6| Mus musculus BAC clone RP24-230D17 from chromosom... 42 1.4
389gb|AC156990.11| Mus musculus chromosome 8, clone RP23-322E23, co... 42 1.4
390gb|AC161232.7| Mus musculus chromosome 3, clone RP24-369J22, com... 42 1.4
391gb|AC010295.7| Homo sapiens chromosome 5 clone CTB-143H13, compl... 42 1.4
392emb|CR387930.11| Zebrafish DNA sequence from clone CH211-69P15 i... 42 1.4
393gb|AY263365.1| Homo sapiens tissue factor pathway inhibitor (lip... 42 1.4
394emb|BX323064.13| Zebrafish DNA sequence from clone DKEYP-13D12 i... 42 1.4
395gb|AC084859.7| Homo sapiens chromosome 11, clone CTC-497E21, com... 42 1.4
396emb|AL732314.18| Human DNA sequence from clone RP13-465B17 on ch... 42 1.4
397emb|Z82215.1|HS68O2 Human DNA sequence from clone RP1-68O2 on ch... 42 1.4
398emb|CR381602.30| Zebrafish DNA sequence from clone DKEY-183M22 i... 42 1.4
399emb|AL645504.10| Human DNA sequence from clone RP11-90L20 on chr... 42 1.4
400emb|AL607082.9| Human DNA sequence from clone RP11-166O7 on chro... 42 1.4
401emb|AL592182.6| Human DNA sequence from clone RP11-567C20 on chr... 42 1.4
402emb|AL592524.4| Human DNA sequence from clone RP11-2B19 on chrom... 42 1.4
403emb|AL590041.9| Human DNA sequence from clone RP13-436D9 on chro... 42 1.4
404emb|AL590072.7| Human DNA sequence from clone RP11-154J12 on chr... 42 1.4
405emb|AL589916.4| Human DNA sequence from clone RP11-166P24 on chr... 42 1.4
406emb|AL499606.18| Human DNA sequence from clone RP11-13J16 on chr... 42 1.4
407emb|AL513007.5| Human DNA sequence from clone CTD-2530H13 on chr... 42 1.4
408emb|AL391825.15| Human DNA sequence from clone RP11-456P18 on ch... 42 1.4
409emb|AL442067.16| Human DNA sequence from clone RP11-128N14 on ch... 42 1.4
410emb|AL445604.9| Human DNA sequence from clone RP11-661D17 on chr... 42 1.4
411emb|AL450344.4| Human DNA sequence from clone RP11-136K14 on chr... 42 1.4
412emb|AL360078.16| Human DNA sequence from clone RP11-530N10 on ch... 42 1.4
413emb|AL390966.14| Human DNA sequence from clone RP11-155I19 on ch... 42 1.4
414emb|AL357140.33| Human DNA sequence from clone RP11-84A14 on chr... 42 1.4
415emb|AL359532.26| Human DNA sequence from clone RP11-330O11 on ch... 42 1.4
416gb|AC022773.17| Mus musculus chromosome X, clone RP23-157B8, com... 42 1.4
417emb|AL356986.11| Human DNA sequence from clone RP11-395N6 on chr... 42 1.4
418emb|AL356535.19| Human DNA sequence from clone RP11-613F7 on chr... 42 1.4
419emb|AL356055.13| Human DNA sequence from clone RP11-416A14 on ch... 42 1.4
420emb|AL355358.9| Human DNA sequence from clone RP11-536L15 on chr... 42 1.4
421emb|AL354740.29| Human DNA sequence from clone RP11-513I15 on ch... 42 1.4
422emb|AL354796.21| Human DNA sequence from clone RP11-145E17 on ch... 42 1.4
423emb|AL162502.17| Human DNA sequence from clone RP11-153G4 on chr... 42 1.4
424emb|AL354916.16| Human DNA sequence from clone RP11-26K22 on chr... 42 1.4
425emb|AL354735.14| Human DNA sequence from clone RP11-738I14 on ch... 42 1.4
426emb|AL353802.14| Human DNA sequence from clone RP4-662P1 on chro... 42 1.4
427emb|AL353740.14| Human DNA sequence from clone RP11-163F15 on ch... 42 1.4
428emb|AL353664.14| Human DNA sequence from clone RP11-140B17 on ch... 42 1.4
429gb|AC109660.8| Rattus norvegicus 14 BAC CH230-162H23 (Children's... 42 1.4
430gb|AC134265.6| Rattus norvegicus 13 BAC CH230-151K3 (Children's ... 42 1.4
431emb|AL353754.10| Human DNA sequence from clone RP11-401E9 on chr... 42 1.4
432emb|AL159971.26| Human DNA sequence from clone RP11-150L15 on ch... 42 1.4
433emb|AL160411.25| Human DNA sequence from clone RP4-726N1 on chro... 42 1.4
434emb|AL160412.14| Human DNA sequence from clone RP5-827E24 on chr... 42 1.4
435emb|AL139010.29| Human DNA sequence from clone RP11-444M10 on ch... 42 1.4
436emb|AL139038.18| Human DNA sequence from clone RP11-456B18 on ch... 42 1.4
437emb|AL139137.15| Human DNA sequence from clone RP11-58O13 on chr... 42 1.4
438emb|AL139001.14| Human DNA sequence from clone RP11-1G3 on chrom... 42 1.4
439emb|AL135839.15| Human DNA sequence from clone RP1-188K17 on chr... 42 1.4
440emb|AL136305.14| Human DNA sequence from clone RP1-259A10 on chr... 42 1.4
441gb|AC069228.26| Homo sapiens 12 BAC RP11-315E17 (Roswell Park Ca... 42 1.4
442emb|AL137848.5| Human DNA sequence from clone RP11-77D6 on chrom... 42 1.4
443emb|AL133344.28| Human DNA sequence from clone RP5-1158H2 on chr... 42 1.4
444emb|AL121776.19|HSJ1050K3 Human DNA sequence from clone RP5-1050... 42 1.4
445gb|AC115989.6| Homo sapiens chromosome 17, clone CTD-2104P17, co... 42 1.4
446emb|AL121924.13|HSJ746J20 Human DNA sequence from clone RP4-746J... 42 1.4
447emb|AL121722.9|HSJ788L20 Human DNA sequence from clone RP4-788L2... 42 1.4
448emb|AL109945.15|HSJ811H24 Human DNA sequence from clone RP4-811H... 42 1.4
449emb|AL109915.10|HSDJ120N9 Human DNA sequence from clone RP1-120N... 42 1.4
450emb|AL031680.20|HS850H21 Human DNA sequence from clone RP5-850H2... 42 1.4
451gb|AC157581.2| Mus musculus chromosome 18, clone RP24-249P15, co... 42 1.4
452gb|AC158971.4| Mus musculus chromosome 15, clone RP24-204H21, co... 42 1.4
453emb|AL034403.19|HS31B8 Human DNA sequence from clone RP1-31B8 on... 42 1.4
454emb|AL034405.16|HS537K23 Human DNA sequence from clone RP4-537K2... 42 1.4
455gb|AC158571.3| Mus musculus chromosome 3, clone RP23-117E23, com... 42 1.4
456gb|AC158151.4| Mus musculus chromosome 1, clone RP24-315B17, com... 42 1.4
457emb|AL023807.6|HS525L6 Human DNA sequence from clone RP3-525L6 o... 42 1.4
458gb|AC157794.3| Mus musculus chromosome 1, clone RP24-111L14, com... 42 1.4
459gb|AC105487.6| Rattus norvegicus 1 BAC CH230-229J7 (Children's H... 42 1.4
460emb|AL022401.2|HS93L7 Human DNA sequence from clone RP1-93L7 on ... 42 1.4
461emb|BX060250.1|CNS09INI Single read from an extremity of a full-... 42 1.4
462gb|AC079944.17| Homo sapiens 3 BAC RP11-435F17 (Roswell Park Can... 42 1.4
463gb|AC018449.11| Homo sapiens 3 BAC RP11-26G10 (Roswell Park Canc... 42 1.4
464gb|AC112509.4| Homo sapiens 3 BAC RP11-428B17 (Roswell Park Canc... 42 1.4
465emb|BX025322.1|CNS08RPA Single read from an extremity of a full-... 42 1.4
466emb|BX018512.1|CNS08MG4 Single read from an extremity of a full-... 42 1.4
467emb|BX016485.1|CNS08KVT Single read from an extremity of a full-... 42 1.4
468emb|BX015267.1|CNS08JXZ Single read from an extremity of a full-... 42 1.4
469emb|BX014983.1|CNS08JQ3 Single read from an extremity of a full-... 42 1.4
470emb|BX011329.1|CNS08GWL Single read from an extremity of a full-... 42 1.4
471emb|BX009796.1|CNS08FQ0 Single read from an extremity of a full-... 42 1.4
472gb|AC112162.8| Mus Musculus chromosome 9 BAC clone MGS1-296M6 ES... 42 1.4
473emb|BX007190.1|CNS08DPM Single read from an extremity of a full-... 42 1.4
474emb|BX005733.1|CNS08CL5 Single read from an extremity of a full-... 42 1.4
475gb|AC103688.4| Homo sapiens chromosome 8, clone CTD-3046C4, comp... 42 1.4
476gb|AC164556.2| Mus musculus BAC clone RP23-334L9 from chromosome... 42 1.4
477gb|AC161576.7| Mus musculus chromosome 8, clone RP24-315L4, comp... 42 1.4
478gb|AC156546.7| Mus musculus chromosome 18, clone RP23-131O22, co... 42 1.4
479gb|AC162918.3| Mus musculus BAC clone RP23-370K14 from chromosom... 42 1.4
480gb|AC177796.2| Mus musculus chromosome 3, clone wi1-1134L22, com... 42 1.4
481gb|AC157360.9| Mus musculus chromosome 8, clone RP23-420E22, com... 42 1.4
482gb|AC165272.2| Mus musculus BAC clone RP24-296O4 from chromosome... 42 1.4
483gb|AC148836.6| Pan troglodytes BAC clone CH251-2C8 from chromoso... 42 1.4
484emb|AL669842.11| Mouse DNA sequence from clone RP23-25D18 on chr... 42 1.4
485emb|AL596127.12| Mouse DNA sequence from clone RP23-297J14 on ch... 42 1.4
486emb|AL645587.9| Mouse DNA sequence from clone RP23-171O15 on chr... 42 1.4
487emb|AL589701.9| Mouse DNA sequence from clone RP23-202F3 on chro... 42 1.4
488gb|AC102791.15| Mus musculus chromosome 3, clone RP23-278C9, com... 42 1.4
489gb|AC162293.4| Mus musculus chromosome 3, clone RP24-172J1, comp... 42 1.4
490gb|AC158633.7| Mus musculus 10 BAC RP23-407I4 (Roswell Park Canc... 42 1.4
491emb|BX323577.16| Zebrafish DNA sequence from clone CH211-277N6 i... 42 1.4
492emb|AL606508.12| Mouse DNA sequence from clone RP23-180B9 on chr... 42 1.4
493emb|AL731800.11| Mouse DNA sequence from clone RP23-358E7 on chr... 42 1.4
494emb|AL732490.10| Mouse DNA sequence from clone RP23-17C2 on chro... 42 1.4
495emb|AL929371.6| Mouse DNA sequence from clone RP23-176O5 on chro... 42 1.4
496emb|AL731827.6| Mouse DNA sequence from clone RP23-109M24 on chr... 42 1.4
497emb|AL732631.4| Mouse DNA sequence from clone RP23-345P19 on chr... 42 1.4
498emb|AL603913.14| Mouse DNA sequence from clone RP23-103H9 on chr... 42 1.4
499emb|AL590380.9| Mouse DNA sequence from clone RP23-146D23 on chr... 42 1.4
500emb|BX530021.7| Zebrafish DNA sequence from clone CH211-117G3 in... 42 1.4

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score =  258 bits (130), Expect = 1e-65
 Identities = 172/186 (92%)
 Strand = Plus / Minus

                                                                           
Query: 158     ctacttctccgacgagttggggccacgcttcttgccgaagccgacgacggcggtgacgaa 217
               ||||||||| || |||||||| || |||||||||||||| ||||||||||||||||||||
Sbjct: 3655832 ctacttctcggaggagttgggcccgcgcttcttgccgaatccgacgacggcggtgacgaa 3655773

                                                                           
Query: 218     gcggcggttgtactggatgcgcttgtgggcgcggccgcgcggctgcttcttcttgtcctg 277
               ||||||||||||||| || | |||||||||||||||||| |||| |||||||||||||||
Sbjct: 3655772 gcggcggttgtactgcatcctcttgtgggcgcggccgcggggcttcttcttcttgtcctg 3655713

                                                                           
Query: 278     cttcgccaccttgggcgtctggccccgcaccttcccggcacgcgccagcgatccgtgcac 337
               |||||||||||||||||||||||| |||||||||||||| || || ||||||||||||||
Sbjct: 3655712 cttcgccaccttgggcgtctggccgcgcaccttcccggcgcgagcgagcgatccgtgcac 3655653

                     
Query: 338     cttacc 343
               ||||||
Sbjct: 3655652 cttacc 3655647



to top

>dbj|AP002854.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBa0014B15
          Length = 158821

 Score =  258 bits (130), Expect = 1e-65
 Identities = 172/186 (92%)
 Strand = Plus / Minus

                                                                         
Query: 158   ctacttctccgacgagttggggccacgcttcttgccgaagccgacgacggcggtgacgaa 217
             ||||||||| || |||||||| || |||||||||||||| ||||||||||||||||||||
Sbjct: 50060 ctacttctcggaggagttgggcccgcgcttcttgccgaatccgacgacggcggtgacgaa 50001

                                                                         
Query: 218   gcggcggttgtactggatgcgcttgtgggcgcggccgcgcggctgcttcttcttgtcctg 277
             ||||||||||||||| || | |||||||||||||||||| |||| |||||||||||||||
Sbjct: 50000 gcggcggttgtactgcatcctcttgtgggcgcggccgcggggcttcttcttcttgtcctg 49941

                                                                         
Query: 278   cttcgccaccttgggcgtctggccccgcaccttcccggcacgcgccagcgatccgtgcac 337
             |||||||||||||||||||||||| |||||||||||||| || || ||||||||||||||
Sbjct: 49940 cttcgccaccttgggcgtctggccgcgcaccttcccggcgcgagcgagcgatccgtgcac 49881

                   
Query: 338   cttacc 343
             ||||||
Sbjct: 49880 cttacc 49875



to top

>dbj|AK060583.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-023-H06, full
           insert sequence
          Length = 1094

 Score =  258 bits (130), Expect = 1e-65
 Identities = 175/190 (92%)
 Strand = Plus / Minus

                                                                       
Query: 158 ctacttctccgacgagttggggccacgcttcttgccgaagccgacgacggcggtgacgaa 217
           ||||||||| || |||||||| || |||||||||||||| |||||| |||||||||||||
Sbjct: 832 ctacttctcggaggagttgggcccgcgcttcttgccgaatccgacggcggcggtgacgaa 773

                                                                       
Query: 218 gcggcggttgtactggatgcgcttgtgggcgcggccgcgcggctgcttcttcttgtcctg 277
           ||||||||||||||| || | |||||||||||||||||| |||| |||||||||||||||
Sbjct: 772 gcggcggttgtactgcatcctcttgtgggcgcggccgcggggcttcttcttcttgtcctg 713

                                                                       
Query: 278 cttcgccaccttgggcgtctggccccgcaccttcccggcacgcgccagcgatccgtgcac 337
           |||||||||||||||||||||||| |||||||||||||| || || ||||||||||||||
Sbjct: 712 cttcgccaccttgggcgtctggccgcgcaccttcccggcgcgagcgagcgatccgtgcac 653

                     
Query: 338 cttacccatg 347
           ||||||||||
Sbjct: 652 cttacccatg 643



to top

>gb|AY106443.1| Zea mays PCO068394 mRNA sequence
          Length = 667

 Score =  254 bits (128), Expect = 2e-64
 Identities = 176/192 (91%)
 Strand = Plus / Minus

                                                                       
Query: 158 ctacttctccgacgagttggggccacgcttcttgccgaagccgacgacggcggtgacgaa 217
           ||||||||| || |||||||| || |||||||||||||||||||||||||||||||||||
Sbjct: 243 ctacttctcggaggagttgggcccgcgcttcttgccgaagccgacgacggcggtgacgaa 184

                                                                       
Query: 218 gcggcggttgtactggatgcgcttgtgggcgcggccgcgcggctgcttcttcttgtcctg 277
           ||||||||||||||| || | |||||| ||||||||||| |||| |||||||||||||||
Sbjct: 183 gcggcggttgtactgcatcctcttgtgcgcgcggccgcggggcttcttcttcttgtcctg 124

                                                                       
Query: 278 cttcgccaccttgggcgtctggccccgcaccttcccggcacgcgccagcgatccgtgcac 337
           ||||||||||||||| ||||| || || ||||||||||| ||||||| ||||||||||||
Sbjct: 123 cttcgccaccttgggggtctgcccgcggaccttcccggcgcgcgccaacgatccgtgcac 64

                       
Query: 338 cttacccatggc 349
           ||||||||||||
Sbjct: 63  cttacccatggc 52



to top

>gb|BT017988.1| Zea mays clone EL01N0526A01.c mRNA sequence
          Length = 556

 Score =  246 bits (124), Expect = 5e-62
 Identities = 175/192 (91%)
 Strand = Plus / Minus

                                                                       
Query: 158 ctacttctccgacgagttggggccacgcttcttgccgaagccgacgacggcggtgacgaa 217
           ||||||||| || |||||||| || |||||||||||||| ||||||||||||||||||||
Sbjct: 243 ctacttctcggaggagttgggcccgcgcttcttgccgaaaccgacgacggcggtgacgaa 184

                                                                       
Query: 218 gcggcggttgtactggatgcgcttgtgggcgcggccgcgcggctgcttcttcttgtcctg 277
           ||||||||||||||| || | |||||| ||||||||||| |||| |||||||||||||||
Sbjct: 183 gcggcggttgtactgcatcctcttgtgcgcgcggccgcggggcttcttcttcttgtcctg 124

                                                                       
Query: 278 cttcgccaccttgggcgtctggccccgcaccttcccggcacgcgccagcgatccgtgcac 337
           ||||||||||||||| ||||| || || ||||||||||| ||||||| ||||||||||||
Sbjct: 123 cttcgccaccttgggggtctgcccgcggaccttcccggcgcgcgccaacgatccgtgcac 64

                       
Query: 338 cttacccatggc 349
           ||||||||||||
Sbjct: 63  cttacccatggc 52



to top

>gb|AY108153.1| Zea mays PCO068393 mRNA sequence
          Length = 570

 Score =  242 bits (122), Expect = 8e-61
 Identities = 170/186 (91%)
 Strand = Plus / Minus

                                                                       
Query: 158 ctacttctccgacgagttggggccacgcttcttgccgaagccgacgacggcggtgacgaa 217
           |||||||||||| ||||||||||| || ||||||||||| ||||||||||||||||||||
Sbjct: 375 ctacttctccgaggagttggggccgcgtttcttgccgaatccgacgacggcggtgacgaa 316

                                                                       
Query: 218 gcggcggttgtactggatgcgcttgtgggcgcggccgcgcggctgcttcttcttgtcctg 277
           ||||||||||||||| ||||||||||  ||||||||||| |||| |||||||||||||||
Sbjct: 315 gcggcggttgtactgcatgcgcttgtacgcgcggccgcggggcttcttcttcttgtcctg 256

                                                                       
Query: 278 cttcgccaccttgggcgtctggccccgcaccttcccggcacgcgccagcgatccgtgcac 337
           ||||||||||||||||||||| || ||||||||||| || || || ||||||||||| ||
Sbjct: 255 cttcgccaccttgggcgtctgcccacgcaccttccccgcgcgggcaagcgatccgtgaac 196

                 
Query: 338 cttacc 343
           ||||||
Sbjct: 195 cttacc 190



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  226 bits (114), Expect = 5e-56
 Identities = 168/186 (90%)
 Strand = Plus / Plus

                                                                            
Query: 158      ctacttctccgacgagttggggccacgcttcttgccgaagccgacgacggcggtgacgaa 217
                ||||||||| || ||||| || || |||||||||||||||||||||||||||||||||||
Sbjct: 34314578 ctacttctcggaggagtttggcccgcgcttcttgccgaagccgacgacggcggtgacgaa 34314637

                                                                            
Query: 218      gcggcggttgtactggatgcgcttgtgggcgcggccgcgcggctgcttcttcttgtcctg 277
                 |||||||||||||| || ||||||||||||||||| || |||| |||||||||||||||
Sbjct: 34314638 acggcggttgtactgcatccgcttgtgggcgcggccccggggcttcttcttcttgtcctg 34314697

                                                                            
Query: 278      cttcgccaccttgggcgtctggccccgcaccttcccggcacgcgccagcgatccgtgcac 337
                |||||||||||| |||||||| |||| |||||||||||| || |||||||| ||||| ||
Sbjct: 34314698 cttcgccaccttcggcgtctgccccctcaccttcccggcgcgagccagcgagccgtgaac 34314757

                      
Query: 338      cttacc 343
                ||||||
Sbjct: 34314758 cttacc 34314763



to top

>dbj|AP004240.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1548_F12
          Length = 118814

 Score =  226 bits (114), Expect = 5e-56
 Identities = 168/186 (90%)
 Strand = Plus / Plus

                                                                         
Query: 158   ctacttctccgacgagttggggccacgcttcttgccgaagccgacgacggcggtgacgaa 217
             ||||||||| || ||||| || || |||||||||||||||||||||||||||||||||||
Sbjct: 12225 ctacttctcggaggagtttggcccgcgcttcttgccgaagccgacgacggcggtgacgaa 12284

                                                                         
Query: 218   gcggcggttgtactggatgcgcttgtgggcgcggccgcgcggctgcttcttcttgtcctg 277
              |||||||||||||| || ||||||||||||||||| || |||| |||||||||||||||
Sbjct: 12285 acggcggttgtactgcatccgcttgtgggcgcggccccggggcttcttcttcttgtcctg 12344

                                                                         
Query: 278   cttcgccaccttgggcgtctggccccgcaccttcccggcacgcgccagcgatccgtgcac 337
             |||||||||||| |||||||| |||| |||||||||||| || |||||||| ||||| ||
Sbjct: 12345 cttcgccaccttcggcgtctgccccctcaccttcccggcgcgagccagcgagccgtgaac 12404

                   
Query: 338   cttacc 343
             ||||||
Sbjct: 12405 cttacc 12410



to top

>dbj|AP005056.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0689B12
          Length = 154745

 Score =  226 bits (114), Expect = 5e-56
 Identities = 168/186 (90%)
 Strand = Plus / Plus

                                                                          
Query: 158    ctacttctccgacgagttggggccacgcttcttgccgaagccgacgacggcggtgacgaa 217
              ||||||||| || ||||| || || |||||||||||||||||||||||||||||||||||
Sbjct: 149851 ctacttctcggaggagtttggcccgcgcttcttgccgaagccgacgacggcggtgacgaa 149910

                                                                          
Query: 218    gcggcggttgtactggatgcgcttgtgggcgcggccgcgcggctgcttcttcttgtcctg 277
               |||||||||||||| || ||||||||||||||||| || |||| |||||||||||||||
Sbjct: 149911 acggcggttgtactgcatccgcttgtgggcgcggccccggggcttcttcttcttgtcctg 149970

                                                                          
Query: 278    cttcgccaccttgggcgtctggccccgcaccttcccggcacgcgccagcgatccgtgcac 337
              |||||||||||| |||||||| |||| |||||||||||| || |||||||| ||||| ||
Sbjct: 149971 cttcgccaccttcggcgtctgccccctcaccttcccggcgcgagccagcgagccgtgaac 150030

                    
Query: 338    cttacc 343
              ||||||
Sbjct: 150031 cttacc 150036



to top

>dbj|AP006400.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT22I23, TM0281b,
             complete sequence
          Length = 48187

 Score =  149 bits (75), Expect = 9e-33
 Identities = 123/139 (88%)
 Strand = Plus / Plus

                                                                         
Query: 205   cggcggtgacgaagcggcggttgtactggatgcgcttgtgggcgcggccgcgcggctgct 264
             ||||||||||||| ||||||||||| || ||||||||||| ||||||||||| |||| ||
Sbjct: 39644 cggcggtgacgaatcggcggttgtattgcatgcgcttgtgagcgcggccgcggggcttct 39703

                                                                         
Query: 265   tcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgcca 324
             |||||||||||||||| ||||||||||| || ||||| | ||||||||| ||||| || |
Sbjct: 39704 tcttcttgtcctgcttggccaccttgggagtttggcctctcaccttcccagcacgagcaa 39763

                                
Query: 325   gcgatccgtgcaccttacc 343
             | |||||||| ||||||||
Sbjct: 39764 gagatccgtgaaccttacc 39782



to top

>gb|AY109694.1| Zea mays CL7222_2 mRNA sequence
          Length = 609

 Score =  131 bits (66), Expect = 2e-27
 Identities = 90/98 (91%)
 Strand = Plus / Plus

                                                                       
Query: 158 ctacttctccgacgagttggggccacgcttcttgccgaagccgacgacggcggtgacgaa 217
           |||||||||||| ||||||||||| |||||||||||||| || || ||||||||||||||
Sbjct: 275 ctacttctccgatgagttggggccgcgcttcttgccgaatccaacaacggcggtgacgaa 334

                                                 
Query: 218 gcggcggttgtactggatgcgcttgtgggcgcggccgc 255
           |||||||||||| || ||||||||||| ||||||||||
Sbjct: 335 gcggcggttgtattgcatgcgcttgtgagcgcggccgc 372



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 59/65 (90%)
 Strand = Plus / Plus

                                                                       
Query: 285 accttgggcgtctggccccgcaccttcccggcacgcgccagcgatccgtgcaccttaccc 344
           |||||||||||||| || ||||||||||| || || |||||||||||||| |||||||||
Sbjct: 402 accttgggcgtctgcccgcgcaccttcccagcgcgggccagcgatccgtgaaccttaccc 461

                
Query: 345 atggc 349
           |||||
Sbjct: 462 atggc 466



to top

>ref|NM_127533.1| Arabidopsis thaliana structural constituent of ribosome AT2G19750
           mRNA, complete cds
          Length = 189

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 152/189 (80%)
 Strand = Plus / Minus

                                                                       
Query: 158 ctacttctccgacgagttggggccacgcttcttgccgaagccgacgacggcggtgacgaa 217
           ||||||||| || ||||| || || | ||||||||| || || || ||||||||||||||
Sbjct: 189 ctacttctctgatgagtttggtcctctcttcttgccaaaaccaacaacggcggtgacgaa 130

                                                                       
Query: 218 gcggcggttgtactggatgcgcttgtgggcgcggccgcgcggctgcttcttcttgtcctg 277
            ||||||||||  || |  ||||| || || || || || |||| |||||||||||||||
Sbjct: 129 acggcggttgtgttgcagacgcttatgagcacgaccacgaggcttcttcttcttgtcctg 70

                                                                       
Query: 278 cttcgccaccttgggcgtctggccccgcaccttcccggcacgcgccagcgatccgtgcac 337
           ||| ||||| || || ||||| || | |||||| |||||||| ||||  || ||||| ||
Sbjct: 69  cttagccactttaggtgtctgacctctcaccttaccggcacgagccaatgaaccgtggac 10

                    
Query: 338 cttacccat 346
           ||| |||||
Sbjct: 9   ctttcccat 1



to top

>gb|AC007772.6| Drosophila melanogaster clone BACR19P12, complete sequence
          Length = 186607

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                          
Query: 263    cttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgc 322
              ||||||||| ||||||||| |||||||||||||||| |||   ||||| |||||||| ||
Sbjct: 135516 cttcttcttctcctgcttctccaccttgggcgtctgtcccttgaccttgccggcacgggc 135457

                                   
Query: 323    cagcgatccgtgcaccttacc 343
              ||| || ||||||||||||||
Sbjct: 135456 cagagaaccgtgcaccttacc 135436



to top

>emb|CR931740.2| Medicago truncatula chromosome 5 clone mth2-67g10, COMPLETE SEQUENCE
          Length = 153273

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 113/137 (82%)
 Strand = Plus / Plus

                                                                          
Query: 207    gcggtgacgaagcggcggttgtactggatgcgcttgtgggcgcggccgcgcggctgcttc 266
              ||||||||||| | ||| |||||||| || |||||||| || ||||| || |||||||||
Sbjct: 139058 gcggtgacgaatctgcgattgtactgcatacgcttgtgagcacggccacggggctgcttc 139117

                                                                          
Query: 267    ttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgccagc 326
              |||||||| ||||| || |||||||| || || ||||  || || |||||||| ||||  
Sbjct: 139118 ttcttgtcttgcttagctaccttgggtgtttgtcccctaactttaccggcacgggccaat 139177

                               
Query: 327    gatccgtgcaccttacc 343
              || ||||| ||||||||
Sbjct: 139178 gaaccgtgaaccttacc 139194



to top

>gb|AY071683.2| Drosophila melanogaster RH08962 full insert cDNA
          Length = 547

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 263 cttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgc 322
           ||||||||| ||||||||| |||||||||||||||| |||   ||||| |||||||| ||
Sbjct: 341 cttcttcttctcctgcttctccaccttgggcgtctgtcccttgaccttgccggcacgggc 282

                                
Query: 323 cagcgatccgtgcaccttacc 343
           ||| || ||||||||||||||
Sbjct: 281 cagagaaccgtgcaccttacc 261



to top

>ref|NM_169933.1| Drosophila melanogaster Ribosomal protein S30 CG15697-RB,
           transcript variant B (RpS30), mRNA
          Length = 500

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 263 cttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgc 322
           ||||||||| ||||||||| |||||||||||||||| |||   ||||| |||||||| ||
Sbjct: 312 cttcttcttctcctgcttctccaccttgggcgtctgtcccttgaccttgccggcacgggc 253

                                
Query: 323 cagcgatccgtgcaccttacc 343
           ||| || ||||||||||||||
Sbjct: 252 cagagaaccgtgcaccttacc 232



to top

>ref|NM_142665.1| Drosophila melanogaster Ribosomal protein S30 CG15697-RA,
           transcript variant A (RpS30), mRNA
          Length = 572

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                       
Query: 263 cttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgc 322
           ||||||||| ||||||||| |||||||||||||||| |||   ||||| |||||||| ||
Sbjct: 384 cttcttcttctcctgcttctccaccttgggcgtctgtcccttgaccttgccggcacgggc 325

                                
Query: 323 cagcgatccgtgcaccttacc 343
           ||| || ||||||||||||||
Sbjct: 324 cagagaaccgtgcaccttacc 304



to top

>gb|AY061910.1| Arabidopsis thaliana At2g19750/F6F22.22 mRNA, complete cds
          Length = 189

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 152/189 (80%)
 Strand = Plus / Minus

                                                                       
Query: 158 ctacttctccgacgagttggggccacgcttcttgccgaagccgacgacggcggtgacgaa 217
           ||||||||| || ||||| || || | ||||||||| || || || ||||||||||||||
Sbjct: 189 ctacttctctgatgagtttggtcctctcttcttgccaaaaccaacaacggcggtgacgaa 130

                                                                       
Query: 218 gcggcggttgtactggatgcgcttgtgggcgcggccgcgcggctgcttcttcttgtcctg 277
            ||||||||||  || |  ||||| || || || || || |||| |||||||||||||||
Sbjct: 129 acggcggttgtgttgcagacgcttatgagcacgaccacgaggcttcttcttcttgtcctg 70

                                                                       
Query: 278 cttcgccaccttgggcgtctggccccgcaccttcccggcacgcgccagcgatccgtgcac 337
           ||| ||||| || || ||||| || | |||||| |||||||| ||||  || ||||| ||
Sbjct: 69  cttagccactttaggtgtctgacctctcaccttaccggcacgagccaatgaaccgtggac 10

                    
Query: 338 cttacccat 346
           ||| |||||
Sbjct: 9   ctttcccat 1



to top

>gb|AY052341.1| Arabidopsis thaliana At2g19750/F6F22.22 mRNA, complete cds
          Length = 552

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 152/189 (80%)
 Strand = Plus / Minus

                                                                       
Query: 158 ctacttctccgacgagttggggccacgcttcttgccgaagccgacgacggcggtgacgaa 217
           ||||||||| || ||||| || || | ||||||||| || || || ||||||||||||||
Sbjct: 268 ctacttctctgatgagtttggtcctctcttcttgccaaaaccaacaacggcggtgacgaa 209

                                                                       
Query: 218 gcggcggttgtactggatgcgcttgtgggcgcggccgcgcggctgcttcttcttgtcctg 277
            ||||||||||  || |  ||||| || || || || || |||| |||||||||||||||
Sbjct: 208 acggcggttgtgttgcagacgcttatgagcacgaccacgaggcttcttcttcttgtcctg 149

                                                                       
Query: 278 cttcgccaccttgggcgtctggccccgcaccttcccggcacgcgccagcgatccgtgcac 337
           ||| ||||| || || ||||| || | |||||| |||||||| ||||  || ||||| ||
Sbjct: 148 cttagccactttaggtgtctgacctctcaccttaccggcacgagccaatgaaccgtggac 89

                    
Query: 338 cttacccat 346
           ||| |||||
Sbjct: 88  ctttcccat 80



to top

>emb|BX822051.1|CNS0AA4U Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL94ZE07 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 547

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 152/189 (80%)
 Strand = Plus / Minus

                                                                       
Query: 158 ctacttctccgacgagttggggccacgcttcttgccgaagccgacgacggcggtgacgaa 217
           ||||||||| || ||||| || || | ||||||||| || || || ||||||||||||||
Sbjct: 253 ctacttctctgatgagtttggtcctctcttcttgccaaaaccaacaacggcggtgacgaa 194

                                                                       
Query: 218 gcggcggttgtactggatgcgcttgtgggcgcggccgcgcggctgcttcttcttgtcctg 277
            ||||||||||  || |  ||||| || || || || || |||| |||||||||||||||
Sbjct: 193 acggcggttgtgttgcagacgcttatgagcacgaccacgaggcttcttcttcttgtcctg 134

                                                                       
Query: 278 cttcgccaccttgggcgtctggccccgcaccttcccggcacgcgccagcgatccgtgcac 337
           ||| ||||| || || ||||| || | |||||| |||||||| ||||  || ||||| ||
Sbjct: 133 cttagccactttaggtgtctgacctctcaccttaccggcacgagccaatgaaccgtggac 74

                    
Query: 338 cttacccat 346
           ||| |||||
Sbjct: 73  ctttcccat 65



to top

>gb|AY088766.1| Arabidopsis thaliana clone 9466 mRNA, complete sequence
          Length = 516

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 152/189 (80%)
 Strand = Plus / Minus

                                                                       
Query: 158 ctacttctccgacgagttggggccacgcttcttgccgaagccgacgacggcggtgacgaa 217
           ||||||||| || ||||| || || | ||||||||| || || || ||||||||||||||
Sbjct: 272 ctacttctctgatgagtttggtcctctcttcttgccaaaaccaacaacggcggtgacgaa 213

                                                                       
Query: 218 gcggcggttgtactggatgcgcttgtgggcgcggccgcgcggctgcttcttcttgtcctg 277
            ||||||||||  || |  ||||| || || || || || |||| |||||||||||||||
Sbjct: 212 acggcggttgtgttgcagacgcttatgagcacgaccacgaggcttcttcttcttgtcctg 153

                                                                       
Query: 278 cttcgccaccttgggcgtctggccccgcaccttcccggcacgcgccagcgatccgtgcac 337
           ||| ||||| || || ||||| || | |||||| |||||||| ||||  || ||||| ||
Sbjct: 152 cttagccactttaggtgtctgacctctcaccttaccggcacgagccaatgaaccgtggac 93

                    
Query: 338 cttacccat 346
           ||| |||||
Sbjct: 92  ctttcccat 84



to top

>gb|AE003732.3| Drosophila melanogaster chromosome 3R, section 70 of 118 of the
             complete sequence
          Length = 224529

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                         
Query: 263   cttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgc 322
             ||||||||| ||||||||| |||||||||||||||| |||   ||||| |||||||| ||
Sbjct: 97540 cttcttcttctcctgcttctccaccttgggcgtctgtcccttgaccttgccggcacgggc 97481

                                  
Query: 323   cagcgatccgtgcaccttacc 343
             ||| || ||||||||||||||
Sbjct: 97480 cagagaaccgtgcaccttacc 97460



to top

>ref|NM_119084.2| Arabidopsis thaliana structural constituent of ribosome AT4G29390
           mRNA, complete cds
          Length = 495

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 152/190 (80%)
 Strand = Plus / Minus

                                                                       
Query: 158 ctacttctccgacgagttggggccacgcttcttgccgaagccgacgacggcggtgacgaa 217
           ||||||||| || |||||||| || | ||||||||| || || || |||||||| |||||
Sbjct: 270 ctacttctcagaagagttgggtcctctcttcttgccaaatccaacaacggcggttacgaa 211

                                                                       
Query: 218 gcggcggttgtactggatgcgcttgtgggcgcggccgcgcggctgcttcttcttgtcctg 277
            ||||| ||||  || |  |  ||||| || ||||| || |||| ||||||||| |||||
Sbjct: 210 acggcgattgtgttgcaaccttttgtgagcacggccacgtggcttcttcttcttatcctg 151

                                                                       
Query: 278 cttcgccaccttgggcgtctggccccgcaccttcccggcacgcgccagcgatccgtgcac 337
           ||| ||||| || || ||||| || | |||||| |||||||| ||||  || ||||| ||
Sbjct: 150 ctttgccactttcggtgtctgacctctcaccttaccggcacgagccaaggaaccgtgtac 91

                     
Query: 338 cttacccatg 347
           ||||||||||
Sbjct: 90  cttacccatg 81



to top

>gb|BT012137.1| Arabidopsis thaliana At4g29390 mRNA, complete cds
          Length = 237

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 152/190 (80%)
 Strand = Plus / Plus

                                                                       
Query: 158 ctacttctccgacgagttggggccacgcttcttgccgaagccgacgacggcggtgacgaa 217
           ||||||||| || |||||||| || | ||||||||| || || || |||||||| |||||
Sbjct: 25  ctacttctcagaagagttgggtcctctcttcttgccaaatccaacaacggcggttacgaa 84

                                                                       
Query: 218 gcggcggttgtactggatgcgcttgtgggcgcggccgcgcggctgcttcttcttgtcctg 277
            ||||| ||||  || |  |  ||||| || ||||| || |||| ||||||||| |||||
Sbjct: 85  acggcgattgtgttgcaaccttttgtgagcacggccacgtggcttcttcttcttatcctg 144

                                                                       
Query: 278 cttcgccaccttgggcgtctggccccgcaccttcccggcacgcgccagcgatccgtgcac 337
           ||| ||||| || || ||||| || | |||||| |||||||| ||||  || ||||| ||
Sbjct: 145 ctttgccactttcggtgtctgacctctcaccttaccggcacgagccaaggaaccgtgtac 204

                     
Query: 338 cttacccatg 347
           ||||||||||
Sbjct: 205 cttacccatg 214



to top

>gb|BT011203.1| Arabidopsis thaliana At4g29390 gene, complete cds
          Length = 390

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 152/190 (80%)
 Strand = Plus / Plus

                                                                       
Query: 158 ctacttctccgacgagttggggccacgcttcttgccgaagccgacgacggcggtgacgaa 217
           ||||||||| || |||||||| || | ||||||||| || || || |||||||| |||||
Sbjct: 142 ctacttctcagaagagttgggtcctctcttcttgccaaatccaacaacggcggttacgaa 201

                                                                       
Query: 218 gcggcggttgtactggatgcgcttgtgggcgcggccgcgcggctgcttcttcttgtcctg 277
            ||||| ||||  || |  |  ||||| || ||||| || |||| ||||||||| |||||
Sbjct: 202 acggcgattgtgttgcaaccttttgtgagcacggccacgtggcttcttcttcttatcctg 261

                                                                       
Query: 278 cttcgccaccttgggcgtctggccccgcaccttcccggcacgcgccagcgatccgtgcac 337
           ||| ||||| || || ||||| || | |||||| |||||||| ||||  || ||||| ||
Sbjct: 262 ctttgccactttcggtgtctgacctctcaccttaccggcacgagccaaggaaccgtgtac 321

                     
Query: 338 cttacccatg 347
           ||||||||||
Sbjct: 322 cttacccatg 331



to top

>emb|BX828921.1|CNS0A2HH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL51ZA04 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 438

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 152/190 (80%)
 Strand = Plus / Minus

                                                                       
Query: 158 ctacttctccgacgagttggggccacgcttcttgccgaagccgacgacggcggtgacgaa 217
           ||||||||| || |||||||| || | ||||||||| || || || |||||||| |||||
Sbjct: 236 ctacttctcagaagagttgggtcctctcttcttgccaaatccaacaacggcggttacgaa 177

                                                                       
Query: 218 gcggcggttgtactggatgcgcttgtgggcgcggccgcgcggctgcttcttcttgtcctg 277
            ||||| ||||  || |  |  ||||| || ||||| || |||| ||||||||| |||||
Sbjct: 176 acggcgattgtgttgcaaccttttgtgagcacggccacgtggcttcttcttcttatcctg 117

                                                                       
Query: 278 cttcgccaccttgggcgtctggccccgcaccttcccggcacgcgccagcgatccgtgcac 337
           ||| ||||| || || ||||| || | |||||| |||||||| ||||  || ||||| ||
Sbjct: 116 ctttgccactttcggtgtctgacctctcaccttaccggcacgagccaaggaaccgtgtac 57

                     
Query: 338 cttacccatg 347
           ||||||||||
Sbjct: 56  cttacccatg 47



to top

>gb|AY232248.1| Drosophila yakuba clone yak-ad_CG15697 mRNA sequence
          Length = 396

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                       
Query: 263 cttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgc 322
           ||||||||| ||||||||| | |||||||||||||| |||   ||||| |||||||| ||
Sbjct: 294 cttcttcttctcctgcttctctaccttgggcgtctgtcccttgaccttgccggcacgggc 235

                                
Query: 323 cagcgatccgtgcaccttacc 343
           ||| || ||||||||||||||
Sbjct: 234 cagagaaccgtgcaccttacc 214



to top

>gb|AY231796.1| Drosophila yakuba clone yak-em_CG15697 mRNA sequence
          Length = 396

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 70/81 (86%)
 Strand = Plus / Minus

                                                                       
Query: 263 cttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgc 322
           ||||||||| ||||||||| | |||||||||||||| |||   ||||| |||||||| ||
Sbjct: 294 cttcttcttctcctgcttctctaccttgggcgtctgtcccttgaccttgccggcacgggc 235

                                
Query: 323 cagcgatccgtgcaccttacc 343
           ||| || ||||||||||||||
Sbjct: 234 cagagaaccgtgcaccttacc 214



to top

>emb|BX821809.1|CNS0A8DZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL76ZD07 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 583

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 151/189 (79%)
 Strand = Plus / Minus

                                                                       
Query: 158 ctacttctccgacgagttggggccacgcttcttgccgaagccgacgacggcggtgacgaa 217
           ||||||||| || ||||| || || | ||||||||| || || || ||||||||||||||
Sbjct: 251 ctacttctctgatgagtttggtcctctcttcttgccaaaaccaacaacggcggtgacgaa 192

                                                                       
Query: 218 gcggcggttgtactggatgcgcttgtgggcgcggccgcgcggctgcttcttcttgtcctg 277
            ||||||||||  || |  ||||| |  || || || || |||| |||||||||||||||
Sbjct: 191 acggcggttgtgttgcagacgcttattagcacgaccacgaggcttcttcttcttgtcctg 132

                                                                       
Query: 278 cttcgccaccttgggcgtctggccccgcaccttcccggcacgcgccagcgatccgtgcac 337
           ||| ||||| || || ||||| || | |||||| |||||||| ||||  || ||||| ||
Sbjct: 131 cttagccactttaggtgtctgacctctcaccttaccggcacgagccaatgaaccgtggac 72

                    
Query: 338 cttacccat 346
           ||| |||||
Sbjct: 71  ctttcccat 63



to top

>gb|DQ066328.1| Ixodes scapularis isolate IS-6-12L-102 40S ribosomal protein S30
           mRNA, complete cds
          Length = 405

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 113/139 (81%)
 Strand = Plus / Minus

                                                                       
Query: 202 cgacggcggtgacgaagcggcggttgtactggatgcgcttgtgggcgcggccgcgcggct 261
           |||||||| |||||||||| | |||||||||||||||| | | ||| || |||  |  ||
Sbjct: 358 cgacggcgttgacgaagcgcctgttgtactggatgcgcctcttggcacgcccggtcttct 299

                                                                       
Query: 262 gcttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcg 321
            ||||||||| ||||||||  ||||||| || ||||| |||  |||||| |||||||| |
Sbjct: 298 tcttcttcttctcctgcttgtccacctttggtgtctgtcccttcacctttccggcacgag 239

                              
Query: 322 ccagcgatccgtgcacctt 340
           | || |||||||| |||||
Sbjct: 238 cgagagatccgtggacctt 220



to top

>emb|BX819364.1|CNS0AA8V Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB71ZF10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 536

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 130/162 (80%)
 Strand = Plus / Minus

                                                                       
Query: 185 cttcttgccgaagccgacgacggcggtgacgaagcggcggttgtactggatgcgcttgtg 244
           ||||||||| || || || |||||||||||||| ||||||||||  || |  ||||| ||
Sbjct: 215 cttcttgccaaaaccaacaacggcggtgacgaaacggcggttgtgttgtagacgcttatg 156

                                                                       
Query: 245 ggcgcggccgcgcggctgcttcttcttgtcctgcttcgccaccttgggcgtctggccccg 304
            || || || || |||| |||||||||||||||||| ||||| || || ||||| |  | 
Sbjct: 155 agcacgaccacgaggcttcttcttcttgtcctgcttagccactttaggtgtctgacttct 96

                                                     
Query: 305 caccttcccggcacgcgccagcgatccgtgcaccttacccat 346
           |||||| |||||||| ||||  || ||||| ||||| |||||
Sbjct: 95  caccttaccggcacgagccaatgaaccgtggacctttcccat 54



to top

>gb|AY357069.1| Hippocampus comes 40S ribosomal protein S30 mRNA, complete cds
          Length = 542

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 108/133 (81%)
 Strand = Plus / Minus

                                                                       
Query: 211 tgacgaagcggcggttgtactggatgcgcttgtgggcgcggccgcgcggctgcttcttct 270
           |||||||||| |||||||||||||||||    | |||||||||   |  || ||||||||
Sbjct: 382 tgacgaagcgtcggttgtactggatgcgacgcttggcgcggccagtcttcttcttcttct 323

                                                                       
Query: 271 tgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgccagcgatc 330
           | ||||||||  |||||||||| |||||||| | ||| || || ||||| ||||| || |
Sbjct: 322 tctcctgcttatccaccttgggggtctggcctctcacttttccagcacgggccagagagc 263

                        
Query: 331 cgtgcaccttacc 343
           |||| ||||||||
Sbjct: 262 cgtggaccttacc 250



to top

>gb|AC138087.17| Medicago truncatula clone mth2-22p8, complete sequence
          Length = 130194

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                         
Query: 205   cggcggtgacgaagcggcggttgtactggatgcgcttgtgggcgcggccgcgcggctgct 264
             ||||||||||||| ||||| ||||| || || |||||||| || || || || |||||||
Sbjct: 18053 cggcggtgacgaaacggcgattgtattgcatacgcttgtgagcacgtccacgtggctgct 17994

                             
Query: 265   tcttcttgtcctgctt 280
             |||||||||| |||||
Sbjct: 17993 tcttcttgtcttgctt 17978



to top

>gb|AC005169.3| Arabidopsis thaliana chromosome 2 clone F6F22 map mi148, complete
              sequence
          Length = 126386

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 98/120 (81%)
 Strand = Plus / Plus

                                                                          
Query: 205    cggcggtgacgaagcggcggttgtactggatgcgcttgtgggcgcggccgcgcggctgct 264
              ||||||||||||| ||||||||||  || |  ||||| || || || || || |||| ||
Sbjct: 108104 cggcggtgacgaaacggcggttgtgttgcagacgcttatgagcacgaccacgaggcttct 108163

                                                                          
Query: 265    tcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgcca 324
              |||||||||||||||| ||||| || || ||||| || | |||||| |||||||| ||||
Sbjct: 108164 tcttcttgtcctgcttagccactttaggtgtctgacctctcaccttaccggcacgagcca 108223



to top

>gb|CP000069.1| Trypanosoma brucei chromosome 6, complete sequence
          Length = 1618915

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 75/90 (83%)
 Strand = Plus / Plus

                                                                          
Query: 258    ggctgcttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggca 317
              |||||||||||||| ||||||||    ||||| |||||||||     |||||| ||||||
Sbjct: 679611 ggctgcttcttcttctcctgcttgctaaccttcggcgtctggtttttcaccttgccggca 679670

                                            
Query: 318    cgcgccagcgatccgtgcaccttacccatg 347
              || |||||||||||||| ||||| ||||||
Sbjct: 679671 cgggccagcgatccgtggaccttccccatg 679700



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 73/89 (82%)
 Strand = Plus / Plus

                                                                          
Query: 258    ggctgcttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggca 317
              |||||||||||||| ||||||||    ||||| |||||||||     |||||| ||||| 
Sbjct: 679145 ggctgcttcttcttctcctgcttgctaaccttcggcgtctggtttttcaccttgccggcg 679204

                                           
Query: 318    cgcgccagcgatccgtgcaccttacccat 346
              || |||||||||||||| ||||| |||||
Sbjct: 679205 cgggccagcgatccgtggaccttccccat 679233



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 107    aacaagcaaacaaacaaaaaaggagggg 134
              ||||| |||||||||||||||| |||||
Sbjct: 344493 aacaaacaaacaaacaaaaaagaagggg 344520



to top

>gb|AC074259.14| Trypanosoma brucei chromosome 6 clone RPCI93-4M18, complete sequence
          Length = 160865

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 75/90 (83%)
 Strand = Plus / Plus

                                                                         
Query: 258   ggctgcttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggca 317
             |||||||||||||| ||||||||    ||||| |||||||||     |||||| ||||||
Sbjct: 38187 ggctgcttcttcttctcctgcttgctaaccttcggcgtctggtttttcaccttgccggca 38246

                                           
Query: 318   cgcgccagcgatccgtgcaccttacccatg 347
             || |||||||||||||| ||||| ||||||
Sbjct: 38247 cgggccagcgatccgtggaccttccccatg 38276



 Score = 50.1 bits (25), Expect = 0.006
 Identities = 73/89 (82%)
 Strand = Plus / Plus

                                                                         
Query: 258   ggctgcttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggca 317
             |||||||||||||| ||||||||    ||||| |||||||||     |||||| ||||| 
Sbjct: 37721 ggctgcttcttcttctcctgcttgctaaccttcggcgtctggtttttcaccttgccggcg 37780

                                          
Query: 318   cgcgccagcgatccgtgcaccttacccat 346
             || |||||||||||||| ||||| |||||
Sbjct: 37781 cgggccagcgatccgtggaccttccccat 37809



to top

>ref|XM_821669.1| Trypanosoma brucei TREU927 clone RPCI93-4M18 40S ribosomal protein
           S30 (Tb927.6.2110) partial mRNA
          Length = 201

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 74/89 (83%)
 Strand = Plus / Minus

                                                                       
Query: 258 ggctgcttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggca 317
           |||||||||||||| ||||||||    ||||| |||||||||     |||||| ||||||
Sbjct: 89  ggctgcttcttcttctcctgcttgctaaccttcggcgtctggtttttcaccttgccggca 30

                                        
Query: 318 cgcgccagcgatccgtgcaccttacccat 346
           || |||||||||||||| ||||| |||||
Sbjct: 29  cgggccagcgatccgtggaccttccccat 1



to top

>gb|AY674244.1| Ixodes pacificus clone IP_7_60_92_99_CLU 40S ribosomal protein S30
           mRNA, complete cds
          Length = 402

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 202 cgacggcggtgacgaagcggcggttgtactggatgcgc 239
           |||||||| |||||||||| | ||||||||||||||||
Sbjct: 355 cgacggcgttgacgaagcgcctgttgtactggatgcgc 318



to top

>ref|XM_753132.1| Ustilago maydis 521 hypothetical protein (UM02078.1) partial mRNA
          Length = 798

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 306 accttcccggcacgcgccagcgatccgtgcaccttacccat 346
           ||||| ||||||||||| || |||||||| |||||||||||
Sbjct: 41  accttaccggcacgcgcgagggatccgtgaaccttacccat 1



to top

>ref|XM_821618.1| Trypanosoma brucei TREU927 clone RPCI93-4M18 40S ribosomal protein
           S30 (Tb927.6.2100) partial mRNA
          Length = 201

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 73/89 (82%)
 Strand = Plus / Minus

                                                                       
Query: 258 ggctgcttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggca 317
           |||||||||||||| ||||||||    ||||| |||||||||     |||||| ||||| 
Sbjct: 89  ggctgcttcttcttctcctgcttgctaaccttcggcgtctggtttttcaccttgccggcg 30

                                        
Query: 318 cgcgccagcgatccgtgcaccttacccat 346
           || |||||||||||||| ||||| |||||
Sbjct: 29  cgggccagcgatccgtggaccttccccat 1



to top

>emb|BX064327.1|CNS09LSR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 727

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 67/81 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 cttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgc 322
           ||||||||| |||| |||  | ||||||||||| || |||  ||| || |||||||| ||
Sbjct: 382 cttcttcttttccttcttttcgaccttgggcgtttgtcccttcactttgccggcacgggc 323

                                
Query: 323 cagcgatccgtgcaccttacc 343
            ||||| ||||||||||||||
Sbjct: 322 gagcgaaccgtgcaccttacc 302



to top

>emb|BX048818.1|CNS099TY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC24BA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 631

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 67/81 (82%)
 Strand = Plus / Plus

                                                                       
Query: 263 cttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgc 322
           ||||||||| |||| |||  | ||||||||||| || |||  ||| || |||||||| ||
Sbjct: 310 cttcttcttttccttcttttcgaccttgggcgtttgtcccttcactttgccggcacgggc 369

                                
Query: 323 cagcgatccgtgcaccttacc 343
            ||||| ||||||||||||||
Sbjct: 370 gagcgaaccgtgcaccttacc 390



to top

>emb|BX044197.1|CNS0969L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC17CE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 693

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 67/81 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 cttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgc 322
           ||||||||| |||| |||  | ||||||||||| || |||  ||| || |||||||| ||
Sbjct: 352 cttcttcttttccttcttttcgaccttgggcgtttgtcccttcactttgccggcacgggc 293

                                
Query: 323 cagcgatccgtgcaccttacc 343
            ||||| ||||||||||||||
Sbjct: 292 gagcgaaccgtgcaccttacc 272



to top

>emb|BX040902.1|CNS093Q2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC11DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 707

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 67/81 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 cttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgc 322
           ||||||||| |||| |||  | ||||||||||| || |||  ||| || |||||||| ||
Sbjct: 363 cttcttcttttccttcttttcgaccttgggcgtttgtcccttcactttgccggcacgggc 304

                                
Query: 323 cagcgatccgtgcaccttacc 343
            ||||| ||||||||||||||
Sbjct: 303 gagcgaaccgtgcaccttacc 283



to top

>emb|BX034577.1|CNS08YUD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50CB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 441

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 67/81 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 cttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgc 322
           ||||||||| |||| |||  | ||||||||||| || |||  ||| || |||||||| ||
Sbjct: 347 cttcttcttttccttcttttcgaccttgggcgtttgtcccttcactttgccggcacgggc 288

                                
Query: 323 cagcgatccgtgcaccttacc 343
            ||||| ||||||||||||||
Sbjct: 287 gagcgaaccgtgcaccttacc 267



to top

>emb|BX030335.1|CNS08VKJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA45BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 718

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 67/81 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 cttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgc 322
           ||||||||| |||| |||  | ||||||||||| || |||  ||| || |||||||| ||
Sbjct: 355 cttcttcttttccttcttttcgaccttgggcgtttgtcccttcactttgccggcacgggc 296

                                
Query: 323 cagcgatccgtgcaccttacc 343
            ||||| ||||||||||||||
Sbjct: 295 gagcgaaccgtgcaccttacc 275



to top

>emb|BX026461.1|CNS08SKX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4DA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 660

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 67/81 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 cttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgc 322
           ||||||||| |||| |||  | ||||||||||| || |||  ||| || |||||||| ||
Sbjct: 317 cttcttcttttccttcttttcgaccttgggcgtttgtcccttcactttgccggcacgggc 258

                                
Query: 323 cagcgatccgtgcaccttacc 343
            ||||| ||||||||||||||
Sbjct: 257 gagcgaaccgtgcaccttacc 237



to top

>emb|BX025808.1|CNS08S2S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA39CF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 710

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 67/81 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 cttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgc 322
           ||||||||| |||| |||  | ||||||||||| || |||  ||| || |||||||| ||
Sbjct: 374 cttcttcttttccttcttttcgaccttgggcgtttgtcccttcactttgccggcacgggc 315

                                
Query: 323 cagcgatccgtgcaccttacc 343
            ||||| ||||||||||||||
Sbjct: 314 gagcgaaccgtgcaccttacc 294



to top

>emb|BX025321.1|CNS08RP9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA38DC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 549

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 67/81 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 cttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgc 322
           ||||||||| |||| |||  | ||||||||||| || |||  ||| || |||||||| ||
Sbjct: 284 cttcttcttttccttcttttcgaccttgggcgtttgtcccttcactttgccggcacgggc 225

                                
Query: 323 cagcgatccgtgcaccttacc 343
            ||||| ||||||||||||||
Sbjct: 224 gagcgaaccgtgcaccttacc 204



to top

>emb|BX025277.1|CNS08RO1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA38DA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 497

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 67/81 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 cttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgc 322
           ||||||||| |||| |||  | ||||||||||| || |||  ||| || |||||||| ||
Sbjct: 239 cttcttcttttccttcttttcgaccttgggcgtttgtcccttcactttgccggcacgggc 180

                                
Query: 323 cagcgatccgtgcaccttacc 343
            ||||| ||||||||||||||
Sbjct: 179 gagcgaaccgtgcaccttacc 159



to top

>emb|BX024620.1|CNS08R5S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 659

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 67/81 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 cttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgc 322
           ||||||||| |||| |||  | ||||||||||| || |||  ||| || |||||||| ||
Sbjct: 325 cttcttcttttccttcttttcgaccttgggcgtttgtcccttcactttgccggcacgggc 266

                                
Query: 323 cagcgatccgtgcaccttacc 343
            ||||| ||||||||||||||
Sbjct: 265 gagcgaaccgtgcaccttacc 245



to top

>emb|BX015266.1|CNS08JXY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA22DH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 682

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 67/81 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 cttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgc 322
           ||||||||| |||| |||  | ||||||||||| || |||  ||| || |||||||| ||
Sbjct: 350 cttcttcttttccttcttttcgaccttgggcgtttgtcccttcactttgccggcacgggc 291

                                
Query: 323 cagcgatccgtgcaccttacc 343
            ||||| ||||||||||||||
Sbjct: 290 gagcgaaccgtgcaccttacc 270



to top

>emb|BX011328.1|CNS08GWK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA18AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 571

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 67/81 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 cttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgc 322
           ||||||||| |||| |||  | ||||||||||| || |||  ||| || |||||||| ||
Sbjct: 343 cttcttcttttccttcttttcgaccttgggcgtttgtcccttcactttgccggcacgggc 284

                                
Query: 323 cagcgatccgtgcaccttacc 343
            ||||| ||||||||||||||
Sbjct: 283 gagcgaaccgtgcaccttacc 263



to top

>emb|BX009900.1|CNS08FSW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 703

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 67/81 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 cttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgc 322
           ||||||||| |||| |||  | ||||||||||| || |||  ||| || |||||||| ||
Sbjct: 352 cttcttcttttccttcttttcgaccttgggcgtttgtcccttcactttgccggcacgggc 293

                                
Query: 323 cagcgatccgtgcaccttacc 343
            ||||| ||||||||||||||
Sbjct: 292 gagcgaaccgtgcaccttacc 272



to top

>emb|BX009795.1|CNS08FPZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 705

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 67/81 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 cttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgc 322
           ||||||||| |||| |||  | ||||||||||| || |||  ||| || |||||||| ||
Sbjct: 357 cttcttcttttccttcttttcgaccttgggcgtttgtcccttcactttgccggcacgggc 298

                                
Query: 323 cagcgatccgtgcaccttacc 343
            ||||| ||||||||||||||
Sbjct: 297 gagcgaaccgtgcaccttacc 277



to top

>ref|XM_311180.2| Anopheles gambiae str. PEST ENSANGP00000019081
           (ENSANGG00000016592), mRNA
          Length = 705

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 67/81 (82%)
 Strand = Plus / Minus

                                                                       
Query: 263 cttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgc 322
           ||||||||| |||| |||  | ||||||||||| || |||  ||| || |||||||| ||
Sbjct: 389 cttcttcttttccttcttttcgaccttgggcgtttgtcccttcactttgccggcacgggc 330

                                
Query: 323 cagcgatccgtgcaccttacc 343
            ||||| ||||||||||||||
Sbjct: 329 gagcgaaccgtgcaccttacc 309



to top

>gb|AC007993.15|AC007993 Homo sapiens chromosome 17, clone RP11-527L4, complete sequence
          Length = 141704

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 107   aacaagcaaacaaacaaaaaaggag 131
             |||||||||||||||||||||||||
Sbjct: 69605 aacaagcaaacaaacaaaaaaggag 69581



to top

>gb|AC139317.4| Mus musculus BAC clone RP24-495N6 from 15, complete sequence
          Length = 182415

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 106    gaacaagcaaacaaacaaaaaagga 130
              |||||||||||||||||||||||||
Sbjct: 102480 gaacaagcaaacaaacaaaaaagga 102456



to top

>gb|AC115881.8| Mus musculus chromosome 6, clone RP24-365K16, complete sequence
          Length = 164311

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 105    tgaacaagcaaacaaacaaaaaag 128
              ||||||||||||||||||||||||
Sbjct: 126230 tgaacaagcaaacaaacaaaaaag 126253



to top

>gb|AC125321.4| Mus musculus BAC clone RP23-371B13 from chromosome 9, complete sequence
          Length = 196150

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 107    aacaagcaaacaaacaaaaaaggagggg 134
              ||||| ||||||||||||||||||||||
Sbjct: 103168 aacaaacaaacaaacaaaaaaggagggg 103141



to top

>emb|AL731561.12| Human DNA sequence from clone RP11-463P17 on chromosome 10 Contains a
             novel gene, gene FLJ32104, a novel gene, the RBP3 gene for
             retinol binding protein 3, the GDF2 gene for growth
             differentiation factor 2, the GDF10 gene for growth
             differentiation factor 10 and three CpG islands, complete
             sequence
          Length = 204512

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 105   tgaacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||||
Sbjct: 66411 tgaacaagcaaacaaacaaaaaag 66434



to top

>emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chromosome 13 Contains the
              genes for H2b histone family member A, two H2a, two H4 and
              an H2b histone family member, a serine/threonine protein
              kinase pseudogene, a novel pseudogene, a novel gene
              (4930500C15Rik), the gene for a novel KRAB box and C2H2
              Zinc Finger containing protein, a ribosomal protein L21
              (RPL21) pseudogene, a TU mitochondrial translation
              elongation factor (tufa) pseudogene, the 5' end of the gene
              for a novel protein similar to nuclear envelope pore
              membrane protein POM121 and four CpG islands, complete
              sequence
          Length = 182817

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 107    aacaagcaaacaaacaaaaaaggagggg 134
              ||||| ||||||||||||||||||||||
Sbjct: 126008 aacaaacaaacaaacaaaaaaggagggg 125981



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 107    aacaagcaaacaaacaaaaaagga 130
              |||||||| |||||||||||||||
Sbjct: 132914 aacaagcagacaaacaaaaaagga 132937



to top

>gb|AC079822.13| Homo sapiens 3 BAC RP11-413G22 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 181672

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 110   aagcaaacaaacaaaaaaggaggg 133
             ||||||||||||||||||||||||
Sbjct: 18548 aagcaaacaaacaaaaaaggaggg 18525



to top

>emb|BX571955.15| Zebrafish DNA sequence from clone DKEY-27B3 in linkage group 10,
             complete sequence
          Length = 272498

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 108   acaagcaaacaaacaaaaaaggag 131
             ||||||||||||||||||||||||
Sbjct: 67581 acaagcaaacaaacaaaaaaggag 67604



to top

>gb|AC155727.6| Mus musculus 6 BAC RP24-194N1 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 199400

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 107    aacaagcaaacaaacaaaaaaggagggg 134
              ||||||||||||||||||||||| ||||
Sbjct: 149175 aacaagcaaacaaacaaaaaaggggggg 149148



to top

>gb|AC160399.6| Mus musculus 6 BAC RP23-218B15 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 196625

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 107    aacaagcaaacaaacaaaaaaggagggg 134
              ||||||||||||||||||||||| ||||
Sbjct: 120233 aacaagcaaacaaacaaaaaaggggggg 120260



to top

>emb|BX820425.1|CNS0AA74 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH30ZH06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 539

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 185 cttcttgccgaagccgacgacggcggtgacgaagcggcggttgt 228
           ||||||||| || || || |||||||||||||| ||||||||||
Sbjct: 228 cttcttgccaaaaccaacaacggcggtgacgaaacggcggttgt 185



to top

>gb|AC154840.2| Mus musculus BAC clone RP23-61I7 from chromosome 14, complete sequence
          Length = 195596

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 107   aacaagcaaacaaacaaaaaagga 130
             ||||||||||||||||||||||||
Sbjct: 59221 aacaagcaaacaaacaaaaaagga 59198



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 107    aacaagcaaacaaacaaaaa 126
              ||||||||||||||||||||
Sbjct: 125103 aacaagcaaacaaacaaaaa 125122



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 107    aacaagcaaacaaacaaaaa 126
              ||||||||||||||||||||
Sbjct: 124691 aacaagcaaacaaacaaaaa 124672



to top

>gb|AC090963.32| Mus musculus strain C57BL/6J chromosome 17 clone rp23-435j12,
            complete sequence
          Length = 218107

 Score = 48.1 bits (24), Expect = 0.023
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 107  aacaagcaaacaaacaaaaaaggagggg 134
            |||||||||||||||||||||| |||||
Sbjct: 8380 aacaagcaaacaaacaaaaaagaagggg 8353



to top

>gb|AC170804.2| Mus musculus BAC clone RP24-435B12 from chromosome 6, complete sequence
          Length = 143675

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 105   tgaacaagcaaacaaacaaaaaa 127
             |||||||||||||||||||||||
Sbjct: 83404 tgaacaagcaaacaaacaaaaaa 83382



to top

>gb|AC120397.7| Mus musculus chromosome 18, clone RP24-332E21, complete sequence
          Length = 178502

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 113   caaacaaacaaaaaaggaggggt 135
             |||||||||||||||||||||||
Sbjct: 56348 caaacaaacaaaaaaggaggggt 56326



to top

>gb|BC091402.1| Rattus norvegicus Finkel-Biskis-Reilly murine sarcoma virus
           (FBR-MuSV) ubiquitously expressed (fox derived) protein,
           mRNA (cDNA clone MGC:109525 IMAGE:7324328), complete cds
          Length = 550

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                       
Query: 263 cttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgc 322
           ||||||||| ||||| || ||||||||||| ||||| || | ||| ||||| ||||| ||
Sbjct: 368 cttcttcttttcctgtttggccaccttgggagtctgacctctcactttcccagcacgagc 309

              
Query: 323 cag 325
           |||
Sbjct: 308 cag 306



to top

>ref|NM_001012739.1| Rattus norvegicus Finkel-Biskis-Reilly murine sarcoma virus
           (FBR-MuSV) ubiquitously expressed (fox derived) protein
           (Fau), mRNA
          Length = 550

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                       
Query: 263 cttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgc 322
           ||||||||| ||||| || ||||||||||| ||||| || | ||| ||||| ||||| ||
Sbjct: 368 cttcttcttttcctgtttggccaccttgggagtctgacctctcactttcccagcacgagc 309

              
Query: 323 cag 325
           |||
Sbjct: 308 cag 306



to top

>emb|X62671.1|RRFUSP Rattus rattus mRNA for hybrid protein (ubiquitin-like
           protein/rps30)
          Length = 522

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                       
Query: 263 cttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgc 322
           ||||||||| ||||| || ||||||||||| ||||| || | ||| ||||| ||||| ||
Sbjct: 358 cttcttcttttcctgtttggccaccttgggagtctgacctctcactttcccagcacgagc 299

              
Query: 323 cag 325
           |||
Sbjct: 298 cag 296



to top

>emb|AL603702.14| Mouse DNA sequence from clone RP23-406A14 on chromosome 11 Contains a
              protease (prosome, macropain) 26S subunit ATPase 1 (Psmc1)
              pseudogene and a CpG island, complete sequence
          Length = 197265

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 107    aacaagcaaacaaacaaaaaagg 129
              |||||||||||||||||||||||
Sbjct: 118184 aacaagcaaacaaacaaaaaagg 118206



to top

>gb|AC164162.2| Mus musculus BAC clone RP23-253E17 from chromosome 16, complete
             sequence
          Length = 174250

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 105   tgaacaagcaaacaaacaaaaaa 127
             |||||||||||||||||||||||
Sbjct: 66487 tgaacaagcaaacaaacaaaaaa 66465



to top

>gb|AC026130.15| Homo sapiens chromosome 17, clone RP11-801J18, complete sequence
          Length = 182909

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 107    aacaagcaaacaaacaaaaaaggaggg 133
              ||||| |||||||||||||||||||||
Sbjct: 114911 aacaaacaaacaaacaaaaaaggaggg 114885



to top

>gb|AC087330.6| Mus Musculus Strain C57BL6/J chromosome 5 BAC, RP23-3M10, complete
             sequence
          Length = 206093

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 109   caagcaaacaaacaaaaaaggag 131
             |||||||||||||||||||||||
Sbjct: 71781 caagcaaacaaacaaaaaaggag 71759



to top

>gb|BC102873.1| Bos taurus Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV)
           ubiquitously expressed (fox derived); ribosomal protein
           S30, mRNA (cDNA clone MGC:128133 IMAGE:7944155),
           complete cds
          Length = 635

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                       
Query: 263 cttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgc 322
           ||||||||| || ||||| ||||||||||| ||||| || | ||| ||||| ||||| ||
Sbjct: 411 cttcttcttctcttgcttggccaccttgggagtctgacctctcactttcccagcacgggc 352

              
Query: 323 cag 325
           |||
Sbjct: 351 cag 349



to top

>emb|BX548012.11| Zebrafish DNA sequence from clone DKEY-271O4 in linkage group 18,
             complete sequence
          Length = 154557

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 108   acaagcaaacaaacaaaaaagga 130
             |||||||||||||||||||||||
Sbjct: 62223 acaagcaaacaaacaaaaaagga 62245



to top

>gb|AC013449.8| Homo sapiens BAC clone RP11-558C24 from 2, complete sequence
          Length = 120997

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 107   aacaagcaaacaaacaaaaaagg 129
             |||||||||||||||||||||||
Sbjct: 90749 aacaagcaaacaaacaaaaaagg 90771



to top

>gb|AC154537.3| Mus musculus BAC clone RP23-451F20 from chromosome 13, complete
             sequence
          Length = 181229

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 107   aacaagcaaacaaacaaaaaagg 129
             |||||||||||||||||||||||
Sbjct: 86941 aacaagcaaacaaacaaaaaagg 86963



to top

>ref|NM_213937.1| Sus scrofa ubiquitin-like/S30 ribosomal fusion protein (FAU), mRNA
          Length = 499

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                       
Query: 263 cttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgc 322
           ||||||||| ||||| || ||||||||||| ||||| || | ||| ||||| ||||| ||
Sbjct: 350 cttcttcttctcctgtttggccaccttgggagtctgacctctcactttcccagcacgggc 291

              
Query: 323 cag 325
           |||
Sbjct: 290 cag 288



to top

>ref|XM_574605.1| PREDICTED: Rattus norvegicus similar to Finkel-Biskis-Reilly murine
           sarcoma virus (FBR-MuSV) ubiquitously expressed (fox
           derived) (LOC499305), mRNA
          Length = 527

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                       
Query: 263 cttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgc 322
           ||||||||| ||||| || ||||||||||| ||||| || | ||| ||||| ||||| ||
Sbjct: 420 cttcttcttttcctgtttggccaccttgggagtctgacctctcactttcccagcacgagc 361

              
Query: 323 cag 325
           |||
Sbjct: 360 cag 358



to top

>gb|AF520959.1| Bos taurus ubiquitin-like/S30 ribosomal fusion protein mRNA,
           complete cds
          Length = 482

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                       
Query: 263 cttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgc 322
           ||||||||| || ||||| ||||||||||| ||||| || | ||| ||||| ||||| ||
Sbjct: 333 cttcttcttctcttgcttggccaccttgggagtctgacctctcactttcccagcacgggc 274

              
Query: 323 cag 325
           |||
Sbjct: 273 cag 271



to top

>gb|AY911375.1| Bos taurus clone IMAGE:7961514 ubiquitin-like/S30 ribosomal fusion
           protein mRNA, complete cds
          Length = 404

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                       
Query: 263 cttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgc 322
           ||||||||| || ||||| ||||||||||| ||||| || | ||| ||||| ||||| ||
Sbjct: 255 cttcttcttctcttgcttggccaccttgggagtctgacctctcactttcccagcacgggc 196

              
Query: 323 cag 325
           |||
Sbjct: 195 cag 193



to top

>gb|U72543.1|SSU72543 Sus scrofa ubiquitin-like/S30 ribosomal fusion protein (fau) mRNA,
           complete cds
          Length = 499

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                       
Query: 263 cttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgc 322
           ||||||||| ||||| || ||||||||||| ||||| || | ||| ||||| ||||| ||
Sbjct: 350 cttcttcttctcctgtttggccaccttgggagtctgacctctcactttcccagcacgggc 291

              
Query: 323 cag 325
           |||
Sbjct: 290 cag 288



to top

>ref|NM_174731.3| Bos taurus Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV)
           ubiquitously expressed (fox derived); ribosomal protein
           S30 (FAU), mRNA
          Length = 635

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                       
Query: 263 cttcttcttgtcctgcttcgccaccttgggcgtctggccccgcaccttcccggcacgcgc 322
           ||||||||| || ||||| ||||||||||| ||||| || | ||| ||||| ||||| ||
Sbjct: 411 cttcttcttctcttgcttggccaccttgggagtctgacctctcactttcccagcacgggc 352

              
Query: 323 cag 325
           |||
Sbjct: 351 cag 349



to top

>emb|AL845171.5| Mouse DNA sequence from clone RP23-38N8 on chromosome 4, complete
              sequence
          Length = 229784

 Score = 46.1 bits (23), Expect = 0.092
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 105    tgaacaagcaaacaaacaaaaaa 127
              |||||||||||||||||||||||
Sbjct: 169399 tgaacaagcaaacaaacaaaaaa 169421



to top

>gb|AC155166.4| Mus musculus BAC clone RP24-69M8 from chromosome 8, complete sequence
          Length = 212711

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 49968 aacaagcaaacaaacaaaaaag 49989



to top

>gb|AE014832.1| Plasmodium falciparum 3D7 chromosome 10 section 4 of 7 of the complete
             sequence
          Length = 258658

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 113   caaacaaacaaaaaaggagggg 134
             ||||||||||||||||||||||
Sbjct: 13318 caaacaaacaaaaaaggagggg 13339



to top

>gb|CP000081.1| Leishmania major chromosome 35, complete sequence
          Length = 2090491

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 107    aacaagcaaacaaacaaaaaag 128
              ||||||||||||||||||||||
Sbjct: 478974 aacaagcaaacaaacaaaaaag 478953



to top

>gb|AC159435.1| Trypanosoma brucei chromosome 8 clone RPCI93-29H22, complete sequence
          Length = 148464

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 34927 aacaagcaaacaaacaaaaaag 34948



to top

>gb|CP000071.1| Trypanosoma brucei chromosome 8, complete sequence
          Length = 2481190

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 107     aacaagcaaacaaacaaaaaag 128
               ||||||||||||||||||||||
Sbjct: 1245150 aacaagcaaacaaacaaaaaag 1245171



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 107    aacaagcaaacaaacaaaaa 126
              ||||||||||||||||||||
Sbjct: 278320 aacaagcaaacaaacaaaaa 278301



to top

>gb|AC155164.5| Mus musculus BAC clone RP24-74L7 from chromosome 8, complete sequence
          Length = 193057

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 107    aacaagcaaacaaacaaaaaag 128
              ||||||||||||||||||||||
Sbjct: 114990 aacaagcaaacaaacaaaaaag 114969



to top

>gb|AC168205.7| Mus musculus chromosome 8, clone RP23-478P10, complete sequence
          Length = 174995

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 107   aacaagcaaacaaacaaaaaaggagg 132
             ||||| ||||||||||||||||||||
Sbjct: 74510 aacaaacaaacaaacaaaaaaggagg 74535



to top

>gb|AC139758.3| Mus musculus BAC clone RP23-367E7 from chromosome 14, complete sequence
          Length = 210969

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 56787 aacaagcaaacaaacaaaaaag 56766



to top

>gb|BT013797.1| Lycopersicon esculentum clone 132717F, mRNA sequence
          Length = 1981

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 3    acaaagcagtgagatttccattacca 28
            ||||||||| ||||||||||||||||
Sbjct: 1185 acaaagcagggagatttccattacca 1210



to top

>gb|AC091276.7| Mus musculus chromosome 15, clone RP23-167B4, complete sequence
          Length = 255663

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 105   tgaacaagcaaacaaacaaaaa 126
             ||||||||||||||||||||||
Sbjct: 60903 tgaacaagcaaacaaacaaaaa 60882



to top

>gb|AC163616.3| Mus musculus BAC clone RP23-114P22 from chromosome 3, complete sequence
          Length = 212857

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 107    aacaagcaaacaaacaaaaaag 128
              ||||||||||||||||||||||
Sbjct: 148467 aacaagcaaacaaacaaaaaag 148488



to top

>gb|AC110164.26| Mus musculus chromosome 3, clone RP23-167C5, complete sequence
          Length = 199235

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 105  tgaacaagcaaacaaacaaaaa 126
            ||||||||||||||||||||||
Sbjct: 5446 tgaacaagcaaacaaacaaaaa 5425



to top

>gb|AC132377.3| Mus musculus BAC clone RP24-81F14 from chromosome 16, complete sequence
          Length = 173662

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 107    aacaagcaaacaaacaaaaaag 128
              ||||||||||||||||||||||
Sbjct: 149516 aacaagcaaacaaacaaaaaag 149537



to top

>gb|AC113011.9| Mus musculus chromosome 16, clone RP23-173D22, complete sequence
          Length = 210962

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 46793 aacaagcaaacaaacaaaaaag 46772



to top

>gb|AC122485.3| Mus musculus BAC clone RP24-377J10 from chromosome 3, complete sequence
          Length = 157739

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 106   gaacaagcaaacaaacaaaaaaggag 131
             |||||| |||||||||||||||||||
Sbjct: 30629 gaacaaacaaacaaacaaaaaaggag 30654



to top

>gb|AC124408.4| Mus musculus BAC clone RP24-262E22 from chromosome 14, complete
             sequence
          Length = 159082

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 81515 aacaagcaaacaaacaaaaaag 81494



to top

>gb|AC122383.4| Mus musculus BAC clone RP23-479O8 from chromosome 7, complete sequence
          Length = 196195

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 49065 aacaagcaaacaaacaaaaaag 49086



to top

>gb|AC121571.4| Mus musculus BAC clone RP23-231J6 from 3, complete sequence
          Length = 195006

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 106  gaacaagcaaacaaacaaaaaaggag 131
            |||||| |||||||||||||||||||
Sbjct: 5452 gaacaaacaaacaaacaaaaaaggag 5427



to top

>gb|AC122919.3| Mus musculus BAC clone RP23-30C12 from 10, complete sequence
          Length = 221920

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 107    aacaagcaaacaaacaaaaaag 128
              ||||||||||||||||||||||
Sbjct: 105072 aacaagcaaacaaacaaaaaag 105093



to top

>gb|AC122434.2| Mus musculus BAC clone RP24-198G2 from chromosome 8, complete sequence
          Length = 168940

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 105    tgaacaagcaaacaaacaaaaaagga 130
              ||||||| ||||||||||||||||||
Sbjct: 123730 tgaacaaacaaacaaacaaaaaagga 123755



to top

>gb|AC127332.3| Mus musculus BAC clone RP23-136I1 from 5, complete sequence
          Length = 230629

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 25816 aacaagcaaacaaacaaaaaag 25795



to top

>gb|AC124578.4| Mus musculus BAC clone RP23-166C2 from 18, complete sequence
          Length = 213229

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 107    aacaagcaaacaaacaaaaaag 128
              ||||||||||||||||||||||
Sbjct: 112763 aacaagcaaacaaacaaaaaag 112742



to top

>gb|AC115304.3| Mus musculus BAC clone RP24-156K1 from 15, complete sequence
          Length = 144026

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 20528 aacaagcaaacaaacaaaaaag 20549



to top

>gb|AC113003.9| Mus musculus chromosome 18, clone RP23-246G4, complete sequence
          Length = 162882

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 37212 aacaagcaaacaaacaaaaaag 37233



to top

>gb|AC141325.1| Pan troglodytes BAC clone RP43-168D7 from 7, complete sequence
          Length = 195031

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 107    aacaagcaaacaaacaaaaaag 128
              ||||||||||||||||||||||
Sbjct: 145194 aacaagcaaacaaacaaaaaag 145173



to top

>emb|CR753843.8| Zebrafish DNA sequence from clone DKEY-169H1 in linkage group 14,
             complete sequence
          Length = 112358

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 106   gaacaagcaaacaaacaaaaaa 127
             ||||||||||||||||||||||
Sbjct: 50227 gaacaagcaaacaaacaaaaaa 50206



to top

>emb|Z86062.1|HS121G13 Human DNA sequence from clone RP1-121G13 on chromosome 6q16 Contains
             the 3' end of the RNAH gene for an RNA helicase, the 5'
             end of the SIM1 gene for single-minded homolog 1
             (Drosophila), an RP42 homolog pseudogene a novel gene and
             three CpG islands, complete sequence
          Length = 176932

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 105   tgaacaagcaaacaaacaaaaa 126
             ||||||||||||||||||||||
Sbjct: 61876 tgaacaagcaaacaaacaaaaa 61855



to top

>emb|AL451074.13| Human DNA sequence from clone RP11-466F5 on chromosome 1 Contains the 3'
              end of the MGST3 gene for microsomal glutathione
              S-transferase 3, the ALDH9A1 gene for aldehyde
              dehydrogenase 9 family (member A1), a ribosomal protein S13
              (RPS13) pseudogene, a ribosomal protein L21 (RPL21)
              pseudogene, two novel genes (FLJ42974), a carbonic
              anhydrase XIV (CA14) pseudogene, the gene for putative
              membrane protein (LOC54499), a ribosomal protein L26
              (RPL26) pseudogene, the 5' end of (tbc), the 5' end of the
              UMPK gene for uridine monophosphate kinase and two CpG
              islands, complete sequence
          Length = 188217

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 107    aacaagcaaacaaacaaaaaag 128
              ||||||||||||||||||||||
Sbjct: 111513 aacaagcaaacaaacaaaaaag 111534



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 107    aacaagcaaacaaacaaaaaa 127
              |||||||||||||||||||||
Sbjct: 158800 aacaagcaaacaaacaaaaaa 158820



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 107    aacaagcaaacaaacaaaaa 126
              ||||||||||||||||||||
Sbjct: 147442 aacaagcaaacaaacaaaaa 147423



to top

>emb|AL391865.9| Human DNA sequence from clone RP13-40J16 on chromosome X, complete
             sequence
          Length = 151421

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 99460 aacaagcaaacaaacaaaaaag 99439



to top

>emb|AL357117.20| Human DNA sequence from clone RP11-436I24 on chromosome 6 Contains part
             of the gene for a novel protein (contains KIAA0680), a
             novel gene and a CpG island, complete sequence
          Length = 139627

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 88025 aacaagcaaacaaacaaaaaag 88004



to top

>emb|AL356776.21| Human DNA sequence from clone RP11-477E3 on chromosome 6 Contains the 5'
              end of a gene for a  novel WD repeat-containing protein and
              a nucleoporin pseudogene, complete sequence
          Length = 170387

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 107    aacaagcaaacaaacaaaaaag 128
              ||||||||||||||||||||||
Sbjct: 133753 aacaagcaaacaaacaaaaaag 133774



to top

>emb|AL355985.18| Human DNA sequence from clone RP11-98O17 on chromosome 9 Contains a
           putative novel pseudogene, complete sequence
          Length = 64969

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 107 aacaagcaaacaaacaaaaaaggagg 132
           ||||||||||||||||||| ||||||
Sbjct: 255 aacaagcaaacaaacaaaacaggagg 230



to top

>emb|AL158154.28| Human DNA sequence from clone RP11-383M4 on chromosome 9 Contains two
              novel genes and three putative novel pseudogenes, complete
              sequence
          Length = 189319

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 107    aacaagcaaacaaacaaaaaaggagg 132
              ||||||||||||||||||| ||||||
Sbjct: 187574 aacaagcaaacaaacaaaacaggagg 187549



to top

>gb|AC113194.8| Homo sapiens chromosome 8, clone RP11-1070A24, complete sequence
          Length = 166015

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 107    aacaagcaaacaaacaaaaaag 128
              ||||||||||||||||||||||
Sbjct: 102409 aacaagcaaacaaacaaaaaag 102430



to top

>gb|AC158926.4| Mus musculus chromosome 3, clone RP24-93J4, complete sequence
          Length = 185247

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 26160 aacaagcaaacaaacaaaaaag 26181



to top

>emb|AL022717.2|HS201D7 Human DNA sequence from clone RP1-201D7 on chromosome 6p22.1-22.3
             Contains part of a novel gene (FLJ20342), complete
             sequence
          Length = 100733

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 106   gaacaagcaaacaaacaaaaaa 127
             ||||||||||||||||||||||
Sbjct: 35947 gaacaagcaaacaaacaaaaaa 35968



to top

>gb|AC163678.3| Mus musculus BAC clone RP24-104D14 from chromosome 10, complete
             sequence
          Length = 196603

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 89801 aacaagcaaacaaacaaaaaag 89822



to top

>emb|AL591496.13| Mouse DNA sequence from clone RP23-384C18 on chromosome 11 Contains the
              3' end of a novel gene, five novel genes, the Serpinf1 and
              Serpinf2 genes for serine (or cysteine) proteinase
              inhibitor, clade F) members 1 and 2, an H+ transporting
              mitochondrial F0 complex ATP synthase subunit c (subunit 9)
              isoform 1 (Atp5g1) pseudogene, the Prpf8 gene for pre-mRNA
              processing factor 8, the gene for the ortholog of human
              scavenger receptor class F member 1 SCARF1, the 5' end of
              the gene for novel protein similar to solute carrier family
              43 member 1 Slc43a1 and seven CpG islands, complete
              sequence
          Length = 205633

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 107    aacaagcaaacaaacaaaaaaggagg 132
              ||||| ||||||||||||||||||||
Sbjct: 122472 aacaaacaaacaaacaaaaaaggagg 122447



to top

>gb|AC002121.1| Genomic sequence from Mouse 11, complete sequence
          Length = 84056

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 107   aacaagcaaacaaacaaaaaaggagg 132
             ||||| ||||||||||||||||||||
Sbjct: 78078 aacaaacaaacaaacaaaaaaggagg 78103



to top

>gb|AC063968.5| Genomic sequence for Mus musculus, clone RP23-105K11, complete sequence
          Length = 222520

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 97545 aacaagcaaacaaacaaaaaag 97566



to top

>gb|AC021649.18| Homo sapiens 3 BAC RP11-321F19 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 209521

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 38833 aacaagcaaacaaacaaaaaag 38854



to top

>gb|AC121255.2| Homo sapiens chromosome 3 clone RP11-669E5, complete sequence
          Length = 16032

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 110  aagcaaacaaacaaaaaaggag 131
            ||||||||||||||||||||||
Sbjct: 3909 aagcaaacaaacaaaaaaggag 3930



to top

>gb|AC010296.6| Homo sapiens chromosome 5 clone CTB-155H23, complete sequence
          Length = 134349

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 107   aacaagcaaacaaacaaaaaaggagg 132
             |||||||||||||| |||||||||||
Sbjct: 28768 aacaagcaaacaaaaaaaaaaggagg 28743



to top

>gb|AC117379.3| Homo sapiens 3 BAC RP11-392C7 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 181191

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 105    tgaacaagcaaacaaacaaaaa 126
              ||||||||||||||||||||||
Sbjct: 149189 tgaacaagcaaacaaacaaaaa 149210



to top

>gb|AC090448.5| Homo sapiens chromosome 8, clone RP11-142M8, complete sequence
          Length = 82020

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 71963 aacaagcaaacaaacaaaaaag 71984



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 107   aacaagcaaacaaacaaaaaa 127
             |||||||||||||||||||||
Sbjct: 27026 aacaagcaaacaaacaaaaaa 27006



to top

>gb|AC078813.13| Homo sapiens 3q BAC RP11-149B11 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 142000

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 71643 aacaagcaaacaaacaaaaaag 71664



to top

>gb|AC099775.2| Homo sapiens chromosome 3 clone RP11-169G24, complete sequence
          Length = 181443

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 110  aagcaaacaaacaaaaaaggag 131
            ||||||||||||||||||||||
Sbjct: 1226 aagcaaacaaacaaaaaaggag 1205



to top

>gb|AC092042.2| Homo sapiens chromosome 3 clone RP11-136C24, complete sequence
          Length = 171974

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 107    aacaagcaaacaaacaaaaaaggagg 132
              ||||| ||||||||||||||||||||
Sbjct: 103037 aacaaacaaacaaacaaaaaaggagg 103012



to top

>gb|AC101979.13| Mus musculus chromosome 3, clone RP24-338A7, complete sequence
          Length = 161025

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 71816 aacaagcaaacaaacaaaaaag 71837



to top

>emb|CR406246.1| Gallus gallus finished cDNA, clone ChEST877h12
          Length = 801

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 107 aacaagcaaacaaacaaaaaag 128
           ||||||||||||||||||||||
Sbjct: 663 aacaagcaaacaaacaaaaaag 642



to top

>gb|AC150899.3| Mus musculus BAC clone RP23-179F8 from chromosome 10, complete sequence
          Length = 202346

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 107    aacaagcaaacaaacaaaaaag 128
              ||||||||||||||||||||||
Sbjct: 151489 aacaagcaaacaaacaaaaaag 151510



to top

>dbj|AK080271.1| Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched
           library, clone:A630013K22 product:unclassifiable, full
           insert sequence
          Length = 1512

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 107 aacaagcaaacaaacaaaaaag 128
           ||||||||||||||||||||||
Sbjct: 120 aacaagcaaacaaacaaaaaag 141



to top

>gb|AC007351.40|AC007351 Homo sapiens 12 BAC RP11-492N15 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 195501

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 107    aacaagcaaacaaacaaaaaag 128
              ||||||||||||||||||||||
Sbjct: 190385 aacaagcaaacaaacaaaaaag 190406



to top

>gb|AC021001.5|AC021001 Homo sapiens chromosome 8, clone RP11-419L20, complete sequence
          Length = 175742

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 52773 aacaagcaaacaaacaaaaaag 52752



to top

>gb|AC015982.9| Homo sapiens BAC clone RP11-554J4 from 2, complete sequence
          Length = 191546

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 107    aacaagcaaacaaacaaaaaag 128
              ||||||||||||||||||||||
Sbjct: 157646 aacaagcaaacaaacaaaaaag 157625



to top

>gb|AC152159.6| Mus musculus chromosome 15, clone RP23-10O8, complete sequence
          Length = 217045

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 105    tgaacaagcaaacaaacaaaaa 126
              ||||||||||||||||||||||
Sbjct: 105861 tgaacaagcaaacaaacaaaaa 105882



to top

>gb|AC154322.1| Mus musculus BAC clone RP23-299P17 from chromosome 14, complete
             sequence
          Length = 182146

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 104   gtgaacaagcaaacaaacaaaaaagg 129
             |||||||| |||||||||||||||||
Sbjct: 77821 gtgaacaaacaaacaaacaaaaaagg 77796



to top

>gb|AC145987.2| Pan troglodytes BAC clone RP43-165D6 from chromosome 7, complete sequence
          Length = 158415

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 106    gaacaagcaaacaaacaaaaaa 127
              ||||||||||||||||||||||
Sbjct: 101033 gaacaagcaaacaaacaaaaaa 101054



to top

>gb|AC155816.3| Mus musculus BAC clone RP23-435J8 from chromosome 8, complete sequence
          Length = 207128

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 105   tgaacaagcaaacaaacaaaaaagga 130
             ||||||| ||||||||||||||||||
Sbjct: 56664 tgaacaaacaaacaaacaaaaaagga 56689



to top

>gb|AC017033.5| Homo sapiens BAC clone RP11-297J22 from 2, complete sequence
          Length = 183887

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 69534 aacaagcaaacaaacaaaaaag 69513



to top

>gb|AC020594.6| Homo sapiens BAC clone RP11-322P19 from 2, complete sequence
          Length = 193410

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 56420 aacaagcaaacaaacaaaaaag 56399



to top

>gb|AC008431.5|AC008431 Homo sapiens chromosome 5 clone CTC-311C22, complete sequence
          Length = 118947

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 107   aacaagcaaacaaacaaaaaaggagg 132
             |||||||||||||| |||||||||||
Sbjct: 39281 aacaagcaaacaaaaaaaaaaggagg 39306



to top

>gb|AC108039.4| Homo sapiens BAC clone RP11-210C5 from 2, complete sequence
          Length = 168612

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 107   aacaagcaaacaaacaaaaaaggaggggta 136
             ||||| ||||||||||||||||||| ||||
Sbjct: 25460 aacaaacaaacaaacaaaaaaggagaggta 25431



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 107    aacaagcaaacaaacaaaaaa 127
              |||||||||||||||||||||
Sbjct: 129974 aacaagcaaacaaacaaaaaa 129954



to top

>gb|AC132445.3| Mus musculus BAC clone RP23-173F23 from chromosome unknown, complete
             sequence
          Length = 194715

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 46771 aacaagcaaacaaacaaaaaag 46792



to top

>gb|AC133184.3| Mus musculus BAC clone RP24-186A17 from chromosome 5, complete sequence
          Length = 169357

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 107    aacaagcaaacaaacaaaaaag 128
              ||||||||||||||||||||||
Sbjct: 155928 aacaagcaaacaaacaaaaaag 155907



to top

>gb|AC092573.2| Homo sapiens BAC clone RP11-1O7 from 2, complete sequence
          Length = 171265

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 107    aacaagcaaacaaacaaaaaag 128
              ||||||||||||||||||||||
Sbjct: 136719 aacaagcaaacaaacaaaaaag 136740



to top

>gb|AC018752.4|AC018752 Homo sapiens chromosome 5 clone CTC-339F2, complete sequence
          Length = 206691

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 107   aacaagcaaacaaacaaaaaaggagg 132
             |||||||||||||| |||||||||||
Sbjct: 39279 aacaagcaaacaaaaaaaaaaggagg 39304



to top

>gb|AF157330.1|MMPRXI3 Mus musculus peroxiredoxin I (PrxI) gene, exons 3-5
          Length = 2553

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 107  aacaagcaaacaaacaaaaaag 128
            ||||||||||||||||||||||
Sbjct: 1040 aacaagcaaacaaacaaaaaag 1019



to top

>gb|AC149589.2| Mus musculus BAC clone RP23-356I2 from 18, complete sequence
          Length = 225803

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 75239 aacaagcaaacaaacaaaaaag 75218



to top

>gb|AC007751.3|AC007751 Homo sapiens, clone 5_A_11, complete sequence
          Length = 158963

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 107    aacaagcaaacaaacaaaaaag 128
              ||||||||||||||||||||||
Sbjct: 152869 aacaagcaaacaaacaaaaaag 152848



to top

>gb|AC152984.2| Mus musculus 6 BAC RP23-462B3 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 185001

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 82265 aacaagcaaacaaacaaaaaag 82244



to top

>gb|AC155637.4| Mus musculus 10 BAC RP24-227O16 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 159189

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 106    gaacaagcaaacaaacaaaaaa 127
              ||||||||||||||||||||||
Sbjct: 107443 gaacaagcaaacaaacaaaaaa 107422



to top

>gb|AC108782.9| Mus musculus chromosome 8, clone RP23-350C11, complete sequence
          Length = 221428

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 107    aacaagcaaacaaacaaaaaag 128
              ||||||||||||||||||||||
Sbjct: 168326 aacaagcaaacaaacaaaaaag 168347



to top

>dbj|AP000427.3| Homo sapiens genomic DNA, chromosome 8q23, clone:KB1171G1
          Length = 187189

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 42931 aacaagcaaacaaacaaaaaag 42952



to top

>emb|AL627212.21| Mouse DNA sequence from clone RP23-145E1 on chromosome 4, complete
             sequence
          Length = 207362

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 40162 aacaagcaaacaaacaaaaaag 40183



to top

>emb|AL672268.18| Mouse DNA sequence from clone RP23-171J18 on chromosome X, complete
             sequence
          Length = 187999

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 109   caagcaaacaaacaaaaaagga 130
             ||||||||||||||||||||||
Sbjct: 98327 caagcaaacaaacaaaaaagga 98306



to top

>emb|BX005233.10| Mouse DNA sequence from clone RP23-214I11 on chromosome X, complete
              sequence
          Length = 189118

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 107    aacaagcaaacaaacaaaaaag 128
              ||||||||||||||||||||||
Sbjct: 166501 aacaagcaaacaaacaaaaaag 166522



to top

>gb|AC133497.4| Mus musculus BAC clone RP24-390A22 from 8, complete sequence
          Length = 158740

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 90755 aacaagcaaacaaacaaaaaag 90776



to top

>gb|AC147366.5| Mus musculus BAC clone RP23-386J3 from 15, complete sequence
          Length = 175781

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 51087 aacaagcaaacaaacaaaaaag 51066



to top

>emb|CT033847.5| Mouse DNA sequence from clone RP24-225N8 on chromosome 17, complete
             sequence
          Length = 171164

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 64466 aacaagcaaacaaacaaaaaag 64487



to top

>emb|CT030683.6| Mouse DNA sequence from clone RP23-22O8 on chromosome 9, complete
             sequence
          Length = 126280

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 37267 aacaagcaaacaaacaaaaaag 37288



to top

>gb|AC002109.1|AC002109 Genomic sequence from Mouse 9, complete sequence
          Length = 160048

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 107    aacaagcaaacaaacaaaaaag 128
              ||||||||||||||||||||||
Sbjct: 117200 aacaagcaaacaaacaaaaaag 117179



to top

>gb|AC069561.37| Mus musculus strain C57BL/6J chromosome 9 clone rp23-263o15, complete
             sequence
          Length = 201162

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 62031 aacaagcaaacaaacaaaaaag 62052



to top

>emb|AL831786.7| Mouse DNA sequence from clone RP23-177C18 on chromosome 4, complete
             sequence
          Length = 80871

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 66568 aacaagcaaacaaacaaaaaag 66547



to top

>emb|AL683810.10| Mouse DNA sequence from clone RP23-10L18 on chromosome 2, complete
              sequence
          Length = 186882

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 107    aacaagcaaacaaacaaaaaag 128
              ||||||||||||||||||||||
Sbjct: 100172 aacaagcaaacaaacaaaaaag 100151



to top

>emb|AL671672.4| Mouse DNA sequence from clone RP23-461E2 on chromosome 4, complete
             sequence
          Length = 191255

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 69021 aacaagcaaacaaacaaaaaag 69000



to top

>emb|AL451076.14| Mouse DNA sequence from clone RP23-43O20 on chromosome X, complete
              sequence
          Length = 203581

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 107    aacaagcaaacaaacaaaaaag 128
              ||||||||||||||||||||||
Sbjct: 141964 aacaagcaaacaaacaaaaaag 141985



to top

>emb|AL670231.7| Mouse DNA sequence from clone RP23-329G7 on chromosome 4, complete
              sequence
          Length = 229957

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 107    aacaagcaaacaaacaaaaaaggaggggta 136
              ||||| |||||||||||| |||||||||||
Sbjct: 200577 aacaaacaaacaaacaaacaaggaggggta 200548



to top

>emb|AL929375.5| Mouse DNA sequence from clone RP23-49G18 on chromosome 2, complete
             sequence
          Length = 54202

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 106   gaacaagcaaacaaacaaaaaa 127
             ||||||||||||||||||||||
Sbjct: 22864 gaacaagcaaacaaacaaaaaa 22885



to top

>emb|AL731717.11| Mouse DNA sequence from clone RP23-92C4 on chromosome X, complete
             sequence
          Length = 234900

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 70722 aacaagcaaacaaacaaaaaag 70701



to top

>emb|AL833775.7| Mouse DNA sequence from clone RP23-135L5 on chromosome 4, complete
              sequence
          Length = 194640

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 107    aacaagcaaacaaacaaaaaaggagg 132
              ||||| ||||||||||||||||||||
Sbjct: 151905 aacaaacaaacaaacaaaaaaggagg 151880



to top

>dbj|AP004288.2| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1735D4
          Length = 212373

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 107    aacaagcaaacaaacaaaaaag 128
              ||||||||||||||||||||||
Sbjct: 134297 aacaagcaaacaaacaaaaaag 134318



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 107   aacaagcaaacaaacaaaaaa 127
             |||||||||||||||||||||
Sbjct: 89432 aacaagcaaacaaacaaaaaa 89412



to top

>emb|AL732428.7| Mouse DNA sequence from clone RP23-347P2 on chromosome 2, complete
            sequence
          Length = 123627

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 107  aacaagcaaacaaacaaaaaag 128
            ||||||||||||||||||||||
Sbjct: 7123 aacaagcaaacaaacaaaaaag 7144



to top

>emb|AL627078.10| Mouse DNA sequence from clone RP23-138K13 on chromosome 4, complete
             sequence
          Length = 90129

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 107   aacaagcaaacaaacaaaaaag 128
             ||||||||||||||||||||||
Sbjct: 61542 aacaagcaaacaaacaaaaaag 61521



to top

>gb|AC117731.14| Mus musculus chromosome 8, clone RP24-128L11, complete sequence
          Length = 171484

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 107    aacaagcaaacaaacaaaaaa 127
              |||||||||||||||||||||
Sbjct: 151564 aacaagcaaacaaacaaaaaa 151584



to top

>gb|AC153080.4| Colobus guereza clone CH272-279A15, complete sequence
          Length = 141541

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 107    aacaagcaaacaaacaaaaaa 127
              |||||||||||||||||||||
Sbjct: 115062 aacaagcaaacaaacaaaaaa 115042



to top

>gb|AC162384.6| Mus musculus 10 BAC RP24-292K6 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 172853

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 107    aacaagcaaacaaacaaaaaa 127
              |||||||||||||||||||||
Sbjct: 161993 aacaagcaaacaaacaaaaaa 162013



to top

>gb|AC102039.8| Mus musculus chromosome 5, clone RP23-262L7, complete sequence
          Length = 168142

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 107   aacaagcaaacaaacaaaaaa 127
             |||||||||||||||||||||
Sbjct: 61888 aacaagcaaacaaacaaaaaa 61908



to top

>gb|AC102612.14| Mus musculus chromosome 9, clone RP23-417D20, complete sequence
          Length = 202804

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 107   aacaagcaaacaaacaaaaaa 127
             |||||||||||||||||||||
Sbjct: 18994 aacaagcaaacaaacaaaaaa 19014



to top

>gb|AC165229.7| Mus musculus chromosome 1, clone RP23-47K10, complete sequence
          Length = 218929

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 107    aacaagcaaacaaacaaaaaa 127
              |||||||||||||||||||||
Sbjct: 161535 aacaagcaaacaaacaaaaaa 161555



to top

>gb|AC153380.1| Mus musculus  BAC RP23-256G5 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 160046

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 107    aacaagcaaacaaacaaaaaa 127
              |||||||||||||||||||||
Sbjct: 125884 aacaagcaaacaaacaaaaaa 125864



to top

>gb|AC123629.10| Mus musculus chromosome 13, clone RP24-344N4, complete sequence
          Length = 177594

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 107    aacaagcaaacaaacaaaaaa 127
              |||||||||||||||||||||
Sbjct: 166041 aacaagcaaacaaacaaaaaa 166061



to top

>gb|AC152753.1| Mus musculus chromosome 17 clone RP23-65L9, complete sequence
          Length = 211853

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 107   aacaagcaaacaaacaaaaaaggag 131
             ||||| |||||||||||||||||||
Sbjct: 82614 aacaaacaaacaaacaaaaaaggag 82590



to top

>gb|AC121261.9| Mus musculus chromosome 7, clone RP24-69L13, complete sequence
          Length = 163319

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 107   aacaagcaaacaaacaaaaaa 127
             |||||||||||||||||||||
Sbjct: 63147 aacaagcaaacaaacaaaaaa 63167



to top

>gb|AC110525.10| Mus musculus chromosome 8, clone RP23-82N11, complete sequence
          Length = 153281

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 107    aacaagcaaacaaacaaaaaa 127
              |||||||||||||||||||||
Sbjct: 126434 aacaagcaaacaaacaaaaaa 126454



to top

>gb|AC154387.2| Mus musculus BAC clone RP23-10K1 from chromosome 16, complete sequence
          Length = 212628

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 107    aacaagcaaacaaacaaaaaa 127
              |||||||||||||||||||||
Sbjct: 188341 aacaagcaaacaaacaaaaaa 188321



to top

>gb|AC160992.2| Mus musculus BAC clone RP23-147I23 from chromosome 9, complete sequence
          Length = 215980

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 107    aacaagcaaacaaacaaaaaa 127
              |||||||||||||||||||||
Sbjct: 164483 aacaagcaaacaaacaaaaaa 164503



to top

>gb|AC145600.6| Mus musculus BAC clone RP24-220P24 from chromosome y, complete sequence
          Length = 171542

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 107    aacaagcaaacaaacaaaaaa 127
              |||||||||||||||||||||
Sbjct: 155190 aacaagcaaacaaacaaaaaa 155170



to top

>gb|AC167812.4| Mus musculus BAC clone RP24-299F5 from chromosome 18, complete sequence
          Length = 193523

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 107   aacaagcaaacaaacaaaaaa 127
             |||||||||||||||||||||
Sbjct: 51168 aacaagcaaacaaacaaaaaa 51148



to top

>ref|NM_001031595.1| Gallus gallus zinc finger protein, subfamily 1A, 5 (ZNFN1A5), mRNA
          Length = 5155

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 107  aacaagcaaacaaacaaaaaa 127
            |||||||||||||||||||||
Sbjct: 4409 aacaagcaaacaaacaaaaaa 4389



to top

>gb|AC168308.2| Mus musculus chromosome 18, clone wi1-1401I7, complete sequence
          Length = 39007

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 107   aacaagcaaacaaacaaaaaa 127
             |||||||||||||||||||||
Sbjct: 17325 aacaagcaaacaaacaaaaaa 17305



to top

>ref|NM_020443.2| Homo sapiens neuron navigator 1 (NAV1), mRNA
          Length = 11365

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 107  aacaagcaaacaaacaaaaaa 127
            |||||||||||||||||||||
Sbjct: 6548 aacaagcaaacaaacaaaaaa 6568



to top

>gb|AC163447.5| Mus musculus chromosome 7, clone RP24-314E16, complete sequence
          Length = 135851

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 107    aacaagcaaacaaacaaaaaa 127
              |||||||||||||||||||||
Sbjct: 106976 aacaagcaaacaaacaaaaaa 106956



to top

>gb|AC102794.8| Mus musculus chromosome 3, clone RP23-235G13, complete sequence
          Length = 166028

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 107    aacaagcaaacaaacaaaaaa 127
              |||||||||||||||||||||
Sbjct: 118299 aacaagcaaacaaacaaaaaa 118319



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 107    aacaagcaaacaaacaaaaaagga 130
              ||||| ||||||||||||||||||
Sbjct: 115822 aacaaacaaacaaacaaaaaagga 115799



to top

>gb|AC107634.8| Mus musculus chromosome 5, clone RP23-19G21, complete sequence
          Length = 201345

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 107   aacaagcaaacaaacaaaaaa 127
             |||||||||||||||||||||
Sbjct: 23428 aacaagcaaacaaacaaaaaa 23448



to top

>gb|AC113177.16| Mus musculus chromosome 15, clone RP23-447G7, complete sequence
          Length = 179268

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 107    aacaagcaaacaaacaaaaaa 127
              |||||||||||||||||||||
Sbjct: 124155 aacaagcaaacaaacaaaaaa 124135



to top

>gb|AC138278.9| Mus musculus chromosome 8, clone RP23-378E4, complete sequence
          Length = 177245

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 107    aacaagcaaacaaacaaaaaa 127
              |||||||||||||||||||||
Sbjct: 169469 aacaagcaaacaaacaaaaaa 169489



to top

>gb|AC102168.9| Mus musculus chromosome 7, clone RP23-452N21, complete sequence
          Length = 171392

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 107  aacaagcaaacaaacaaaaaa 127
            |||||||||||||||||||||
Sbjct: 7255 aacaagcaaacaaacaaaaaa 7235



to top

>gb|AC158499.5| Mus musculus chromosome 18, clone RP23-466O5, complete sequence
          Length = 164645

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 107   aacaagcaaacaaacaaaaaa 127
             |||||||||||||||||||||
Sbjct: 46480 aacaagcaaacaaacaaaaaa 46460



to top

>gb|AC124228.16| Mus musculus chromosome 5, clone RP23-345O14, complete sequence
          Length = 219244

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 107    aacaagcaaacaaacaaaaaa 127
              |||||||||||||||||||||
Sbjct: 130365 aacaagcaaacaaacaaaaaa 130385



to top

>gb|AC161809.3| Mus musculus chromosome 1, clone RP23-114N13, complete sequence
          Length = 213778

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 107    aacaagcaaacaaacaaaaaa 127
              |||||||||||||||||||||
Sbjct: 147416 aacaagcaaacaaacaaaaaa 147436



to top

>gb|AC146536.3| Dasypus novemcinctus clone VMRC5-215B23, complete sequence
          Length = 113776

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 107   aacaagcaaacaaacaaaaaa 127
             |||||||||||||||||||||
Sbjct: 39213 aacaagcaaacaaacaaaaaa 39233



to top

>gb|AC005213.1| Homo sapiens chromosome 5, BAC clone 84E9 (LBNL H120), complete
             sequence
          Length = 102431

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 107   aacaagcaaacaaacaaaaaa 127
             |||||||||||||||||||||
Sbjct: 94525 aacaagcaaacaaacaaaaaa 94545



to top

>gb|AC093481.8| Mus musculus chromosome 18, clone RP23-62E19, complete sequence
          Length = 242587

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 106    gaacaagcaaacaaacaaaaa 126
              |||||||||||||||||||||
Sbjct: 130701 gaacaagcaaacaaacaaaaa 130681



to top

>gb|AC101715.8| Mus musculus chromosome 1, clone RP23-283P17, complete sequence
          Length = 148387

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 107    aacaagcaaacaaacaaaaaa 127
              |||||||||||||||||||||
Sbjct: 105999 aacaagcaaacaaacaaaaaa 106019



to top

>gb|AC161262.2| Mus musculus BAC clone RP23-325G1 from chromosome 9, complete sequence
          Length = 204750

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 107    aacaagcaaacaaacaaaaaa 127
              |||||||||||||||||||||
Sbjct: 187049 aacaagcaaacaaacaaaaaa 187069



to top

>gb|AC161416.2| Mus musculus BAC clone RP23-306A2 from chromosome 1, complete sequence
          Length = 196764

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 107   aacaagcaaacaaacaaaaaa 127
             |||||||||||||||||||||
Sbjct: 59000 aacaagcaaacaaacaaaaaa 58980



to top

>gb|AC159635.2| Mus musculus BAC clone RP24-111I3 from chromosome 12, complete sequence
          Length = 168623

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 107    aacaagcaaacaaacaaaaaa 127
              |||||||||||||||||||||
Sbjct: 167273 aacaagcaaacaaacaaaaaa 167253



to top

>gb|AC153977.4| Mus musculus 10 BAC RP24-270K22 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 163035

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 107    aacaagcaaacaaacaaaaaa 127
              |||||||||||||||||||||
Sbjct: 126552 aacaagcaaacaaacaaaaaa 126532



to top

>gb|AC102654.7| Mus musculus chromosome 1, clone RP23-2K13, complete sequence
          Length = 245404

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 107   aacaagcaaacaaacaaaaaa 127
             |||||||||||||||||||||
Sbjct: 61650 aacaagcaaacaaacaaaaaa 61670



to top

>gb|AC151571.1| Latimeria menadoensis clone VMRC4-140H19, complete sequence
          Length = 187392

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 107   aacaagcaaacaaacaaaaaa 127
             |||||||||||||||||||||
Sbjct: 56070 aacaagcaaacaaacaaaaaa 56090



to top

>gb|AC120875.12| Mus musculus chromosome 1, clone RP23-317M5, complete sequence
          Length = 195159

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 107   aacaagcaaacaaacaaaaaa 127
             |||||||||||||||||||||
Sbjct: 55717 aacaagcaaacaaacaaaaaa 55697



to top

>gb|AY267034.1| Mus musculus cadherin 7 precursor, mRNA, complete cds
          Length = 3408

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 107  aacaagcaaacaaacaaaaaa 127
            |||||||||||||||||||||
Sbjct: 2813 aacaagcaaacaaacaaaaaa 2793



to top

>gb|AC124323.10| Mus musculus chromosome 19, clone RP24-444B6, complete sequence
          Length = 150803

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 107   aacaagcaaacaaacaaaaaa 127
             |||||||||||||||||||||
Sbjct: 70059 aacaagcaaacaaacaaaaaa 70039



to top

>gb|AC137978.8| Mus musculus chromosome 1, clone RP24-468M12, complete sequence
          Length = 181633

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 107    aacaagcaaacaaacaaaaaa 127
              |||||||||||||||||||||
Sbjct: 136757 aacaagcaaacaaacaaaaaa 136737



to top

>gb|AC113104.15| Mus musculus chromosome 18, clone RP23-321L15, complete sequence
          Length = 207418

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 107    aacaagcaaacaaacaaaaaa 127
              |||||||||||||||||||||
Sbjct: 191304 aacaagcaaacaaacaaaaaa 191284



to top

>gb|AC105968.14| Mus musculus chromosome 18, clone RP23-265P4, complete sequence
          Length = 210819

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 107  aacaagcaaacaaacaaaaaa 127
            |||||||||||||||||||||
Sbjct: 5846 aacaagcaaacaaacaaaaaa 5826



to top

>gb|AC117994.12| Mus musculus chromosome 6, clone RP23-25K2, complete sequence
          Length = 237945

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 107    aacaagcaaacaaacaaaaaa 127
              |||||||||||||||||||||
Sbjct: 193941 aacaagcaaacaaacaaaaaa 193921



to top

>gb|AC091333.6| Mus musculus chromosome 7, clone RP23-325M1, complete sequence
          Length = 192111

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 107   aacaagcaaacaaacaaaaaa 127
             |||||||||||||||||||||
Sbjct: 62677 aacaagcaaacaaacaaaaaa 62657



to top

>gb|AC117570.11| Mus musculus chromosome 9, clone RP23-18M12, complete sequence
          Length = 238598

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 107  aacaagcaaacaaacaaaaaa 127
            |||||||||||||||||||||
Sbjct: 1758 aacaagcaaacaaacaaaaaa 1738



to top

>gb|AC102342.10| Mus musculus chromosome 18, clone RP23-250K3, complete sequence
          Length = 168009

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 107   aacaagcaaacaaacaaaaaa 127
             |||||||||||||||||||||
Sbjct: 62581 aacaagcaaacaaacaaaaaa 62601



to top

>ref|XM_429676.1| PREDICTED: Gallus gallus LOC419550 (LOC419550), mRNA
          Length = 655

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 107 aacaagcaaacaaacaaaaaa 127
           |||||||||||||||||||||
Sbjct: 119 aacaagcaaacaaacaaaaaa 139



to top

>gb|AC166334.8| Mus musculus chromosome 7, clone RP23-470P9, complete sequence
          Length = 171861

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 107   aacaagcaaacaaacaaaaaa 127
             |||||||||||||||||||||
Sbjct: 24514 aacaagcaaacaaacaaaaaa 24494



to top

>gb|AF241726.3| Homo sapiens chromosome X, clones RP5-819E23 and RP1-137P19, Map p11.4,
             complete sequences
          Length = 244978

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 107   aacaagcaaacaaacaaaaaa 127
             |||||||||||||||||||||
Sbjct: 35628 aacaagcaaacaaacaaaaaa 35648



to top

>gb|AC101983.16| Mus musculus chromosome 6, clone RP24-352A8, complete sequence
          Length = 153860

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 107   aacaagcaaacaaacaaaaaa 127
             |||||||||||||||||||||
Sbjct: 95932 aacaagcaaacaaacaaaaaa 95912



to top

>gb|AC101794.5| Mus musculus chromosome 1, clone RP24-188N24, complete sequence
          Length = 136946

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 107   aacaagcaaacaaacaaaaaa 127
             |||||||||||||||||||||
Sbjct: 34660 aacaagcaaacaaacaaaaaa 34680



to top

>gb|AC118047.7| Mus musculus chromosome 3, clone RP24-219P20, complete sequence
          Length = 159930

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 107   aacaagcaaacaaacaaaaaa 127
             |||||||||||||||||||||
Sbjct: 91664 aacaagcaaacaaacaaaaaa 91684



to top

>gb|AC135672.4| Mus musculus BAC clone RP23-449K22 from chromosome 9, complete sequence
          Length = 162356

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 107    aacaagcaaacaaacaaaaaa 127
              |||||||||||||||||||||
Sbjct: 121390 aacaagcaaacaaacaaaaaa 121410



to top

>gb|AC140364.4| Mus musculus BAC clone RP24-75K5 from chromosome 5, complete sequence
          Length = 234652

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 107    aacaagcaaacaaacaaaaaa 127
              |||||||||||||||||||||
Sbjct: 225760 aacaagcaaacaaacaaaaaa 225740



to top

>ref|NM_204181.1| Gallus gallus cholinergic receptor, nicotinic, alpha 7 (CHRNA7), mRNA
          Length = 2696

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 107  aacaagcaaacaaacaaaaaa 127
            |||||||||||||||||||||
Sbjct: 1591 aacaagcaaacaaacaaaaaa 1571



to top

>gb|AC123747.26| Mus musculus chromosome 3, clone RP24-123I12, complete sequence
          Length = 188946

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 107   aacaagcaaacaaacaaaaaa 127
             |||||||||||||||||||||
Sbjct: 90331 aacaagcaaacaaacaaaaaa 90311



to top

>gb|AC102497.7| Mus musculus chromosome 18, clone RP24-570C15, complete sequence
          Length = 165977

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 107    aacaagcaaacaaacaaaaaa 127
              |||||||||||||||||||||
Sbjct: 161927 aacaagcaaacaaacaaaaaa 161907



to top

>gb|AC111059.9| Mus musculus chromosome 15, clone RP24-495D8, complete sequence
          Length = 124519

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 107  aacaagcaaacaaacaaaaaa 127
            |||||||||||||||||||||
Sbjct: 8842 aacaagcaaacaaacaaaaaa 8822



to top

>gb|AC100212.8| Mus musculus chromosome 18, clone RP23-60D22, complete sequence
          Length = 225698

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 107    aacaagcaaacaaacaaaaaa 127
              |||||||||||||||||||||
Sbjct: 189836 aacaagcaaacaaacaaaaaa 189816



to top

>gb|AC107274.11| Rattus norvegicus 18 BAC CH230-207M17 (Children's Hospital Oakland
            Research Institute) complete sequence
          Length = 217066

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 107  aacaagcaaacaaacaaaaaa 127
            |||||||||||||||||||||
Sbjct: 1638 aacaagcaaacaaacaaaaaa 1618



to top

>ref|NG_000008.6| Homo sapiens cytochrome P450, family 2, subfamily A (CYP2A) on chromosome
              19
          Length = 413528

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 107    aacaagcaaacaaacaaaaaa 127
              |||||||||||||||||||||
Sbjct: 197131 aacaagcaaacaaacaaaaaa 197111



to top

>gb|AC112938.11| Mus musculus chromosome 5, clone RP24-72E12, complete sequence
          Length = 235924

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 107    aacaagcaaacaaacaaaaaa 127
              |||||||||||||||||||||
Sbjct: 160207 aacaagcaaacaaacaaaaaa 160187



to top

>gb|AC121785.3| Mus musculus BAC clone RP23-382K4 from chromosome 3, complete sequence
          Length = 197272

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 107   aacaagcaaacaaacaaaaaa 127
             |||||||||||||||||||||
Sbjct: 65707 aacaagcaaacaaacaaaaaa 65727



to top

>gb|AC127546.4| Mus musculus BAC clone RP24-485N8 from chromosome 7, complete sequence
          Length = 151861

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 107   aacaagcaaacaaacaaaaaa 127
             |||||||||||||||||||||
Sbjct: 53135 aacaagcaaacaaacaaaaaa 53115



to top

>gb|AC139376.3| Mus musculus BAC clone RP24-420A20 from chromosome 10, complete sequence
          Length = 184039

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 107    aacaagcaaacaaacaaaaaa 127
              |||||||||||||||||||||
Sbjct: 110468 aacaagcaaacaaacaaaaaa 110448



to top

>gb|AC127572.3| Mus musculus BAC clone RP24-231A11 from chromosome Y, complete sequence
          Length = 134145

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 107   aacaagcaaacaaacaaaaaa 127
             |||||||||||||||||||||
Sbjct: 61308 aacaagcaaacaaacaaaaaa 61328


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,008,426
Number of Sequences: 3902068
Number of extensions: 4008426
Number of successful extensions: 554593
Number of sequences better than 10.0: 1906
Number of HSP's better than 10.0 without gapping: 1900
Number of HSP's successfully gapped in prelim test: 7
Number of HSP's that attempted gapping in prelim test: 530781
Number of HSP's gapped (non-prelim): 23811
length of query: 424
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 402
effective length of database: 17,147,199,772
effective search space: 6893174308344
effective search space used: 6893174308344
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top