ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl02e09
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC121811.2| Mus musculus BAC clone RP23-453O15 from 5, comple... 44 0.35
2gb|DQ366717.1| Uncultured Prochlorococcus marinus clone ASNC3046... 42 1.4
3gb|AC160562.2| Mus musculus BAC clone RP23-9A12 from chromosome ... 42 1.4
4emb|AL591967.11| Mouse DNA sequence from clone RP23-143E11 on ch... 42 1.4
5gb|BC063814.1| Homo sapiens glutamate receptor, ionotropic, kain... 40 5.5
6gb|DQ159934.1| Macaca fascicularis GluR6 (GRIK2) mRNA, complete cds 40 5.5
7ref|XM_640817.1| Dictyostelium discoideum hypothetical protein (... 40 5.5
8gb|U23169.2| Caenorhabditis elegans cosmid C29H12, complete sequ... 40 5.5
9ref|NM_175768.1| Homo sapiens glutamate receptor, ionotropic, ka... 40 5.5
10ref|NM_021956.2| Homo sapiens glutamate receptor, ionotropic, ka... 40 5.5
11ref|XM_866973.1| PREDICTED: Bos taurus similar to glutamate rece... 40 5.5
12ref|XM_426186.1| PREDICTED: Gallus gallus similar to glutamate r... 40 5.5
13ref|NM_010349.1| Mus musculus glutamate receptor, ionotropic, ka... 40 5.5
14gb|AC149481.1| Populus trichocarpa clone Pop1-16J18, complete se... 40 5.5
15gb|AC149541.1| Populus trichocarpa clone Pop1-12C14, complete se... 40 5.5
16ref|NM_019309.1| Rattus norvegicus glutamate receptor, ionotropi... 40 5.5
17gb|AY524769.1| Canis familiaris ionotropic kainate 2 (Grik2) mRN... 40 5.5
18ref|XM_539059.2| PREDICTED: Canis familiaris similar to glutamat... 40 5.5
19emb|Z11548.1|RNGLUR6MR R.norvegicus cDNA for glutamate receptor ... 40 5.5
20emb|Z11715.1|RNGLUR6 R.norvegicus mRNA for kainate receptor 40 5.5
21emb|X66117.1|MMGLUR6C M.musculus mRNA for glutamate receptor sub... 40 5.5
22emb|AL161557.2|ATCHRIV57 Arabidopsis thaliana DNA chromosome 4, ... 40 5.5
23emb|AL033545.2|ATF7K2 Arabidopsis thaliana DNA chromosome 4, BAC... 40 5.5
24emb|AJ301610.1|HSA301610 Homo sapiens mRNA for GluR6 kainate rec... 40 5.5
25emb|AJ301609.1|HSA301609 Homo sapiens partial mRNA for GluR6 kai... 40 5.5
26emb|AJ301608.1|HSA301608 Homo sapiens partial mRNA for GluR6 kai... 40 5.5
27emb|AJ252246.1|HSA252246 Homo sapiens mRNA for kainate receptor ... 40 5.5
28emb|BX927332.8| Zebrafish DNA sequence from clone CH211-263M18 i... 40 5.5
29gb|AC154397.8| Mus musculus chromosome 7, clone RP23-53N23, comp... 40 5.5
30emb|AL645667.14| Mouse DNA sequence from clone RP23-316N16 on ch... 40 5.5
31gb|AC012014.20| Homo sapiens 3 BAC RP11-255N4 (Roswell Park Canc... 40 5.5
32ref|XM_579430.1| PREDICTED: Rattus norvegicus glutamate receptor... 40 5.5
33gb|AF149015.1|AF149015 Pneumocystis carinii f. sp. ratti major s... 40 5.5
34dbj|AP006197.1| Homo sapiens genomic DNA, chromosome 6, clone:RP... 40 5.5
35emb|AL844511.14| Mouse DNA sequence from clone RP23-244B6 on chr... 40 5.5
36gb|U16126.1|HSU16126 Human glutamate/kainate receptor subunit (E... 40 5.5
37emb|AL132975.1|ATT22E16 Arabidopsis thaliana DNA chromosome 3, B... 40 5.5
38emb|AL359174.14| Human DNA sequence from clone RP11-423D17 on ch... 40 5.5
39gb|AC153953.2| Mus musculus 10 BAC RP24-394B11 (Roswell Park Can... 40 5.5
40dbj|D10054.1| Mus musculus mRNA for glutamate receptor channel s... 40 5.5
41dbj|AP002530.2| Homo sapiens genomic DNA, chromosome 6q21, anti-... 40 5.5
42dbj|AB041512.1| Homo sapiens genomic DNA, chromosome 6q21, clone... 40 5.5 
>gb|AC121811.2| Mus musculus BAC clone RP23-453O15 from 5, complete sequence
          Length = 190798

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 389   ttctttgaagaattgattgttc 410
             ||||||||||||||||||||||
Sbjct: 45216 ttctttgaagaattgattgttc 45195
to top
>gb|DQ366717.1| Uncultured Prochlorococcus marinus clone ASNC3046 genomic sequence
          Length = 33332

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 327   ttatagcttcattctcaattt 347
             |||||||||||||||||||||
Sbjct: 17542 ttatagcttcattctcaattt 17522
to top
>gb|AC160562.2| Mus musculus BAC clone RP23-9A12 from chromosome 9, complete sequence
          Length = 241034

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 369   aagagttctgtcttgatccat 389
             |||||||||||||||||||||
Sbjct: 84007 aagagttctgtcttgatccat 84027
to top
>emb|AL591967.11| Mouse DNA sequence from clone RP23-143E11 on chromosome 2, complete
            sequence
          Length = 124280

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 275  caggattgtgaagagtgggaa 295
            |||||||||||||||||||||
Sbjct: 3792 caggattgtgaagagtgggaa 3812
to top
>gb|BC063814.1| Homo sapiens glutamate receptor, ionotropic, kainate 2, mRNA (cDNA
            clone MGC:74427 IMAGE:6189201), complete cds
          Length = 2233

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 254  ttgcggtacaaaatacttat 273
            ||||||||||||||||||||
Sbjct: 1834 ttgcggtacaaaatacttat 1815
to top
>gb|DQ159934.1| Macaca fascicularis GluR6 (GRIK2) mRNA, complete cds
          Length = 2729

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 254  ttgcggtacaaaatacttat 273
            ||||||||||||||||||||
Sbjct: 1631 ttgcggtacaaaatacttat 1612
to top
>ref|XM_640817.1| Dictyostelium discoideum hypothetical protein (DDB0190208), partial
            mRNA
          Length = 9444

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 388  attctttgaagaattgattg 407
            ||||||||||||||||||||
Sbjct: 6665 attctttgaagaattgattg 6646
to top
>gb|U23169.2| Caenorhabditis elegans cosmid C29H12, complete sequence
          Length = 46535

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 354   aaaagtatttgatggaagag 373
             ||||||||||||||||||||
Sbjct: 36909 aaaagtatttgatggaagag 36890
to top
>ref|NM_175768.1| Homo sapiens glutamate receptor, ionotropic, kainate 2 (GRIK2),
            transcript variant 2, mRNA
          Length = 3409

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 254  ttgcggtacaaaatacttat 273
            ||||||||||||||||||||
Sbjct: 1831 ttgcggtacaaaatacttat 1812
to top
>ref|NM_021956.2| Homo sapiens glutamate receptor, ionotropic, kainate 2 (GRIK2),
            transcript variant 1, mRNA
          Length = 3322

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 254  ttgcggtacaaaatacttat 273
            ||||||||||||||||||||
Sbjct: 1831 ttgcggtacaaaatacttat 1812
to top
>ref|XM_866973.1| PREDICTED: Bos taurus similar to glutamate receptor 6 isoform 1
           precursor (LOC615226), partial mRNA
          Length = 1189

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 254 ttgcggtacaaaatacttat 273
           ||||||||||||||||||||
Sbjct: 680 ttgcggtacaaaatacttat 661
to top
>ref|XM_426186.1| PREDICTED: Gallus gallus similar to glutamate receptor 6 isoform 1
            precursor; excitatory amino acid receptor 4 (LOC428628),
            mRNA
          Length = 4482

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 254  ttgcggtacaaaatacttat 273
            ||||||||||||||||||||
Sbjct: 2876 ttgcggtacaaaatacttat 2857
to top
>ref|NM_010349.1| Mus musculus glutamate receptor, ionotropic, kainate 2 (beta 2)
            (Grik2), mRNA
          Length = 3109

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 254  ttgcggtacaaaatacttat 273
            ||||||||||||||||||||
Sbjct: 1781 ttgcggtacaaaatacttat 1762
to top
>gb|AC149481.1| Populus trichocarpa clone Pop1-16J18, complete sequence
          Length = 120131

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 248  tctgttttgcggtacaaaat 267
            ||||||||||||||||||||
Sbjct: 7102 tctgttttgcggtacaaaat 7121
to top
>gb|AC149541.1| Populus trichocarpa clone Pop1-12C14, complete sequence
          Length = 88772

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 248   tctgttttgcggtacaaaat 267
             ||||||||||||||||||||
Sbjct: 21794 tctgttttgcggtacaaaat 21813
to top
>ref|NM_019309.1| Rattus norvegicus glutamate receptor, ionotropic, kainate 2 (Grik2),
            mRNA
          Length = 4554

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 254  ttgcggtacaaaatacttat 273
            ||||||||||||||||||||
Sbjct: 1931 ttgcggtacaaaatacttat 1912
to top
>gb|AY524769.1| Canis familiaris ionotropic kainate 2 (Grik2) mRNA, partial
           sequence
          Length = 731

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 254 ttgcggtacaaaatacttat 273
           ||||||||||||||||||||
Sbjct: 347 ttgcggtacaaaatacttat 328
to top
>ref|XM_539059.2| PREDICTED: Canis familiaris similar to glutamate receptor 6 isoform 1
            precursor (LOC481938), mRNA
          Length = 2803

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 254  ttgcggtacaaaatacttat 273
            ||||||||||||||||||||
Sbjct: 1601 ttgcggtacaaaatacttat 1582
to top
>emb|Z11548.1|RNGLUR6MR R.norvegicus cDNA for glutamate receptor subunit (GluR6), kainate
            subtype
          Length = 4554

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 254  ttgcggtacaaaatacttat 273
            ||||||||||||||||||||
Sbjct: 1931 ttgcggtacaaaatacttat 1912
to top
>emb|Z11715.1|RNGLUR6 R.norvegicus mRNA for kainate receptor
          Length = 2839

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 254  ttgcggtacaaaatacttat 273
            ||||||||||||||||||||
Sbjct: 1709 ttgcggtacaaaatacttat 1690
to top
>emb|X66117.1|MMGLUR6C M.musculus mRNA for glutamate receptor subunit GluR6-2
          Length = 3109

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 254  ttgcggtacaaaatacttat 273
            ||||||||||||||||||||
Sbjct: 1781 ttgcggtacaaaatacttat 1762
to top
>emb|AL161557.2|ATCHRIV57 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 57
          Length = 199577

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 267   tacttatacaggattgtgaa 286
             ||||||||||||||||||||
Sbjct: 93188 tacttatacaggattgtgaa 93169
to top
>emb|AL033545.2|ATF7K2 Arabidopsis thaliana DNA chromosome 4, BAC clone F7K2 (ESSA project)
          Length = 106702

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 267   tacttatacaggattgtgaa 286
             ||||||||||||||||||||
Sbjct: 44380 tacttatacaggattgtgaa 44361
to top
>emb|AJ301610.1|HSA301610 Homo sapiens mRNA for GluR6 kainate receptor (GRIK2 gene), isoform-b
          Length = 2692

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 254  ttgcggtacaaaatacttat 273
            ||||||||||||||||||||
Sbjct: 1631 ttgcggtacaaaatacttat 1612
to top
>emb|AJ301609.1|HSA301609 Homo sapiens partial mRNA for GluR6 kainate receptor (GRIK2 gene),
           exons 10, 11 and 13
          Length = 235

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 254 ttgcggtacaaaatacttat 273
           ||||||||||||||||||||
Sbjct: 111 ttgcggtacaaaatacttat 92
to top
>emb|AJ301608.1|HSA301608 Homo sapiens partial mRNA for GluR6 kainate receptor (GRIK2 gene),
           exons 11, 13 and 14
          Length = 351

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 254 ttgcggtacaaaatacttat 273
           ||||||||||||||||||||
Sbjct: 107 ttgcggtacaaaatacttat 88
to top
>emb|AJ252246.1|HSA252246 Homo sapiens mRNA for kainate receptor subunit (GRIK2 gene)
          Length = 2859

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 254  ttgcggtacaaaatacttat 273
            ||||||||||||||||||||
Sbjct: 1631 ttgcggtacaaaatacttat 1612
to top
>emb|BX927332.8| Zebrafish DNA sequence from clone CH211-263M18 in linkage group 21,
             complete sequence
          Length = 90206

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 372   agttctgtcttgatccattc 391
             ||||||||||||||||||||
Sbjct: 82306 agttctgtcttgatccattc 82287
to top
>gb|AC154397.8| Mus musculus chromosome 7, clone RP23-53N23, complete sequence
          Length = 273314

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 276    aggattgtgaagagtgggaa 295
              ||||||||||||||||||||
Sbjct: 185386 aggattgtgaagagtgggaa 185405
to top
>emb|AL645667.14| Mouse DNA sequence from clone RP23-316N16 on chromosome 13 contains the
             vomeronasal receptor 1 H1 pseudogene V1rh1, the V1rh3,
             V1ri4, V1ri7 and V1rh11 genes for vomeronasal receptors 1
             H3, I4, I7 and H11, three vomeronasal receptors 1 H
             pseudogenes, a vomeronasal receptor 1 I pseudogene,  an
             ABC transporter pseudogene, the gene for a novel
             vomeronasal receptor 1, I family member, a novel gene and
             two CpG islands, complete sequence
          Length = 179902

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 310   tatgatataccccaaaatta 329
             ||||||||||||||||||||
Sbjct: 17455 tatgatataccccaaaatta 17474
to top
>gb|AC012014.20| Homo sapiens 3 BAC RP11-255N4 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 199523

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 39     gtacttacaaccaaaccata 58
              ||||||||||||||||||||
Sbjct: 120378 gtacttacaaccaaaccata 120397
to top
>ref|XM_579430.1| PREDICTED: Rattus norvegicus glutamate receptor, ionotropic, kainate
            2 (Grik2), mRNA
          Length = 4137

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 254  ttgcggtacaaaatacttat 273
            ||||||||||||||||||||
Sbjct: 1516 ttgcggtacaaaatacttat 1497
to top
>gb|AF149015.1|AF149015 Pneumocystis carinii f. sp. ratti major surface glycoprotein R7a
            (R7a) gene, partial cds; and major surface glycoprotein
            R7b (R7b) gene, partial cds
          Length = 3459

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 385  tccattctttgaagaattga 404
            ||||||||||||||||||||
Sbjct: 2979 tccattctttgaagaattga 2998
to top
>dbj|AP006197.1| Homo sapiens genomic DNA, chromosome 6, clone:RP11-360J22, complete
              sequence
          Length = 159320

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 254    ttgcggtacaaaatacttat 273
              ||||||||||||||||||||
Sbjct: 127467 ttgcggtacaaaatacttat 127448
to top
>emb|AL844511.14| Mouse DNA sequence from clone RP23-244B6 on chromosome 2, complete
             sequence
          Length = 144077

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 310   tatgatataccccaaaatta 329
             ||||||||||||||||||||
Sbjct: 55379 tatgatataccccaaaatta 55360
to top
>gb|U16126.1|HSU16126 Human glutamate/kainate receptor subunit (EAA4) mRNA, complete cds
          Length = 2727

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 254  ttgcggtacaaaatacttat 273
            ||||||||||||||||||||
Sbjct: 1631 ttgcggtacaaaatacttat 1612
to top
>emb|AL132975.1|ATT22E16 Arabidopsis thaliana DNA chromosome 3, BAC clone T22E16
          Length = 103240

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 386   ccattctttgaagaattgat 405
             ||||||||||||||||||||
Sbjct: 54355 ccattctttgaagaattgat 54374
to top
>emb|AL359174.14| Human DNA sequence from clone RP11-423D17 on chromosome 6, complete
             sequence
          Length = 146372

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   ttgcggtacaaaatacttat 273
             ||||||||||||||||||||
Sbjct: 84626 ttgcggtacaaaatacttat 84607
to top
>gb|AC153953.2| Mus musculus 10 BAC RP24-394B11 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 163098

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   ttgcggtacaaaatacttat 273
             ||||||||||||||||||||
Sbjct: 35294 ttgcggtacaaaatacttat 35313
to top
>dbj|D10054.1| Mus musculus mRNA for glutamate receptor channel subunit beta-2,
            complete cds
          Length = 2993

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 254  ttgcggtacaaaatacttat 273
            ||||||||||||||||||||
Sbjct: 1957 ttgcggtacaaaatacttat 1938
to top
>dbj|AP002530.2| Homo sapiens genomic DNA, chromosome 6q21, anti-oncogene region,
             section 3/4
          Length = 300000

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   ttgcggtacaaaatacttat 273
             ||||||||||||||||||||
Sbjct: 60654 ttgcggtacaaaatacttat 60635
to top
>dbj|AB041512.1| Homo sapiens genomic DNA, chromosome 6q21, clone:520L4, complete
             sequence
          Length = 102910

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   ttgcggtacaaaatacttat 273
             ||||||||||||||||||||
Sbjct: 80637 ttgcggtacaaaatacttat 80618


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,864,254
Number of Sequences: 3902068
Number of extensions: 3864254
Number of successful extensions: 109608
Number of sequences better than 10.0: 42
Number of HSP's better than 10.0 without gapping: 42
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 109551
Number of HSP's gapped (non-prelim): 57
length of query: 413
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 391
effective length of database: 17,147,199,772
effective search space: 6704555110852
effective search space used: 6704555110852
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top