Clone Name | rbastl02e08 |
---|---|
Clone Library Name | barley_pub |
>gb|AY736121.1| Triticum aestivum ubiquitin-conjugating enzyme mRNA, complete cds Length = 460 Score = 281 bits (142), Expect = 8e-73 Identities = 157/162 (96%) Strand = Plus / Minus Query: 228 gctctagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccg 287 ||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| Sbjct: 460 gctctagcccatggcgtacttctgtgtccaggagcgcgccgtggactcgtacttggcccg 401 Query: 288 atcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgt 347 ||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| Sbjct: 400 atcagtcttgtacatgtgagcgatctcgggcaccagaggatcatcggggttcgggtccgt 341 Query: 348 cagcaacgaacagattgacaggaggacctttgatatggtcaa 389 ||||||||||||||||||||| |||||||||||||||||||| Sbjct: 340 cagcaacgaacagattgacagcaggacctttgatatggtcaa 299
>dbj|AK119682.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-A01, full insert sequence Length = 832 Score = 198 bits (100), Expect = 9e-48 Identities = 145/160 (90%) Strand = Plus / Minus Query: 227 ggctctagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggccc 286 |||| ||||||||||||||||| |||||||||||||| || | ||| || |||||||||| Sbjct: 606 ggctttagcccatggcgtacttctgtgtccaggagcgagcggtggattcatacttggccc 547 Query: 287 gatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccg 346 ||||||||||||||||||||| ||||| |||||||| |||||||| ||||||||||||| Sbjct: 546 tatcagtcttgtacatgtgagcaatctccggcaccaacggatcatcggggttcgggtccg 487 Query: 347 tcagcaacgaacagattgacaggaggacctttgatatggt 386 |||||| ||||| |||||||||||||||||||||||||| Sbjct: 486 tcagcagtgaacaaattgacaggaggacctttgatatggt 447 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gtcaggtagaacagactacc 52 |||||||||||||||||||| Sbjct: 783 gtcaggtagaacagactacc 764
>ref|XM_474269.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 447 Score = 196 bits (99), Expect = 4e-47 Identities = 141/155 (90%) Strand = Plus / Minus Query: 232 tagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatca 291 ||||||||||||||||| |||||||||||||| || | ||| || |||||||||| |||| Sbjct: 446 tagcccatggcgtacttctgtgtccaggagcgagcggtggattcatacttggccctatca 387 Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagc 351 ||||||||||||||||| ||||| |||||||| |||||||| |||||||||||||||||| Sbjct: 386 gtcttgtacatgtgagcaatctccggcaccaacggatcatcggggttcgggtccgtcagc 327 Query: 352 aacgaacagattgacaggaggacctttgatatggt 386 | ||||| |||||||||||||||||||||||||| Sbjct: 326 agtgaacaaattgacaggaggacctttgatatggt 292
>emb|AL606619.3|OSJN00032 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0043A12, complete sequence Length = 190432 Score = 178 bits (90), Expect = 9e-42 Identities = 135/150 (90%) Strand = Plus / Plus Query: 227 ggctctagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggccc 286 |||| ||||||||||||||||| |||||||||||||| || | ||| || |||||||||| Sbjct: 33583 ggctttagcccatggcgtacttctgtgtccaggagcgagcggtggattcatacttggccc 33642 Query: 287 gatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccg 346 ||||||||||||||||||||| ||||| |||||||| |||||||| ||||||||||||| Sbjct: 33643 tatcagtcttgtacatgtgagcaatctccggcaccaacggatcatcggggttcgggtccg 33702 Query: 347 tcagcaacgaacagattgacaggaggacct 376 |||||| ||||| |||||||||||||||| Sbjct: 33703 tcagcagtgaacaaattgacaggaggacct 33732 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gtcaggtagaacagactacc 52 |||||||||||||||||||| Sbjct: 33406 gtcaggtagaacagactacc 33425
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 178 bits (90), Expect = 9e-42 Identities = 135/150 (90%) Strand = Plus / Plus Query: 227 ggctctagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggccc 286 |||| ||||||||||||||||| |||||||||||||| || | ||| || |||||||||| Sbjct: 34122201 ggctttagcccatggcgtacttctgtgtccaggagcgagcggtggattcatacttggccc 34122260 Query: 287 gatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccg 346 ||||||||||||||||||||| ||||| |||||||| |||||||| ||||||||||||| Sbjct: 34122261 tatcagtcttgtacatgtgagcaatctccggcaccaacggatcatcggggttcgggtccg 34122320 Query: 347 tcagcaacgaacagattgacaggaggacct 376 |||||| ||||| |||||||||||||||| Sbjct: 34122321 tcagcagtgaacaaattgacaggaggacct 34122350 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gtcaggtagaacagactacc 52 |||||||||||||||||||| Sbjct: 34122024 gtcaggtagaacagactacc 34122043
>dbj|AK104783.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-D03, full insert sequence Length = 1071 Score = 178 bits (90), Expect = 9e-42 Identities = 135/150 (90%) Strand = Plus / Minus Query: 227 ggctctagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggccc 286 |||| ||||||||||||||||| |||||||||||||| || | ||| || |||||||||| Sbjct: 845 ggctttagcccatggcgtacttctgtgtccaggagcgagcggtggattcatacttggccc 786 Query: 287 gatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccg 346 ||||||||||||||||||||| ||||| |||||||| |||||||| ||||||||||||| Sbjct: 785 tatcagtcttgtacatgtgagcaatctccggcaccaacggatcatcggggttcgggtccg 726 Query: 347 tcagcaacgaacagattgacaggaggacct 376 |||||| ||||| |||||||||||||||| Sbjct: 725 tcagcagtgaacaaattgacaggaggacct 696 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gtcaggtagaacagactacc 52 |||||||||||||||||||| Sbjct: 1022 gtcaggtagaacagactacc 1003
>dbj|AK060954.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-201-G05, full insert sequence Length = 1071 Score = 178 bits (90), Expect = 9e-42 Identities = 135/150 (90%) Strand = Plus / Minus Query: 227 ggctctagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggccc 286 |||| ||||||||||||||||| |||||||||||||| || | ||| || |||||||||| Sbjct: 845 ggctttagcccatggcgtacttctgtgtccaggagcgagcggtggattcatacttggccc 786 Query: 287 gatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccg 346 ||||||||||||||||||||| ||||| |||||||| |||||||| ||||||||||||| Sbjct: 785 tatcagtcttgtacatgtgagcaatctccggcaccaacggatcatcggggttcgggtccg 726 Query: 347 tcagcaacgaacagattgacaggaggacct 376 |||||| ||||| |||||||||||||||| Sbjct: 725 tcagcagtgaacaaattgacaggaggacct 696 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 33 gtcaggtagaacagactacc 52 |||||||||||||||||||| Sbjct: 1022 gtcaggtagaacagactacc 1003
>emb|AL732340.3| Oryza sativa genomic DNA, chromosome 4, BAC clone: B0811B10, complete sequence Length = 99356 Score = 178 bits (90), Expect = 9e-42 Identities = 135/150 (90%) Strand = Plus / Plus Query: 227 ggctctagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggccc 286 |||| ||||||||||||||||| |||||||||||||| || | ||| || |||||||||| Sbjct: 39291 ggctttagcccatggcgtacttctgtgtccaggagcgagcggtggattcatacttggccc 39350 Query: 287 gatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccg 346 ||||||||||||||||||||| ||||| |||||||| |||||||| ||||||||||||| Sbjct: 39351 tatcagtcttgtacatgtgagcaatctccggcaccaacggatcatcggggttcgggtccg 39410 Query: 347 tcagcaacgaacagattgacaggaggacct 376 |||||| ||||| |||||||||||||||| Sbjct: 39411 tcagcagtgaacaaattgacaggaggacct 39440 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 gtcaggtagaacagactacc 52 |||||||||||||||||||| Sbjct: 39114 gtcaggtagaacagactacc 39133
>gb|BT016295.1| Zea mays clone Contig128 mRNA sequence Length = 788 Score = 141 bits (71), Expect = 2e-30 Identities = 131/151 (86%) Strand = Plus / Minus Query: 230 tctagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgat 289 ||||||||||||| ||||| |||||||||||||| || | |||||| |||||||||| | Sbjct: 573 tctagcccatggcatacttctgtgtccaggagcgtgcggtggactcatacttggccctgt 514 Query: 290 cagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtca 349 | ||||||||||||||||| ||||| || || | ||||||||||||||| |||||||| | Sbjct: 513 cggtcttgtacatgtgagcaatctcagggacaagaggatcatcagggtttgggtccgtga 454 Query: 350 gcaacgaacagattgacaggaggacctttga 380 ||| || |||||||||||||| |||||||| Sbjct: 453 gcagtgagcagattgacaggagaacctttga 423
>gb|AY109692.1| Zea mays CL301_1 mRNA sequence Length = 912 Score = 141 bits (71), Expect = 2e-30 Identities = 131/151 (86%) Strand = Plus / Minus Query: 230 tctagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgat 289 ||||||||||||| ||||| |||||||||||||| || | |||||| |||||||||| | Sbjct: 572 tctagcccatggcatacttctgtgtccaggagcgtgcggtggactcatacttggccctgt 513 Query: 290 cagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtca 349 | ||||||||||||||||| ||||| || || | ||||||||||||||| |||||||| | Sbjct: 512 cggtcttgtacatgtgagcaatctcagggacaagaggatcatcagggtttgggtccgtga 453 Query: 350 gcaacgaacagattgacaggaggacctttga 380 ||| || |||||||||||||| |||||||| Sbjct: 452 gcagtgagcagattgacaggagaacctttga 422
>dbj|D17786.1|RICKN6922 Oryza sativa KN69 mRNA for ubiquitin-conjugating enzyme, partial CDS Length = 311 Score = 131 bits (66), Expect = 2e-27 Identities = 99/110 (90%) Strand = Plus / Minus Query: 277 tacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcaggg 336 |||||||||| ||||||||||||||||||||| ||||| |||||||| |||||||| | Sbjct: 296 tacttggccctatcagtcttgtacatgtgagcaatctccggcaccaacggatcatcgccg 237 Query: 337 ttcgggtccgtcagcaacgaacagattgacaggaggacctttgatatggt 386 |||||||||||||||| ||||| |||||||| ||||||||||||||||| Sbjct: 236 ttcgggtccgtcagcagtgaacaaattgacagcaggacctttgatatggt 187
>gb|AY083611.1| Oryza sativa elicitor and UV light related transcription factor (Elr) mRNA, complete cds Length = 576 Score = 117 bits (59), Expect = 3e-23 Identities = 100/111 (90%), Gaps = 2/111 (1%) Strand = Plus / Minus Query: 277 tacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcaggg 336 |||||||||| ||||||||||||||||| ||| ||||| |||||||| |||||||| ||| Sbjct: 524 tacttggccctatcagtcttgtacatgtaagcaatctccggcaccaacggatcatcgggg 465 Query: 337 ttcgggtccgtcagcaacgaac-agattgacaggaggacctttgatatggt 386 |||||||||||||||| |||| | ||||||| |||||||||||||||||| Sbjct: 464 ttcgggtccgtcagcagtgaacaaaattgaca-gaggacctttgatatggt 415
>ref|XM_464900.1| Oryza sativa (japonica cultivar-group), mRNA Length = 728 Score = 111 bits (56), Expect = 2e-21 Identities = 104/120 (86%) Strand = Plus / Minus Query: 270 ggactcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatc 329 ||||||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||| Sbjct: 443 ggactcgtacttggcccgatcagtcttgtacatgtgagcaatctctggaaccaatggatc 384 Query: 330 atcagggttcgggtccgtcagcaacgaacagattgacaggaggacctttgatatggtcaa 389 |||||| || || ||||||| || ||| || ||||| || || |||||||| || ||||| Sbjct: 383 atcaggatttggatccgtcaacagcgagcaaattgagagtagcacctttgaaatagtcaa 324
>dbj|AK121248.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023101B08, full insert sequence Length = 729 Score = 111 bits (56), Expect = 2e-21 Identities = 104/120 (86%) Strand = Plus / Minus Query: 270 ggactcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatc 329 ||||||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||| Sbjct: 443 ggactcgtacttggcccgatcagtcttgtacatgtgagcaatctctggaaccaatggatc 384 Query: 330 atcagggttcgggtccgtcagcaacgaacagattgacaggaggacctttgatatggtcaa 389 |||||| || || ||||||| || ||| || ||||| || || |||||||| || ||||| Sbjct: 383 atcaggatttggatccgtcaacagcgagcaaattgagagtagcacctttgaaatagtcaa 324
>dbj|AB074412.1| Oryza sativa (japonica cultivar-group) mRNA for ubiquitin-conjugating enzyme OsUBC5b, complete cds Length = 574 Score = 111 bits (56), Expect = 2e-21 Identities = 104/120 (86%) Strand = Plus / Minus Query: 270 ggactcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatc 329 ||||||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||| Sbjct: 439 ggactcgtacttggcccgatcagtcttgtacatgtgagcaatctctggaaccaatggatc 380 Query: 330 atcagggttcgggtccgtcagcaacgaacagattgacaggaggacctttgatatggtcaa 389 |||||| || || ||||||| || ||| || ||||| || || |||||||| || ||||| Sbjct: 379 atcaggatttggatccgtcaacagcgagcaaattgagagtagcacctttgaaatagtcaa 320
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 103 bits (52), Expect = 4e-19 Identities = 73/80 (91%) Strand = Plus / Minus Query: 270 ggactcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatc 329 ||||||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||| Sbjct: 9118269 ggactcgtacttggcccgatcagtcttgtacatgtgagcaatctctggaaccaatggatc 9118210 Query: 330 atcagggttcgggtccgtca 349 |||||| || || ||||||| Sbjct: 9118209 atcaggatttggatccgtca 9118190 Score = 85.7 bits (43), Expect = 1e-13 Identities = 73/83 (87%) Strand = Plus / Minus Query: 286 cgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtcc 345 |||||||||||| |||| ||||||||||| ||||||| ||||| || |||||||||||| Sbjct: 1079316 cgatcagtcttgcacatatgagcgatctccggcaccagcggatcgtccgggttcgggtcc 1079257 Query: 346 gtcagcaacgaacagattgacag 368 ||||||| ||| ||||| ||||| Sbjct: 1079256 gtcagcagcgagcagatcgacag 1079234
>dbj|AP005777.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBb0026F09 Length = 124371 Score = 103 bits (52), Expect = 4e-19 Identities = 73/80 (91%) Strand = Plus / Minus Query: 270 ggactcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatc 329 ||||||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||| Sbjct: 21032 ggactcgtacttggcccgatcagtcttgtacatgtgagcaatctctggaaccaatggatc 20973 Query: 330 atcagggttcgggtccgtca 349 |||||| || || ||||||| Sbjct: 20972 atcaggatttggatccgtca 20953
>gb|DQ207855.1| Solanum tuberosum clone 078A09 ubiquitin-conjugating enzyme 8-like mRNA, complete cds Length = 757 Score = 99.6 bits (50), Expect = 7e-18 Identities = 80/90 (88%) Strand = Plus / Minus Query: 288 atcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgt 347 ||||||||||||||| ||||| |||||||||||||||||||||||||| || |||||||| Sbjct: 453 atcagtcttgtacatatgagcaatctcgggcaccaaaggatcatcaggattagggtccgt 394 Query: 348 cagcaacgaacagattgacaggaggacctt 377 |||| || ||||||||||| || ||||| Sbjct: 393 tagcagagagcagattgacagcagcacctt 364
>ref|NM_192451.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1125 Score = 95.6 bits (48), Expect = 1e-16 Identities = 84/96 (87%) Strand = Plus / Minus Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332 |||||||||| || ||| |||||||||||||| |||||||| || |||| ||||||||| Sbjct: 858 ctcgtacttgtgcctatctgtcttgtacatgtgggcgatctcagggaccagaggatcatc 799 Query: 333 agggttcgggtccgtcagcaacgaacagattgacag 368 ||||||||| || ||||||| |||||||||||||| Sbjct: 798 agggttcggatcagtcagcagggaacagattgacag 763
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 95.6 bits (48), Expect = 1e-16 Identities = 84/96 (87%) Strand = Plus / Plus Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332 |||||||||| || ||| |||||||||||||| |||||||| || |||| ||||||||| Sbjct: 26774618 ctcgtacttgtgcctatctgtcttgtacatgtgggcgatctcagggaccagaggatcatc 26774677 Query: 333 agggttcgggtccgtcagcaacgaacagattgacag 368 ||||||||| || ||||||| |||||||||||||| Sbjct: 26774678 agggttcggatcagtcagcagggaacagattgacag 26774713 Score = 50.1 bits (25), Expect = 0.005 Identities = 49/57 (85%) Strand = Plus / Plus Query: 294 cttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcag 350 ||||||| |||| ||||| || || |||| |||||||||||||||||| || ||||| Sbjct: 26766406 cttgtacgtgtgggcgatttcagggaccagaggatcatcagggttcggatcagtcag 26766462
>dbj|AP003291.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0684E06 Length = 147004 Score = 95.6 bits (48), Expect = 1e-16 Identities = 84/96 (87%) Strand = Plus / Plus Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332 |||||||||| || ||| |||||||||||||| |||||||| || |||| ||||||||| Sbjct: 10267 ctcgtacttgtgcctatctgtcttgtacatgtgggcgatctcagggaccagaggatcatc 10326 Query: 333 agggttcgggtccgtcagcaacgaacagattgacag 368 ||||||||| || ||||||| |||||||||||||| Sbjct: 10327 agggttcggatcagtcagcagggaacagattgacag 10362 Score = 50.1 bits (25), Expect = 0.005 Identities = 49/57 (85%) Strand = Plus / Plus Query: 294 cttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcag 350 ||||||| |||| ||||| || || |||| |||||||||||||||||| || ||||| Sbjct: 2055 cttgtacgtgtgggcgatttcagggaccagaggatcatcagggttcggatcagtcag 2111
>dbj|AP003294.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0694A04 Length = 141476 Score = 95.6 bits (48), Expect = 1e-16 Identities = 84/96 (87%) Strand = Plus / Plus Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332 |||||||||| || ||| |||||||||||||| |||||||| || |||| ||||||||| Sbjct: 121710 ctcgtacttgtgcctatctgtcttgtacatgtgggcgatctcagggaccagaggatcatc 121769 Query: 333 agggttcgggtccgtcagcaacgaacagattgacag 368 ||||||||| || ||||||| |||||||||||||| Sbjct: 121770 agggttcggatcagtcagcagggaacagattgacag 121805 Score = 50.1 bits (25), Expect = 0.005 Identities = 49/57 (85%) Strand = Plus / Plus Query: 294 cttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcag 350 ||||||| |||| ||||| || || |||| |||||||||||||||||| || ||||| Sbjct: 113498 cttgtacgtgtgggcgatttcagggaccagaggatcatcagggttcggatcagtcag 113554
>dbj|AK099284.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023129D13, full insert sequence Length = 754 Score = 95.6 bits (48), Expect = 1e-16 Identities = 84/96 (87%) Strand = Plus / Minus Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332 |||||||||| || ||| |||||||||||||| |||||||| || |||| ||||||||| Sbjct: 510 ctcgtacttgtgcctatctgtcttgtacatgtgggcgatctcagggaccagaggatcatc 451 Query: 333 agggttcgggtccgtcagcaacgaacagattgacag 368 ||||||||| || ||||||| |||||||||||||| Sbjct: 450 agggttcggatcagtcagcagggaacagattgacag 415
>dbj|AK063826.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-122-A09, full insert sequence Length = 767 Score = 95.6 bits (48), Expect = 1e-16 Identities = 84/96 (87%) Strand = Plus / Minus Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332 |||||||||| || ||| |||||||||||||| |||||||| || |||| ||||||||| Sbjct: 520 ctcgtacttgtgcctatctgtcttgtacatgtgggcgatctcagggaccagaggatcatc 461 Query: 333 agggttcgggtccgtcagcaacgaacagattgacag 368 ||||||||| || ||||||| |||||||||||||| Sbjct: 460 agggttcggatcagtcagcagggaacagattgacag 425
>emb|AJ867286.1| Oryza sativa (indica cultivar-group) mRNA for ubiquitin conjugating enzyme E2 (ubc4 gene) Length = 444 Score = 95.6 bits (48), Expect = 1e-16 Identities = 84/96 (87%) Strand = Plus / Minus Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332 |||||||||| || ||| |||||||||||||| |||||||| || |||| ||||||||| Sbjct: 405 ctcgtacttgtgcctatctgtcttgtacatgtgggcgatctcagggaccagaggatcatc 346 Query: 333 agggttcgggtccgtcagcaacgaacagattgacag 368 ||||||||| || ||||||| |||||||||||||| Sbjct: 345 agggttcggatcagtcagcagggaacagattgacag 310
>dbj|AB074411.1| Oryza sativa (japonica cultivar-group) mRNA for ubiquitin-conjugating enzyme OsUBC5a, complete cds Length = 731 Score = 95.6 bits (48), Expect = 1e-16 Identities = 84/96 (87%) Strand = Plus / Minus Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332 |||||||||| || ||| |||||||||||||| |||||||| || |||| ||||||||| Sbjct: 508 ctcgtacttgtgcctatctgtcttgtacatgtgggcgatctcagggaccagaggatcatc 449 Query: 333 agggttcgggtccgtcagcaacgaacagattgacag 368 ||||||||| || ||||||| |||||||||||||| Sbjct: 448 agggttcggatcagtcagcagggaacagattgacag 413
>ref|XM_463908.1| Oryza sativa (japonica cultivar-group), mRNA Length = 815 Score = 89.7 bits (45), Expect = 6e-15 Identities = 87/101 (86%) Strand = Plus / Minus Query: 286 cgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtcc 345 |||||||||||| |||| ||||||||||| ||||||| ||||| || |||||||||||| Sbjct: 479 cgatcagtcttgcacatatgagcgatctccggcaccagcggatcgtccgggttcgggtcc 420 Query: 346 gtcagcaacgaacagattgacaggaggacctttgatatggt 386 ||||||| ||| ||||| ||||| || ||||| || ||||| Sbjct: 419 gtcagcagcgagcagatcgacagaagaaccttggagatggt 379
>dbj|AK120237.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013043N18, full insert sequence Length = 815 Score = 89.7 bits (45), Expect = 6e-15 Identities = 87/101 (86%) Strand = Plus / Minus Query: 286 cgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtcc 345 |||||||||||| |||| ||||||||||| ||||||| ||||| || |||||||||||| Sbjct: 479 cgatcagtcttgcacatatgagcgatctccggcaccagcggatcgtccgggttcgggtcc 420 Query: 346 gtcagcaacgaacagattgacaggaggacctttgatatggt 386 ||||||| ||| ||||| ||||| || ||||| || ||||| Sbjct: 419 gtcagcagcgagcagatcgacagaagaaccttggagatggt 379
>gb|BT017507.1| Zea mays clone EL01N0417C02.c mRNA sequence Length = 727 Score = 87.7 bits (44), Expect = 2e-14 Identities = 80/92 (86%) Strand = Plus / Minus Query: 286 cgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtcc 345 |||||||||||||||| |||||| ||||| || ||||| ||||| |||||||| |||||| Sbjct: 495 cgatcagtcttgtacaagtgagcaatctctgggaccaacggatcgtcagggtttgggtcc 436 Query: 346 gtcagcaacgaacagattgacaggaggacctt 377 ||||| | ||||| ||||| ||||||||||| Sbjct: 435 gtcagaagggaacaaattgagaggaggacctt 404
>gb|AF154650.1| Nicotiana tabacum clone PR35 mRNA sequence Length = 671 Score = 87.7 bits (44), Expect = 2e-14 Identities = 80/92 (86%) Strand = Plus / Minus Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagc 351 ||||||||||| ||||| ||||| |||||||||||||||||||| || |||||||| ||| Sbjct: 413 gtcttgtacatatgagcaatctcaggcaccaaaggatcatcaggattagggtccgttagc 354 Query: 352 aacgaacagattgacaggaggacctttgatat 383 | |||||||| |||| ||| ||||| ||||| Sbjct: 353 agagaacagatagacatgagcaccttggatat 322
>gb|AY106353.1| Zea mays PCO068301 mRNA sequence Length = 727 Score = 87.7 bits (44), Expect = 2e-14 Identities = 80/92 (86%) Strand = Plus / Minus Query: 286 cgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtcc 345 |||||||||||||||| |||||| ||||| || ||||| ||||| |||||||| |||||| Sbjct: 533 cgatcagtcttgtacaagtgagcaatctctgggaccaacggatcgtcagggtttgggtcc 474 Query: 346 gtcagcaacgaacagattgacaggaggacctt 377 ||||| | ||||| ||||| ||||||||||| Sbjct: 473 gtcagaagggaacaaattgagaggaggacctt 442
>ref|NM_124709.2| Arabidopsis thaliana UBC10; ubiquitin conjugating enzyme/ ubiquitin-like activating enzyme AT5G53300 (UBC10) transcript variant AT5G53300.2 mRNA, complete cds Length = 837 Score = 85.7 bits (43), Expect = 1e-13 Identities = 91/107 (85%) Strand = Plus / Minus Query: 232 tagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatca 291 ||||||||||| ||||| || |||||| || || | ||||||||||||| | ||| Sbjct: 548 tagcccatggcatacttctgagtccagcttcgtgcagtggactcgtacttgttcttgtca 489 Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338 ||||||||||||||||| ||||||||||||||||||||||| ||||| Sbjct: 488 gtcttgtacatgtgagctatctcgggcaccaaaggatcatccgggtt 442
>ref|NM_180850.1| Arabidopsis thaliana UBC10; ubiquitin conjugating enzyme/ ubiquitin-like activating enzyme AT5G53300 (UBC10) transcript variant AT5G53300.1 mRNA, complete cds Length = 856 Score = 85.7 bits (43), Expect = 1e-13 Identities = 91/107 (85%) Strand = Plus / Minus Query: 232 tagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatca 291 ||||||||||| ||||| || |||||| || || | ||||||||||||| | ||| Sbjct: 567 tagcccatggcatacttctgagtccagcttcgtgcagtggactcgtacttgttcttgtca 508 Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338 ||||||||||||||||| ||||||||||||||||||||||| ||||| Sbjct: 507 gtcttgtacatgtgagctatctcgggcaccaaaggatcatccgggtt 461
>emb|Z14991.1|ATUBC10 A.thaliana UBC10 mRNA for ubiquitin conjugating enzyme homolog Length = 818 Score = 85.7 bits (43), Expect = 1e-13 Identities = 91/107 (85%) Strand = Plus / Minus Query: 232 tagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatca 291 ||||||||||| ||||| || |||||| || || | ||||||||||||| | ||| Sbjct: 578 tagcccatggcatacttctgagtccagcttcgtgcagtggactcgtacttgttcttgtca 519 Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338 ||||||||||||||||| ||||||||||||||||||||||| ||||| Sbjct: 518 gtcttgtacatgtgagctatctcgggcaccaaaggatcatccgggtt 472
>gb|AY113937.1| Arabidopsis thaliana putative E2, ubiquitin-conjugating enzyme UBC10 (At5g53300) mRNA, complete cds Length = 478 Score = 85.7 bits (43), Expect = 1e-13 Identities = 91/107 (85%) Strand = Plus / Minus Query: 232 tagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatca 291 ||||||||||| ||||| || |||||| || || | ||||||||||||| | ||| Sbjct: 446 tagcccatggcatacttctgagtccagcttcgtgcagtggactcgtacttgttcttgtca 387 Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338 ||||||||||||||||| ||||||||||||||||||||||| ||||| Sbjct: 386 gtcttgtacatgtgagctatctcgggcaccaaaggatcatccgggtt 340
>gb|AF326872.1| Arabidopsis thaliana putative E2, ubiquitin-conjugating enzyme UBC10 (At5g53300) mRNA, complete cds Length = 768 Score = 85.7 bits (43), Expect = 1e-13 Identities = 91/107 (85%) Strand = Plus / Minus Query: 232 tagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatca 291 ||||||||||| ||||| || |||||| || || | ||||||||||||| | ||| Sbjct: 540 tagcccatggcatacttctgagtccagcttcgtgcagtggactcgtacttgttcttgtca 481 Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338 ||||||||||||||||| ||||||||||||||||||||||| ||||| Sbjct: 480 gtcttgtacatgtgagctatctcgggcaccaaaggatcatccgggtt 434
>gb|AY129488.1| Arabidopsis thaliana AT5g53300/K19E1_10 mRNA, complete cds Length = 447 Score = 85.7 bits (43), Expect = 1e-13 Identities = 91/107 (85%) Strand = Plus / Minus Query: 232 tagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatca 291 ||||||||||| ||||| || |||||| || || | ||||||||||||| | ||| Sbjct: 446 tagcccatggcatacttctgagtccagcttcgtgcagtggactcgtacttgttcttgtca 387 Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338 ||||||||||||||||| ||||||||||||||||||||||| ||||| Sbjct: 386 gtcttgtacatgtgagctatctcgggcaccaaaggatcatccgggtt 340
>gb|AY065059.1| Arabidopsis thaliana AT5g53300/K19E1_10 mRNA, complete cds Length = 752 Score = 85.7 bits (43), Expect = 1e-13 Identities = 91/107 (85%) Strand = Plus / Minus Query: 232 tagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatca 291 ||||||||||| ||||| || |||||| || || | ||||||||||||| | ||| Sbjct: 540 tagcccatggcatacttctgagtccagcttcgtgcagtggactcgtacttgttcttgtca 481 Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338 ||||||||||||||||| ||||||||||||||||||||||| ||||| Sbjct: 480 gtcttgtacatgtgagctatctcgggcaccaaaggatcatccgggtt 434
>gb|AY039566.1| Arabidopsis thaliana AT5g53300/K19E1_10 mRNA, complete cds Length = 713 Score = 85.7 bits (43), Expect = 1e-13 Identities = 91/107 (85%) Strand = Plus / Minus Query: 232 tagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatca 291 ||||||||||| ||||| || |||||| || || | ||||||||||||| | ||| Sbjct: 544 tagcccatggcatacttctgagtccagcttcgtgcagtggactcgtacttgttcttgtca 485 Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338 ||||||||||||||||| ||||||||||||||||||||||| ||||| Sbjct: 484 gtcttgtacatgtgagctatctcgggcaccaaaggatcatccgggtt 438
>gb|AF325005.2|AF325005 Arabidopsis thaliana AT5g53300 (AT5g53300/K19E1_10) mRNA, complete cds Length = 731 Score = 85.7 bits (43), Expect = 1e-13 Identities = 91/107 (85%) Strand = Plus / Minus Query: 232 tagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatca 291 ||||||||||| ||||| || |||||| || || | ||||||||||||| | ||| Sbjct: 535 tagcccatggcatacttctgagtccagcttcgtgcagtggactcgtacttgttcttgtca 476 Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338 ||||||||||||||||| ||||||||||||||||||||||| ||||| Sbjct: 475 gtcttgtacatgtgagctatctcgggcaccaaaggatcatccgggtt 429
>gb|AF324718.2|AF324718 Arabidopsis thaliana AT5g53300 (AT5g53300/K19E1_10) mRNA, complete cds Length = 748 Score = 85.7 bits (43), Expect = 1e-13 Identities = 91/107 (85%) Strand = Plus / Minus Query: 232 tagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatca 291 ||||||||||| ||||| || |||||| || || | ||||||||||||| | ||| Sbjct: 536 tagcccatggcatacttctgagtccagcttcgtgcagtggactcgtacttgttcttgtca 477 Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338 ||||||||||||||||| ||||||||||||||||||||||| ||||| Sbjct: 476 gtcttgtacatgtgagctatctcgggcaccaaaggatcatccgggtt 430
>emb|BX833981.1|CNS0A0DI Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL88ZC07 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 769 Score = 85.7 bits (43), Expect = 1e-13 Identities = 91/107 (85%) Strand = Plus / Minus Query: 232 tagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatca 291 ||||||||||| ||||| || |||||| || || | ||||||||||||| | ||| Sbjct: 533 tagcccatggcatacttctgagtccagcttcgtgcagtggactcgtacttgttcttgtca 474 Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338 ||||||||||||||||| ||||||||||||||||||||||| ||||| Sbjct: 473 gtcttgtacatgtgagctatctcgggcaccaaaggatcatccgggtt 427
>gb|AY086109.1| Arabidopsis thaliana clone 21455 mRNA, complete sequence Length = 709 Score = 85.7 bits (43), Expect = 1e-13 Identities = 97/115 (84%) Strand = Plus / Minus Query: 235 cccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcagtc 294 ||||| |||||||||||||||||| | ||| | ||||||||||||| || ||| ||| Sbjct: 546 cccattgcgtacttttgtgtccagcttctcgcagttgactcgtacttggacctatctgtc 487 Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtca 349 |||||||||||||| ||||| ||||| | ||||||||| ||||| ||||| |||| Sbjct: 486 ttgtacatgtgagctatctccggcacaagaggatcatctgggtttgggtcagtca 432
>dbj|AP004078.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1020_C02 Length = 124578 Score = 85.7 bits (43), Expect = 1e-13 Identities = 73/83 (87%) Strand = Plus / Minus Query: 286 cgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtcc 345 |||||||||||| |||| ||||||||||| ||||||| ||||| || |||||||||||| Sbjct: 31840 cgatcagtcttgcacatatgagcgatctccggcaccagcggatcgtccgggttcgggtcc 31781 Query: 346 gtcagcaacgaacagattgacag 368 ||||||| ||| ||||| ||||| Sbjct: 31780 gtcagcagcgagcagatcgacag 31758
>dbj|AP005851.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBb0088N06 Length = 123454 Score = 85.7 bits (43), Expect = 1e-13 Identities = 73/83 (87%) Strand = Plus / Minus Query: 286 cgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtcc 345 |||||||||||| |||| ||||||||||| ||||||| ||||| || |||||||||||| Sbjct: 68024 cgatcagtcttgcacatatgagcgatctccggcaccagcggatcgtccgggttcgggtcc 67965 Query: 346 gtcagcaacgaacagattgacag 368 ||||||| ||| ||||| ||||| Sbjct: 67964 gtcagcagcgagcagatcgacag 67942
>dbj|AB013388.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K19E1 Length = 73428 Score = 85.7 bits (43), Expect = 1e-13 Identities = 91/107 (85%) Strand = Plus / Plus Query: 232 tagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatca 291 ||||||||||| ||||| || |||||| || || | ||||||||||||| | ||| Sbjct: 46992 tagcccatggcatacttctgagtccagcttcgtgcagtggactcgtacttgttcttgtca 47051 Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338 ||||||||||||||||| ||||||||||||||||||||||| ||||| Sbjct: 47052 gtcttgtacatgtgagctatctcgggcaccaaaggatcatccgggtt 47098
>gb|DQ027024.1| Arabidopsis thaliana ubiquitinating enzyme (At5g53300) mRNA, complete cds Length = 447 Score = 85.7 bits (43), Expect = 1e-13 Identities = 91/107 (85%) Strand = Plus / Minus Query: 232 tagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatca 291 ||||||||||| ||||| || |||||| || || | ||||||||||||| | ||| Sbjct: 446 tagcccatggcatacttctgagtccagcttcgtgcagtggactcgtacttgttcttgtca 387 Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338 ||||||||||||||||| ||||||||||||||||||||||| ||||| Sbjct: 386 gtcttgtacatgtgagctatctcgggcaccaaaggatcatccgggtt 340
>gb|L00640.1|ATHUBCC Arabidopsis thaliana ubiquitin conjugating enzyme mRNA, complete cds Length = 818 Score = 85.7 bits (43), Expect = 1e-13 Identities = 91/107 (85%) Strand = Plus / Minus Query: 232 tagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatca 291 ||||||||||| ||||| || |||||| || || | ||||||||||||| | ||| Sbjct: 578 tagcccatggcatacttctgagtccagcttcgtgcagtggactcgtacttgttcttgtca 519 Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338 ||||||||||||||||| ||||||||||||||||||||||| ||||| Sbjct: 518 gtcttgtacatgtgagctatctcgggcaccaaaggatcatccgggtt 472
>ref|NM_179131.1| Arabidopsis thaliana UBC9 (UBIQUITIN CONJUGATING ENZYME 9); ubiquitin conjugating enzyme/ ubiquitin-like activating enzyme AT4G27960 (UBC9) transcript variant AT4G27960.1 mRNA, complete cds Length = 686 Score = 83.8 bits (42), Expect = 4e-13 Identities = 108/130 (83%) Strand = Plus / Minus Query: 233 agcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcag 292 |||||||||| |||||||| ||||||| || || | ||||||||||||| | || | Sbjct: 524 agcccatggcatacttttgggtccaggtccgagcagtggactcgtacttgttcttgtctg 465 Query: 293 tcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352 |||||||||||||||| ||||| || |||||||||||||| ||||| || ||||| | || Sbjct: 464 tcttgtacatgtgagctatctcagggaccaaaggatcatctgggtttggatccgttaaca 405 Query: 353 acgaacagat 362 | |||||||| Sbjct: 404 aagaacagat 395
>ref|NM_118934.1| Arabidopsis thaliana UBC9 (UBIQUITIN CONJUGATING ENZYME 9); ubiquitin conjugating enzyme/ ubiquitin-like activating enzyme AT4G27960 (UBC9) transcript variant AT4G27960.2 mRNA, complete cds Length = 896 Score = 83.8 bits (42), Expect = 4e-13 Identities = 108/130 (83%) Strand = Plus / Minus Query: 233 agcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcag 292 |||||||||| |||||||| ||||||| || || | ||||||||||||| | || | Sbjct: 662 agcccatggcatacttttgggtccaggtccgagcagtggactcgtacttgttcttgtctg 603 Query: 293 tcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352 |||||||||||||||| ||||| || |||||||||||||| ||||| || ||||| | || Sbjct: 602 tcttgtacatgtgagctatctcagggaccaaaggatcatctgggtttggatccgttaaca 543 Query: 353 acgaacagat 362 | |||||||| Sbjct: 542 aagaacagat 533
>gb|AY142644.1| Arabidopsis thaliana E2 ubiquitin-conjugating enzyme 9 (UBC9) (At4g27960) mRNA, complete cds Length = 478 Score = 83.8 bits (42), Expect = 4e-13 Identities = 108/130 (83%) Strand = Plus / Minus Query: 233 agcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcag 292 |||||||||| |||||||| ||||||| || || | ||||||||||||| | || | Sbjct: 445 agcccatggcatacttttgggtccaggtccgagcagtggactcgtacttgttcttgtctg 386 Query: 293 tcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352 |||||||||||||||| ||||| || |||||||||||||| ||||| || ||||| | || Sbjct: 385 tcttgtacatgtgagctatctcagggaccaaaggatcatctgggtttggatccgttaaca 326 Query: 353 acgaacagat 362 | |||||||| Sbjct: 325 aagaacagat 316
>emb|Z14990.1|ATUBC9 A.thaliana UBC9 mRNA for ubiquitin conjugating enzyme homolog Length = 687 Score = 83.8 bits (42), Expect = 4e-13 Identities = 108/130 (83%) Strand = Plus / Minus Query: 233 agcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcag 292 |||||||||| |||||||| ||||||| || || | ||||||||||||| | || | Sbjct: 495 agcccatggcatacttttgggtccaggtccgagcagtggactcgtacttgttcttgtctg 436 Query: 293 tcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352 |||||||||||||||| ||||| || |||||||||||||| ||||| || ||||| | || Sbjct: 435 tcttgtacatgtgagctatctcagggaccaaaggatcatctgggtttggatccgttaaca 376 Query: 353 acgaacagat 362 | |||||||| Sbjct: 375 aagaacagat 366
>gb|AY080741.1| Arabidopsis thaliana putative E2, ubiquitin-conjugating enzyme UBC9 (At4g27960) mRNA, complete cds Length = 688 Score = 83.8 bits (42), Expect = 4e-13 Identities = 108/130 (83%) Strand = Plus / Minus Query: 233 agcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcag 292 |||||||||| |||||||| ||||||| || || | ||||||||||||| | || | Sbjct: 521 agcccatggcatacttttgggtccaggtccgagcagtggactcgtacttgttcttgtctg 462 Query: 293 tcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352 |||||||||||||||| ||||| || |||||||||||||| ||||| || ||||| | || Sbjct: 461 tcttgtacatgtgagctatctcagggaccaaaggatcatctgggtttggatccgttaaca 402 Query: 353 acgaacagat 362 | |||||||| Sbjct: 401 aagaacagat 392
>emb|X72626.1|ATUCEE2B A.thaliana UbcAT4b mRNA for ubiquitin conjugating enzyme E2 Length = 643 Score = 83.8 bits (42), Expect = 4e-13 Identities = 108/130 (83%) Strand = Plus / Minus Query: 233 agcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcag 292 |||||||||| |||||||| ||||||| || || | ||||||||||||| | || | Sbjct: 479 agcccatggcatacttttgggtccaggtccgagcagtggactcgtacttgttcttgtctg 420 Query: 293 tcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352 |||||||||||||||| ||||| || |||||||||||||| ||||| || ||||| | || Sbjct: 419 tcttgtacatgtgagctatctcagggaccaaaggatcatctgggtttggatccgttaaca 360 Query: 353 acgaacagat 362 | |||||||| Sbjct: 359 aagaacagat 350
>emb|AL161572.2|ATCHRIV68 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 68 Length = 199749 Score = 83.8 bits (42), Expect = 4e-13 Identities = 108/130 (83%) Strand = Plus / Plus Query: 233 agcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcag 292 |||||||||| |||||||| ||||||| || || | ||||||||||||| | || | Sbjct: 31550 agcccatggcatacttttgggtccaggtccgagcagtggactcgtacttgttcttgtctg 31609 Query: 293 tcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352 |||||||||||||||| ||||| || |||||||||||||| ||||| || ||||| | || Sbjct: 31610 tcttgtacatgtgagctatctcagggaccaaaggatcatctgggtttggatccgttaaca 31669 Query: 353 acgaacagat 362 | |||||||| Sbjct: 31670 aagaacagat 31679
>emb|AL035524.1|ATT13J8 Arabidopsis thaliana DNA chromosome 4, BAC clone T13J8 (ESSAII project) Length = 83693 Score = 83.8 bits (42), Expect = 4e-13 Identities = 108/130 (83%) Strand = Plus / Plus Query: 233 agcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcag 292 |||||||||| |||||||| ||||||| || || | ||||||||||||| | || | Sbjct: 26414 agcccatggcatacttttgggtccaggtccgagcagtggactcgtacttgttcttgtctg 26473 Query: 293 tcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352 |||||||||||||||| ||||| || |||||||||||||| ||||| || ||||| | || Sbjct: 26474 tcttgtacatgtgagctatctcagggaccaaaggatcatctgggtttggatccgttaaca 26533 Query: 353 acgaacagat 362 | |||||||| Sbjct: 26534 aagaacagat 26543
>gb|AF325019.2|AF325019 Arabidopsis thaliana AT4g27960 (AT4g27960/T13J8_70) mRNA, complete cds Length = 896 Score = 83.8 bits (42), Expect = 4e-13 Identities = 108/130 (83%) Strand = Plus / Minus Query: 233 agcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcag 292 |||||||||| |||||||| ||||||| || || | ||||||||||||| | || | Sbjct: 662 agcccatggcatacttttgggtccaggtccgagcagtggactcgtacttgttcttgtctg 603 Query: 293 tcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352 |||||||||||||||| ||||| || |||||||||||||| ||||| || ||||| | || Sbjct: 602 tcttgtacatgtgagctatctcagggaccaaaggatcatctgggtttggatccgttaaca 543 Query: 353 acgaacagat 362 | |||||||| Sbjct: 542 aagaacagat 533
>gb|AY086447.1| Arabidopsis thaliana clone 25162 mRNA, complete sequence Length = 743 Score = 83.8 bits (42), Expect = 4e-13 Identities = 48/50 (96%) Strand = Plus / Minus Query: 289 tcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338 |||||||||||||||||||| ||||||||||||||||||||||| ||||| Sbjct: 487 tcagtcttgtacatgtgagctatctcgggcaccaaaggatcatccgggtt 438
>gb|DQ027023.1| Arabidopsis thaliana ubiquitinating enzyme (At4g27960) mRNA, complete cds Length = 537 Score = 83.8 bits (42), Expect = 4e-13 Identities = 108/130 (83%) Strand = Plus / Minus Query: 233 agcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcag 292 |||||||||| |||||||| ||||||| || || | ||||||||||||| | || | Sbjct: 535 agcccatggcatacttttgggtccaggtccgagcagtggactcgtacttgttcttgtctg 476 Query: 293 tcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352 |||||||||||||||| ||||| || |||||||||||||| ||||| || ||||| | || Sbjct: 475 tcttgtacatgtgagctatctcagggaccaaaggatcatctgggtttggatccgttaaca 416 Query: 353 acgaacagat 362 | |||||||| Sbjct: 415 aagaacagat 406
>gb|L00639.1|ATHUBCB Arabidopsis thaliana ubiquitin conjugating enzyme mRNA, complete cds Length = 658 Score = 83.8 bits (42), Expect = 4e-13 Identities = 108/130 (83%) Strand = Plus / Minus Query: 233 agcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcag 292 |||||||||| |||||||| ||||||| || || | ||||||||||||| | || | Sbjct: 495 agcccatggcatacttttgggtccaggtccgagcagtggactcgtacttgttcttgtctg 436 Query: 293 tcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352 |||||||||||||||| ||||| || |||||||||||||| ||||| || ||||| | || Sbjct: 435 tcttgtacatgtgagctatctcagggaccaaaggatcatctgggtttggatccgttaaca 376 Query: 353 acgaacagat 362 | |||||||| Sbjct: 375 aagaacagat 366
>dbj|AP004929.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT06J16, TM0083, complete sequence Length = 120016 Score = 81.8 bits (41), Expect = 2e-12 Identities = 68/77 (88%) Strand = Plus / Minus Query: 277 tacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcaggg 336 |||||||||| ||||||||||||||| ||||| ||||| ||||||| |||||| || ||| Sbjct: 112098 tacttggccctatcagtcttgtacatatgagcaatctcaggcaccagaggatcctctggg 112039 Query: 337 ttcgggtccgtcagcaa 353 || ||||| |||||||| Sbjct: 112038 ttggggtctgtcagcaa 112022
>gb|AY083170.1| Malus x domestica ubiquitin conjugating-like enzyme mRNA, partial cds Length = 174 Score = 79.8 bits (40), Expect = 6e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 274 tcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatca 333 ||||||||||| |||||||| ||||||||||| |||||||| ||||| | ||| |||||| Sbjct: 88 tcgtacttggctcgatcagttttgtacatgtgggcgatctccggcacgagagggtcatca 29 Query: 334 gggttcgggtccgtcagcaa 353 || || ||||| |||||||| Sbjct: 28 ggatttgggtcagtcagcaa 9
>emb|BX829864.1|CNS0A1IT Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB41ZF02 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 708 Score = 79.8 bits (40), Expect = 6e-12 Identities = 46/48 (95%) Strand = Plus / Minus Query: 291 agtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338 |||||||||||||||||| ||||||||||||||||||||||| ||||| Sbjct: 462 agtcttgtacatgtgagctatctcgggcaccaaaggatcatccgggtt 415
>ref|NM_111703.2| Arabidopsis thaliana ubiquitin conjugating enzyme/ ubiquitin-like activating enzyme AT3G08690 mRNA, complete cds Length = 724 Score = 77.8 bits (39), Expect = 2e-11 Identities = 96/115 (83%) Strand = Plus / Minus Query: 235 cccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcagtc 294 ||||| |||||||||||||||||| | ||| | ||||||||||||| | ||| ||| Sbjct: 546 cccattgcgtacttttgtgtccagcttctcgcagttgactcgtacttggatctatctgtc 487 Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtca 349 |||||||||||||| ||||| ||||| | ||||||||| ||||| ||||| |||| Sbjct: 486 ttgtacatgtgagctatctccggcacaagaggatcatctgggtttgggtcagtca 432
>emb|Z14992.1|ATUBC11 A.thaliana UBC11 mRNA for ubiquitin conjugating enzyme homolog Length = 543 Score = 77.8 bits (39), Expect = 2e-11 Identities = 96/115 (83%) Strand = Plus / Minus Query: 235 cccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcagtc 294 ||||| |||||||||||||||||| | ||| | ||||||||||||| | ||| ||| Sbjct: 353 cccattgcgtacttttgtgtccagcttctcgcagttgactcgtacttggatctatctgtc 294 Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtca 349 |||||||||||||| ||||| ||||| | ||||||||| ||||| ||||| |||| Sbjct: 293 ttgtacatgtgagctatctccggcacaagaggatcatctgggtttgggtcagtca 239
>gb|AY091223.1| Arabidopsis thaliana putative ubiquitin conjugating enzyme 11 (UBC11) (At3g08690) mRNA, complete cds Length = 478 Score = 77.8 bits (39), Expect = 2e-11 Identities = 96/115 (83%) Strand = Plus / Minus Query: 235 cccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcagtc 294 ||||| |||||||||||||||||| | ||| | ||||||||||||| | ||| ||| Sbjct: 443 cccattgcgtacttttgtgtccagcttctcgcagttgactcgtacttggatctatctgtc 384 Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtca 349 |||||||||||||| ||||| ||||| | ||||||||| ||||| ||||| |||| Sbjct: 383 ttgtacatgtgagctatctccggcacaagaggatcatctgggtttgggtcagtca 329
>gb|AY063869.1| Arabidopsis thaliana putative E2, ubiquitin-conjugating enzyme UBC11 (At3g08690) mRNA, complete cds Length = 733 Score = 77.8 bits (39), Expect = 2e-11 Identities = 96/115 (83%) Strand = Plus / Minus Query: 235 cccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcagtc 294 ||||| |||||||||||||||||| | ||| | ||||||||||||| | ||| ||| Sbjct: 539 cccattgcgtacttttgtgtccagcttctcgcagttgactcgtacttggatctatctgtc 480 Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtca 349 |||||||||||||| ||||| ||||| | ||||||||| ||||| ||||| |||| Sbjct: 479 ttgtacatgtgagctatctccggcacaagaggatcatctgggtttgggtcagtca 425
>gb|AC012562.5|AC012562 Arabidopsis thaliana chromosome 3 BAC F17O14 genomic sequence, complete sequence Length = 90721 Score = 77.8 bits (39), Expect = 2e-11 Identities = 96/115 (83%) Strand = Plus / Minus Query: 235 cccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcagtc 294 ||||| |||||||||||||||||| | ||| | ||||||||||||| | ||| ||| Sbjct: 53408 cccattgcgtacttttgtgtccagcttctcgcagttgactcgtacttggatctatctgtc 53349 Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtca 349 |||||||||||||| ||||| ||||| | ||||||||| ||||| ||||| |||| Sbjct: 53348 ttgtacatgtgagctatctccggcacaagaggatcatctgggtttgggtcagtca 53294 Score = 42.1 bits (21), Expect = 1.3 Identities = 42/49 (85%) Strand = Plus / Minus Query: 304 tgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352 ||||| ||||| ||||| | |||||||| ||||||||||| ||||||| Sbjct: 55395 tgagctatctccggcacaagaggatcatttgggttcgggtcagtcagca 55347
>gb|DQ027025.1| Arabidopsis thaliana ubiquitinating enzyme (At3g08690) mRNA, complete cds Length = 447 Score = 77.8 bits (39), Expect = 2e-11 Identities = 96/115 (83%) Strand = Plus / Minus Query: 235 cccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcagtc 294 ||||| |||||||||||||||||| | ||| | ||||||||||||| | ||| ||| Sbjct: 443 cccattgcgtacttttgtgtccagcttctcgcagttgactcgtacttggatctatctgtc 384 Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtca 349 |||||||||||||| ||||| ||||| | ||||||||| ||||| ||||| |||| Sbjct: 383 ttgtacatgtgagctatctccggcacaagaggatcatctgggtttgggtcagtca 329
>gb|L00641.1|ATHUBCD Arabidopsis thaliana ubiquitin conjugating enzyme mRNA, 3' end Length = 543 Score = 77.8 bits (39), Expect = 2e-11 Identities = 96/115 (83%) Strand = Plus / Minus Query: 235 cccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcagtc 294 ||||| |||||||||||||||||| | ||| | ||||||||||||| | ||| ||| Sbjct: 353 cccattgcgtacttttgtgtccagcttctcgcagttgactcgtacttggatctatctgtc 294 Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtca 349 |||||||||||||| ||||| ||||| | ||||||||| ||||| ||||| |||| Sbjct: 293 ttgtacatgtgagctatctccggcacaagaggatcatctgggtttgggtcagtca 239
>gb|AY486137.1| Capsicum annuum ubiquitin-conjugating protein mRNA, complete cds Length = 578 Score = 75.8 bits (38), Expect = 9e-11 Identities = 95/114 (83%) Strand = Plus / Minus Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332 |||||| ||||||| |||||||||||||||||||| || || || || | |||||||| Sbjct: 337 ctcgtatttggccctgtcagtcttgtacatgtgagcaatttctggtacgagcggatcatc 278 Query: 333 agggttcgggtccgtcagcaacgaacagattgacaggaggacctttgatatggt 386 ||||| |||||||||| || || ||||| ||||| |||||||| |||||||| Sbjct: 277 ggggtttgggtccgtcaacagagagcagatggacagcaggaccttcgatatggt 224
>gb|BT013767.1| Lycopersicon esculentum clone 132651R, mRNA sequence Length = 844 Score = 73.8 bits (37), Expect = 4e-10 Identities = 94/113 (83%) Strand = Plus / Minus Query: 274 tcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatca 333 ||||| ||||||| |||||||||||||||||||| || || || || | ||||||||| Sbjct: 566 tcgtatttggccctgtcagtcttgtacatgtgagcaatttcaggtacaagaggatcatct 507 Query: 334 gggttcgggtccgtcagcaacgaacagattgacaggaggacctttgatatggt 386 ||||| ||||| |||| || || ||||| ||||| |||||||| |||||||| Sbjct: 506 gggtttgggtctgtcaacagagagcagatggacagcaggaccttggatatggt 454
>ref|XM_445894.1| Candida glabrata CBS138, CAGL0E04752g partial mRNA Length = 444 Score = 73.8 bits (37), Expect = 4e-10 Identities = 88/105 (83%) Strand = Plus / Minus Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332 ||||||||| || | |||||||||||| ||||| |||||||| || ||||||||||| || Sbjct: 405 ctcgtacttagctctatcagtcttgtagatgtgggcgatctctggaaccaaaggatcgtc 346 Query: 333 agggttcgggtccgtcagcaacgaacagattgacaggaggacctt 377 ||||| | ||| |||||||| || ||||| || || |||||||| Sbjct: 345 tgggttggcgtctgtcagcaaggagcagatggaaagcaggacctt 301
>emb|CR380951.1| Candida glabrata strain CBS138 chromosome E complete sequence Length = 687501 Score = 73.8 bits (37), Expect = 4e-10 Identities = 88/105 (83%) Strand = Plus / Plus Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332 ||||||||| || | |||||||||||| ||||| |||||||| || ||||||||||| || Sbjct: 456004 ctcgtacttagctctatcagtcttgtagatgtgggcgatctctggaaccaaaggatcgtc 456063 Query: 333 agggttcgggtccgtcagcaacgaacagattgacaggaggacctt 377 ||||| | ||| |||||||| || ||||| || || |||||||| Sbjct: 456064 tgggttggcgtctgtcagcaaggagcagatggaaagcaggacctt 456108
>gb|DQ284472.1| Solanum tuberosum clone 116D11 ubiquitin-conjugating protein-like mRNA, complete cds Length = 531 Score = 73.8 bits (37), Expect = 4e-10 Identities = 94/113 (83%) Strand = Plus / Minus Query: 274 tcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatca 333 ||||| ||||||| |||||||||||||||||||| || || || || | ||||||||| Sbjct: 326 tcgtatttggccctgtcagtcttgtacatgtgagcaatttcaggtacaagaggatcatct 267 Query: 334 gggttcgggtccgtcagcaacgaacagattgacaggaggacctttgatatggt 386 ||||| ||||| |||| || || ||||| ||||| |||||||| |||||||| Sbjct: 266 gggtttgggtctgtcaacagagagcagatggacagcaggaccttggatatggt 214
>gb|L23762.1|TOM1KUC Lycopersicon esculentum ubiquitin carrier protein (Ubc) mRNA, complete cds Length = 825 Score = 73.8 bits (37), Expect = 4e-10 Identities = 94/113 (83%) Strand = Plus / Minus Query: 274 tcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatca 333 ||||| ||||||| |||||||||||||||||||| || || || || | ||||||||| Sbjct: 570 tcgtatttggccctgtcagtcttgtacatgtgagcaatttcaggtacaagaggatcatct 511 Query: 334 gggttcgggtccgtcagcaacgaacagattgacaggaggacctttgatatggt 386 ||||| ||||| |||| || || ||||| ||||| |||||||| |||||||| Sbjct: 510 gggtttgggtctgtcaacagagagcagatggacagcaggaccttggatatggt 458
>ref|XM_571364.1| Cryptococcus neoformans var. neoformans JEC21 ubiquitin-conjugating enzyme e2-16 kda (CNF02760) partial mRNA Length = 655 Score = 71.9 bits (36), Expect = 1e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 310 atctcgggcaccaaaggatcatcagggttcgggtccgtcagcaacgaacagattgacagg 369 |||||||||||||||||||| |||||||| |||||||||| || |||||||| |||| Sbjct: 429 atctcgggcaccaaaggatcgtcagggttagggtccgtcaacatggaacagatggacaac 370 Query: 370 aggacctttgatatggtcaa 389 | |||||| || |||||||| Sbjct: 369 aagaccttcgaaatggtcaa 350
>emb|Z14993.1|ATUBC12 A.thaliana UBC12 gene Length = 1010 Score = 71.9 bits (36), Expect = 1e-09 Identities = 105/128 (82%) Strand = Plus / Minus Query: 235 cccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcagtc 294 |||||||| || ||||| ||||||| || || | ||||||||||||| | || ||| Sbjct: 1010 cccatggcatatttttgggtccaggtccgagcagtggactcgtacttgttcttgtctgtc 951 Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagcaac 354 |||||||||||||| ||||| || |||||||||||||| ||||| || ||||| | ||| Sbjct: 950 ttgtacatgtgagctatctcagggaccaaaggatcatctgggtttggatccgttaacaaa 891 Query: 355 gaacagat 362 |||||||| Sbjct: 890 gaacagat 883
>gb|L00642.1|ATHUBCE Arabidopsis thaliana ubiquitin conjugating enzyme gene, exons 1-4 Length = 1010 Score = 71.9 bits (36), Expect = 1e-09 Identities = 105/128 (82%) Strand = Plus / Minus Query: 235 cccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcagtc 294 |||||||| || ||||| ||||||| || || | ||||||||||||| | || ||| Sbjct: 1010 cccatggcatatttttgggtccaggtccgagcagtggactcgtacttgttcttgtctgtc 951 Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagcaac 354 |||||||||||||| ||||| || |||||||||||||| ||||| || ||||| | ||| Sbjct: 950 ttgtacatgtgagctatctcagggaccaaaggatcatctgggtttggatccgttaacaaa 891 Query: 355 gaacagat 362 |||||||| Sbjct: 890 gaacagat 883
>gb|DQ222513.1| Solanum tuberosum clone 117E03 ubiquitin conjugating enzyme E2-like mRNA, complete cds Length = 835 Score = 69.9 bits (35), Expect = 6e-09 Identities = 65/75 (86%) Strand = Plus / Minus Query: 288 atcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgt 347 |||||| |||||||| ||||| ||||| ||||||||||| |||||||| || ||||| || Sbjct: 435 atcagttttgtacatatgagcaatctccggcaccaaagggtcatcaggattagggtctgt 376 Query: 348 cagcaacgaacagat 362 ||||| |||||||| Sbjct: 375 cagcagagaacagat 361
>gb|AF532622.1| Glycine max ubiquitin-conjugation enzyme gene, complete cds Length = 929 Score = 67.9 bits (34), Expect = 2e-08 Identities = 106/130 (81%) Strand = Plus / Minus Query: 233 agcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcag 292 |||||||||| ||||| || |||||| ||| || | || ||| ||||||||||| |||| Sbjct: 628 agcccatggcatacttctgggtccagctgcgtgcagtggcctcatacttggcccggtcag 569 Query: 293 tcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352 | ||||||||||||||||| || || || | ||||||||||| || || || ||||||| Sbjct: 568 ttttgtacatgtgagcgatttccggaacaagtggatcatcaggatttggatcagtcagca 509 Query: 353 acgaacagat 362 | || ||||| Sbjct: 508 atgagcagat 499
>gb|AE017346.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 6, complete sequence Length = 1438950 Score = 67.9 bits (34), Expect = 2e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 310 atctcgggcaccaaaggatcatcagggttcgggtccgtcagcaacgaacagattgaca 367 |||||||||||||||||||| |||||||| |||||||||| || |||||||| |||| Sbjct: 790689 atctcgggcaccaaaggatcgtcagggttagggtccgtcaacatggaacagatggaca 790632
>gb|BT013204.1| Lycopersicon esculentum clone 134378F, mRNA sequence Length = 774 Score = 67.9 bits (34), Expect = 2e-08 Identities = 52/58 (89%) Strand = Plus / Minus Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtca 349 ||||||||||| ||||| ||||| ||||||||||||||||| ||||| || ||||||| Sbjct: 430 gtcttgtacatatgagcaatctcaggcaccaaaggatcatcggggtttggatccgtca 373
>gb|AY109411.1| Zea mays CL25406_3 mRNA sequence Length = 1037 Score = 67.9 bits (34), Expect = 2e-08 Identities = 94/114 (82%) Strand = Plus / Plus Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332 |||||||||| ||| || |||||||||||||| || |||||||| |||| |||||| || Sbjct: 128 ctcgtacttgttccggtccgtcttgtacatgtgcgctatctcggggaccagaggatcgtc 187 Query: 333 agggttcgggtccgtcagcaacgaacagattgacaggaggacctttgatatggt 386 |||||||| || ||||||| || ||||| ||||| || ||||| || ||||| Sbjct: 188 ggggttcggatcggtcagcagggagcagatggacagcagcaccttggagatggt 241
>ref|NM_124997.2| Arabidopsis thaliana ubiquitin conjugating enzyme/ ubiquitin-like activating enzyme AT5G56150 transcript variant AT5G56150.2 mRNA, complete cds Length = 744 Score = 65.9 bits (33), Expect = 9e-08 Identities = 93/113 (82%) Strand = Plus / Minus Query: 270 ggactcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatc 329 ||||||||||||| | || || |||||||| ||||| || || || || ||||||||||| Sbjct: 486 ggactcgtacttgactcggtctgtcttgtagatgtgcgctatttcaggaaccaaaggatc 427 Query: 330 atcagggttcgggtccgtcagcaacgaacagattgacaggaggacctttgata 382 |||||||| || ||||||||||| || || || ||||| || ||||| |||| Sbjct: 426 gtcagggtttggatccgtcagcaatgagcatatcgacagaagaaccttggata 374
>ref|NM_180867.1| Arabidopsis thaliana ubiquitin conjugating enzyme/ ubiquitin-like activating enzyme AT5G56150 transcript variant AT5G56150.1 mRNA, complete cds Length = 751 Score = 65.9 bits (33), Expect = 9e-08 Identities = 93/113 (82%) Strand = Plus / Minus Query: 270 ggactcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatc 329 ||||||||||||| | || || |||||||| ||||| || || || || ||||||||||| Sbjct: 493 ggactcgtacttgactcggtctgtcttgtagatgtgcgctatttcaggaaccaaaggatc 434 Query: 330 atcagggttcgggtccgtcagcaacgaacagattgacaggaggacctttgata 382 |||||||| || ||||||||||| || || || ||||| || ||||| |||| Sbjct: 433 gtcagggtttggatccgtcagcaatgagcatatcgacagaagaaccttggata 381
>gb|AY489135.1| Capsicum annuum ubiquitin-conjugating enzyme 8 mRNA, complete cds Length = 713 Score = 65.9 bits (33), Expect = 9e-08 Identities = 51/57 (89%) Strand = Plus / Minus Query: 288 atcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtc 344 ||||||||||||||| ||||| ||||| ||||| |||||||||||||| || ||||| Sbjct: 449 atcagtcttgtacatatgagctatctcaggcactaaaggatcatcaggattagggtc 393
>ref|XM_390981.1| Gibberella zeae PH-1 chromosome 3 UBC1_COLGL Ubiquitin-conjugating enzyme E2-16 kDa (Ubiquitin-protein ligase) (Ubiquitin carrier protein) (Colletotrichum hard-s> (FG10805.1) partial mRNA Length = 420 Score = 65.9 bits (33), Expect = 9e-08 Identities = 84/101 (83%) Strand = Plus / Minus Query: 289 tcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtc 348 ||||||||||| | || ||||||||||||||||||||||| |||||||| || ||||| Sbjct: 365 tcagtcttgtagacatgggcgatctcgggcaccaaaggatcgtcagggttgggatccgtt 306 Query: 349 agcaacgaacagattgacaggaggacctttgatatggtcaa 389 |||| || ||||| ||||| || || || || |||||||| Sbjct: 305 agcattgagcagatggacagaagaactttagagatggtcaa 265
>gb|AC148404.7| Medicago truncatula clone mth2-28d4, complete sequence Length = 111252 Score = 65.9 bits (33), Expect = 9e-08 Identities = 66/77 (85%) Strand = Plus / Minus Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagc 351 |||||||||||||| || || || ||||||||||||||||| ||||| || || |||||| Sbjct: 92556 gtcttgtacatgtgggcaatatcaggcaccaaaggatcatctgggtttggatctgtcagc 92497 Query: 352 aacgaacagattgacag 368 | || ||||||||||| Sbjct: 92496 agagagcagattgacag 92480
>gb|AY081511.1| Arabidopsis thaliana ubiquitin-conjugating enzyme-like protein (MDA7.21) mRNA, complete cds Length = 479 Score = 65.9 bits (33), Expect = 9e-08 Identities = 93/113 (82%) Strand = Plus / Minus Query: 270 ggactcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatc 329 ||||||||||||| | || || |||||||| ||||| || || || || ||||||||||| Sbjct: 408 ggactcgtacttgactcggtctgtcttgtagatgtgcgctatttcaggaaccaaaggatc 349 Query: 330 atcagggttcgggtccgtcagcaacgaacagattgacaggaggacctttgata 382 |||||||| || ||||||||||| || || || ||||| || ||||| |||| Sbjct: 348 gtcagggtttggatccgtcagcaatgagcatatcgacagaagaaccttggata 296
>gb|AY059806.1| Arabidopsis thaliana ubiquitin-conjugating enzyme-like protein (MDA7.21) mRNA, complete cds Length = 717 Score = 65.9 bits (33), Expect = 9e-08 Identities = 93/113 (82%) Strand = Plus / Minus Query: 270 ggactcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatc 329 ||||||||||||| | || || |||||||| ||||| || || || || ||||||||||| Sbjct: 487 ggactcgtacttgactcggtctgtcttgtagatgtgcgctatttcaggaaccaaaggatc 428 Query: 330 atcagggttcgggtccgtcagcaacgaacagattgacaggaggacctttgata 382 |||||||| || ||||||||||| || || || ||||| || ||||| |||| Sbjct: 427 gtcagggtttggatccgtcagcaatgagcatatcgacagaagaaccttggata 375
>emb|BX833149.1|CNS09Z3U Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL36ZD09 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 707 Score = 65.9 bits (33), Expect = 9e-08 Identities = 93/113 (82%) Strand = Plus / Minus Query: 270 ggactcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatc 329 ||||||||||||| | || || |||||||| ||||| || || || || ||||||||||| Sbjct: 476 ggactcgtacttgactcgttctgtcttgtagatgtgcgctatttcaggaaccaaaggatc 417 Query: 330 atcagggttcgggtccgtcagcaacgaacagattgacaggaggacctttgata 382 |||||||| || ||||||||||| || || || ||||| || ||||| |||| Sbjct: 416 gtcagggtttggatccgtcagcaatgagcatatggacagaagaaccttggata 364
>gb|AY084220.1| Arabidopsis thaliana clone 10022 mRNA, complete sequence Length = 750 Score = 65.9 bits (33), Expect = 9e-08 Identities = 93/113 (82%) Strand = Plus / Minus Query: 270 ggactcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatc 329 ||||||||||||| | || || |||||||| ||||| || || || || ||||||||||| Sbjct: 493 ggactcgtacttgactcggtctgtcttgtagatgtgcgctatttcaggaaccaaaggatc 434 Query: 330 atcagggttcgggtccgtcagcaacgaacagattgacaggaggacctttgata 382 |||||||| || ||||||||||| || || || ||||| || ||||| |||| Sbjct: 433 gtcagggtttggatccgtcagcaatgagcatatcgacagaagaaccttggata 381
>gb|DQ027043.1| Arabidopsis thaliana ubiquitinating enzyme (At5g56150) mRNA, complete cds Length = 447 Score = 65.9 bits (33), Expect = 9e-08 Identities = 93/113 (82%) Strand = Plus / Minus Query: 270 ggactcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatc 329 ||||||||||||| | || || |||||||| ||||| || || || || ||||||||||| Sbjct: 408 ggactcgtacttgactcggtctgtcttgtagatgtgcgctatttcaggaaccaaaggatc 349 Query: 330 atcagggttcgggtccgtcagcaacgaacagattgacaggaggacctttgata 382 |||||||| || ||||||||||| || || || ||||| || ||||| |||| Sbjct: 348 gtcagggtttggatccgtcagcaatgagcatatcgacagaagaaccttggata 296
>gb|DQ249816.1| Capsicum annuum ubiquitin-conjugating enzyme E2 mRNA, complete cds Length = 678 Score = 65.9 bits (33), Expect = 9e-08 Identities = 51/57 (89%) Strand = Plus / Minus Query: 288 atcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtc 344 ||||||||||||||| ||||| ||||| ||||| |||||||||||||| || ||||| Sbjct: 460 atcagtcttgtacatatgagctatctcaggcactaaaggatcatcaggattagggtc 404
>dbj|AB011476.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MDA7 Length = 82033 Score = 63.9 bits (32), Expect = 4e-07 Identities = 71/84 (84%) Strand = Plus / Minus Query: 270 ggactcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatc 329 ||||||||||||| | || || |||||||| ||||| || || || || ||||||||||| Sbjct: 65245 ggactcgtacttgactcggtctgtcttgtagatgtgcgctatttcaggaaccaaaggatc 65186 Query: 330 atcagggttcgggtccgtcagcaa 353 |||||||| || ||||||||||| Sbjct: 65185 gtcagggtttggatccgtcagcaa 65162
>emb|X73419.1|LEUBC L.esculentum mRNA for ubiquitin conjugating enzyme E2 Length = 686 Score = 61.9 bits (31), Expect = 1e-06 Identities = 64/75 (85%) Strand = Plus / Minus Query: 288 atcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgt 347 |||||| |||||||| ||||| ||||| ||||||||||| ||||| || || ||||| || Sbjct: 402 atcagttttgtacatatgagcaatctccggcaccaaagggtcatcgggattagggtctgt 343 Query: 348 cagcaacgaacagat 362 ||||| |||||||| Sbjct: 342 cagcagagaacagat 328
>gb|AY389716.1| Hyacinthus orientalis ubiquitin-conjugating enzyme 9 mRNA, partial cds Length = 650 Score = 60.0 bits (30), Expect = 6e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtca 349 |||||||||||||| ||||| || || ||||| |||||||| ||||| |||||||||| Sbjct: 363 gtcttgtacatgtgcgcgatttctggaaccaacggatcatctgggtttgggtccgtca 306
>gb|AF176040.1|AF176040 Mesembryanthemum crystallinum ubiquitin-conjugating enzyme UBC2 (Ubc2) mRNA, complete cds Length = 809 Score = 60.0 bits (30), Expect = 6e-06 Identities = 54/62 (87%) Strand = Plus / Minus Query: 288 atcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgt 347 ||||||||||||||||||||||||||| || || | ||||||||||| || ||||| || Sbjct: 470 atcagtcttgtacatgtgagcgatctctgggacaagcggatcatcaggatttgggtcggt 411 Query: 348 ca 349 || Sbjct: 410 ca 409
>ref|NM_001036151.1| Arabidopsis thaliana ubiquitin conjugating enzyme/ ubiquitin-like activating enzyme AT1G64230 transcript variant AT1G64230.2 mRNA, complete cds Length = 885 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgt 347 |||||||||||||| ||||| || ||||| |||||||| ||||| |||||||| Sbjct: 505 ttgtacatgtgagcaatctctggaaccaatggatcatctgggtttgggtccgt 453
>ref|NM_105097.3| Arabidopsis thaliana ubiquitin conjugating enzyme/ ubiquitin-like activating enzyme AT1G64230 transcript variant AT1G64230.1 mRNA, complete cds Length = 846 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgt 347 |||||||||||||| ||||| || ||||| |||||||| ||||| |||||||| Sbjct: 517 ttgtacatgtgagcaatctctggaaccaatggatcatctgggtttgggtccgt 465
>gb|BT016331.1| Zea mays clone Contig164 mRNA sequence Length = 860 Score = 58.0 bits (29), Expect = 2e-05 Identities = 116/145 (80%) Strand = Plus / Minus Query: 233 agcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcag 292 ||||||| |||||||| || |||||| ||| |||| ||||||||||| | ||| || | Sbjct: 545 agcccatcgcgtacttctgcgtccagctgcgggccgtcgactcgtacttcggccggtccg 486 Query: 293 tcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352 ||||||||||||| || ||||| || || | ||| || || ||||| ||||| ||||||| Sbjct: 485 tcttgtacatgtgggcaatctccgggacaagagggtcgtccgggttggggtcggtcagca 426 Query: 353 acgaacagattgacaggaggacctt 377 || ||||| || || |||||||| Sbjct: 425 gggagcagatggagagcaggacctt 401
>gb|AY133670.1| Arabidopsis thaliana At1g64230/F22C12_17 mRNA, complete cds Length = 447 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgt 347 |||||||||||||| ||||| || ||||| |||||||| ||||| |||||||| Sbjct: 383 ttgtacatgtgagcaatctctggaaccaatggatcatctgggtttgggtccgt 331
>gb|AF480945.1| Arabidopsis thaliana ubiquitin conjugating enzyme UBC9A (UBC9A) mRNA, complete cds Length = 723 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgt 347 |||||||||||||| ||||| || ||||| |||||||| ||||| |||||||| Sbjct: 470 ttgtacatgtgagcaatctctggaaccaatggatcatctgggtttgggtccgt 418
>gb|AF385718.1|AF385718 Arabidopsis thaliana At1g64230/F22C12_17 mRNA, complete cds Length = 738 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgt 347 |||||||||||||| ||||| || ||||| |||||||| ||||| |||||||| Sbjct: 509 ttgtacatgtgagcaatctctggaaccaatggatcatctgggtttgggtccgt 457
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 58.0 bits (29), Expect = 2e-05 Identities = 80/97 (82%) Strand = Plus / Plus Query: 280 ttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttc 339 |||||||||||||||||||||||||| || ||||| || || | || || || ||||| Sbjct: 17797623 ttggcccgatcagtcttgtacatgtgcgcaatctccggaactagcgggtcgtctgggttt 17797682 Query: 340 gggtccgtcagcaacgaacagattgacaggaggacct 376 ||||||||||| | ||||| ||||| ||||| |||| Sbjct: 17797683 gggtccgtcagtagagaacaaattgagaggagtacct 17797719
>emb|BX815683.1|CNS0ABHQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS83ZF06 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 776 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgt 347 |||||||||||||| ||||| || ||||| |||||||| ||||| |||||||| Sbjct: 487 ttgtacatgtgagcaatctctggaaccaatggatcatctgggtttgggtccgt 435
>emb|BX815644.1|CNS0ABEX Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS7ZD08 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1496 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgt 347 |||||||||||||| ||||| || ||||| |||||||| ||||| |||||||| Sbjct: 1287 ttgtacatgtgagcaatctctggaaccaatggatcatctgggtttgggtccgt 1235
>emb|BX816916.1|CNS0ABT7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH76ZE04 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 467 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgt 347 |||||||||||||| ||||| || ||||| |||||||| ||||| |||||||| Sbjct: 217 ttgtacatgtgagcaatctctggaaccaatggatcatctgggtttgggtccgt 165
>emb|BX816699.1|CNS0ABXP Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH63ZG10 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 782 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgt 347 |||||||||||||| ||||| || ||||| |||||||| ||||| |||||||| Sbjct: 516 ttgtacatgtgagcaatctctggaaccaatggatcatctgggtttgggtccgt 464
>gb|AY082008.1| Gossypium arboreum ubiquitin-conjugating enzyme E2 gene, complete cds Length = 1985 Score = 58.0 bits (29), Expect = 2e-05 Identities = 74/89 (83%) Strand = Plus / Minus Query: 274 tcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatca 333 |||||||| |||||||||||||| |||||||| || ||||| || || | || |||||| Sbjct: 1823 tcgtactttgcccgatcagtcttatacatgtgtgcaatctccggaacaagtgggtcatca 1764 Query: 334 gggttcgggtccgtcagcaacgaacagat 362 ||||| || || |||| |||||| ||||| Sbjct: 1763 gggtttggatcagtcaacaacgagcagat 1735
>gb|AY082006.1| Gossypium hirsutum ubiquitin-conjugating enzyme E2 (UBC1) gene, complete cds Length = 1982 Score = 58.0 bits (29), Expect = 2e-05 Identities = 74/89 (83%) Strand = Plus / Minus Query: 274 tcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatca 333 |||||||| |||||||||||||| |||||||| || ||||| || || | || |||||| Sbjct: 1820 tcgtactttgcccgatcagtcttatacatgtgtgcaatctccggaacaagtgggtcatca 1761 Query: 334 gggttcgggtccgtcagcaacgaacagat 362 ||||| || || |||| |||||| ||||| Sbjct: 1760 gggtttggatcagtcaacaacgagcagat 1732
>gb|AY082004.1| Gossypium hirsutum ubiquitin-conjugating enzyme E2 (UBC1) mRNA, complete cds Length = 773 Score = 58.0 bits (29), Expect = 2e-05 Identities = 74/89 (83%) Strand = Plus / Minus Query: 274 tcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatca 333 |||||||| |||||||||||||| |||||||| || ||||| || || | || |||||| Sbjct: 593 tcgtactttgcccgatcagtcttatacatgtgtgcaatctccggaacaagtgggtcatca 534 Query: 334 gggttcgggtccgtcagcaacgaacagat 362 ||||| || || |||| |||||| ||||| Sbjct: 533 gggtttggatcagtcaacaacgagcagat 505
>gb|AC007764.2|AC007764 Genomic sequence for Arabidopsis thaliana BAC F22C12 from chromosome I, complete sequence Length = 111222 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgt 347 |||||||||||||| ||||| || ||||| |||||||| ||||| |||||||| Sbjct: 15738 ttgtacatgtgagcaatctctggaaccaatggatcatctgggtttgggtccgt 15790
>dbj|AP003618.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0561B08 Length = 161083 Score = 58.0 bits (29), Expect = 2e-05 Identities = 80/97 (82%) Strand = Plus / Plus Query: 280 ttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttc 339 |||||||||||||||||||||||||| || ||||| || || | || || || ||||| Sbjct: 2812 ttggcccgatcagtcttgtacatgtgcgcaatctccggaactagcgggtcgtctgggttt 2871 Query: 340 gggtccgtcagcaacgaacagattgacaggaggacct 376 ||||||||||| | ||||| ||||| ||||| |||| Sbjct: 2872 gggtccgtcagtagagaacaaattgagaggagtacct 2908
>dbj|AP004743.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBb0026G06 Length = 123129 Score = 58.0 bits (29), Expect = 2e-05 Identities = 80/97 (82%) Strand = Plus / Plus Query: 280 ttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttc 339 |||||||||||||||||||||||||| || ||||| || || | || || || ||||| Sbjct: 68045 ttggcccgatcagtcttgtacatgtgcgcaatctccggaactagcgggtcgtctgggttt 68104 Query: 340 gggtccgtcagcaacgaacagattgacaggaggacct 376 ||||||||||| | ||||| ||||| ||||| |||| Sbjct: 68105 gggtccgtcagtagagaacaaattgagaggagtacct 68141
>dbj|AK066232.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013057M05, full insert sequence Length = 2141 Score = 58.0 bits (29), Expect = 2e-05 Identities = 80/97 (82%) Strand = Plus / Minus Query: 280 ttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttc 339 |||||||||||||||||||||||||| || ||||| || || | || || || ||||| Sbjct: 1930 ttggcccgatcagtcttgtacatgtgcgcaatctccggaactagcgggtcgtctgggttt 1871 Query: 340 gggtccgtcagcaacgaacagattgacaggaggacct 376 ||||||||||| | ||||| ||||| ||||| |||| Sbjct: 1870 gggtccgtcagtagagaacaaattgagaggagtacct 1834
>gb|AY104017.1| Zea mays PCO119482 mRNA sequence Length = 885 Score = 58.0 bits (29), Expect = 2e-05 Identities = 116/145 (80%) Strand = Plus / Minus Query: 233 agcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcag 292 ||||||| |||||||| || |||||| ||| |||| ||||||||||| | ||| || | Sbjct: 582 agcccatcgcgtacttctgcgtccagctgcgggccgtcgactcgtacttcggccggtccg 523 Query: 293 tcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352 ||||||||||||| || ||||| || || | ||| || || ||||| ||||| ||||||| Sbjct: 522 tcttgtacatgtgggcaatctccgggacaagagggtcgtccgggttggggtcggtcagca 463 Query: 353 acgaacagattgacaggaggacctt 377 || ||||| || || |||||||| Sbjct: 462 gggagcagatggagagcaggacctt 438
>gb|DQ027041.1| Arabidopsis thaliana ubiquitinating enzyme (At1g64230) mRNA, complete cds Length = 447 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgt 347 |||||||||||||| ||||| || ||||| |||||||| ||||| |||||||| Sbjct: 383 ttgtacatgtgagcaatctctggaaccaatggatcatctgggtttgggtccgt 331
>gb|AF034946.1|AF034946 Zea mays ubiquitin conjugating enzyme (UBC) mRNA, complete cds Length = 781 Score = 58.0 bits (29), Expect = 2e-05 Identities = 116/145 (80%) Strand = Plus / Minus Query: 233 agcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcag 292 ||||||| |||||||| || |||||| ||| |||| ||||||||||| | ||| || | Sbjct: 485 agcccatcgcgtacttctgcgtccagctgcgggccgtcgactcgtacttcggccggtccg 426 Query: 293 tcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352 ||||||||||||| || ||||| || || | ||| || || ||||| ||||| ||||||| Sbjct: 425 tcttgtacatgtgggcaatctccgggacaagagggtcgtccgggttggggtcggtcagca 366 Query: 353 acgaacagattgacaggaggacctt 377 || ||||| || || |||||||| Sbjct: 365 gggagcagatggagagcaggacctt 341
>gb|U15971.1|OSU15971 Oryza sativa ubiquitin conjugating enzyme (UBC) gene, complete cds Length = 2088 Score = 54.0 bits (27), Expect = 3e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 280 ttggcccgatcagtcttgtacatgtgagcgatctc 314 |||||||||||||||||||||||||| || ||||| Sbjct: 1925 ttggcccgatcagtcttgtacatgtgcgccatctc 1891
>ref|XM_454516.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E12595g predicted mRNA Length = 447 Score = 52.0 bits (26), Expect = 0.001 Identities = 56/66 (84%) Strand = Plus / Minus Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332 ||||||||| || | ||| ||||| |||| |||||||| || || |||||||||||||| Sbjct: 408 ctcgtacttagctctatcggtcttatacaaatgagcgatttcagggaccaaaggatcatc 349 Query: 333 agggtt 338 |||||| Sbjct: 348 agggtt 343
>emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL Y-1140 of Kluyveromyces lactis Length = 2234072 Score = 52.0 bits (26), Expect = 0.001 Identities = 56/66 (84%) Strand = Plus / Minus Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332 ||||||||| || | ||| ||||| |||| |||||||| || || |||||||||||||| Sbjct: 1117702 ctcgtacttagctctatcggtcttatacaaatgagcgatttcagggaccaaaggatcatc 1117643 Query: 333 agggtt 338 |||||| Sbjct: 1117642 agggtt 1117637
>gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome V, complete sequence Length = 1519138 Score = 52.0 bits (26), Expect = 0.001 Identities = 74/90 (82%) Strand = Plus / Plus Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332 |||||||||||||| ||| |||||||| |||||||| || || || ||||| || || || Sbjct: 960459 ctcgtacttggccctatccgtcttgtagatgtgagcaatttccggaaccaacgggtcgtc 960518 Query: 333 agggttcgggtccgtcagcaacgaacagat 362 ||||| | |||||||| ||| || ||||| Sbjct: 960519 cgggttggcgtccgtcaacaaagagcagat 960548
>gb|AY082010.1| Gossypium raimondii ubiquitin-conjugating enzyme E2 gene, complete cds Length = 2013 Score = 52.0 bits (26), Expect = 0.001 Identities = 71/86 (82%) Strand = Plus / Minus Query: 277 tacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcaggg 336 ||||| |||||||||||||| |||||||| || ||||| || || | || ||||||||| Sbjct: 1809 tactttgcccgatcagtcttatacatgtgcgcaatctccggaacaagtgggtcatcaggg 1750 Query: 337 ttcgggtccgtcagcaacgaacagat 362 || || || |||| |||||| ||||| Sbjct: 1749 tttggatcagtcaacaacgagcagat 1724
>gb|AY082009.1| Gossypium thurberi ubiquitin-conjugating enzyme E2 gene, complete cds Length = 2016 Score = 52.0 bits (26), Expect = 0.001 Identities = 71/86 (82%) Strand = Plus / Minus Query: 277 tacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcaggg 336 ||||| |||||||||||||| |||||||| || ||||| || || | || ||||||||| Sbjct: 1812 tactttgcccgatcagtcttatacatgtgcgcaatctccggaacaagtgggtcatcaggg 1753 Query: 337 ttcgggtccgtcagcaacgaacagat 362 || || || |||| |||||| ||||| Sbjct: 1752 tttggatcagtcaacaacgagcagat 1727
>ref|NM_210385.1| Eremothecium gossypii AER173Cp (AER173C), mRNA Length = 444 Score = 52.0 bits (26), Expect = 0.001 Identities = 74/90 (82%) Strand = Plus / Minus Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332 |||||||||||||| ||| |||||||| |||||||| || || || ||||| || || || Sbjct: 405 ctcgtacttggccctatccgtcttgtagatgtgagcaatttccggaaccaacgggtcgtc 346 Query: 333 agggttcgggtccgtcagcaacgaacagat 362 ||||| | |||||||| ||| || ||||| Sbjct: 345 cgggttggcgtccgtcaacaaagagcagat 316
>gb|AY104144.1| Zea mays PCO100898 mRNA sequence Length = 831 Score = 52.0 bits (26), Expect = 0.001 Identities = 38/42 (90%) Strand = Plus / Minus Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctc 314 ||||||||| | |||||| ||||||||||||||||| ||||| Sbjct: 538 ctcgtacttaggccgatccgtcttgtacatgtgagcaatctc 497
>gb|AF030296.1|AF030296 Glomerella cingulata ubiquitin conjugating enzyme UBC1 (UBC1) mRNA, complete cds Length = 961 Score = 52.0 bits (26), Expect = 0.001 Identities = 80/98 (81%) Strand = Plus / Minus Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagc 351 |||||||| | ||| ||||||||||| || | || || || ||||| |||||||||||| Sbjct: 591 gtcttgtagacgtgtgcgatctcggggacgagcggttcgtcggggttggggtccgtcagc 532 Query: 352 aacgaacagattgacaggaggacctttgatatggtcaa 389 | ||| ||||| || || |||||||| || |||||||| Sbjct: 531 atcgagcagatggagagcaggaccttagagatggtcaa 494
>gb|U17250.1|BCSC1 Brassica oleracea ubiquitine conjugating enzyme mRNA, partial cds Length = 607 Score = 52.0 bits (26), Expect = 0.001 Identities = 92/114 (80%) Strand = Plus / Minus Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332 |||||||||| | || || |||||||| ||||||| || || || |||| ||||||||| Sbjct: 348 ctcgtacttgactcggtctgtcttgtaggtgtgagctatttctggaaccagaggatcatc 289 Query: 333 agggttcgggtccgtcagcaacgaacagattgacaggaggacctttgatatggt 386 |||||| || || ||||||| || || || || || |||||||| |||||||| Sbjct: 288 agggtttggatctgtcagcagtgagcatatcgaaagaaggaccttggatatggt 235
>gb|AY220735.1| Hordeum vulgare ubiquitin-conjugating enzyme (UBC) mRNA, complete cds Length = 758 Score = 50.1 bits (25), Expect = 0.005 Identities = 76/93 (81%) Strand = Plus / Minus Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332 ||||||||| | |||||| |||||||||||||| || ||||| || || | ||| || || Sbjct: 507 ctcgtacttagaccgatccgtcttgtacatgtgggcaatctcagggacgagagggtcgtc 448 Query: 333 agggttcgggtccgtcagcaacgaacagattga 365 ||||| ||||| || |||| ||| |||||||| Sbjct: 447 cgggttagggtcggtaagcagcgagcagattga 415
>gb|DQ350764.1| Ajellomyces capsulatus ubiquitin-conjugating enzyme E2-like protein (UBC1) gene, partial sequence Length = 1874 Score = 50.1 bits (25), Expect = 0.005 Identities = 64/77 (83%) Strand = Plus / Minus Query: 286 cgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtcc 345 ||||| |||||||| | ||||| || || || |||||||||||||| ||||||||||| Sbjct: 1383 cgatcggtcttgtaaacatgagcaatttcaggtaccaaaggatcatccgggttcgggtct 1324 Query: 346 gtcagcaacgaacagat 362 || |||| |||||||| Sbjct: 1323 gtgagcatggaacagat 1307
>gb|AY639585.1| Picea abies ubiquitin-conjugating enzyme UBC1 mRNA, complete cds Length = 478 Score = 50.1 bits (25), Expect = 0.005 Identities = 52/61 (85%) Strand = Plus / Minus Query: 289 tcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtc 348 |||||||||||||| ||||| ||||| || || | ||||||||| ||||| || |||||| Sbjct: 278 tcagtcttgtacatatgagcaatctctggtacaagaggatcatctgggtttggatccgtc 219 Query: 349 a 349 | Sbjct: 218 a 218
>gb|AY952317.1| Triticum aestivum cultivar 7269-10 immature spike ubiquitin-conjugating enzyme 2 mRNA, complete cds Length = 853 Score = 48.1 bits (24), Expect = 0.021 Identities = 102/128 (79%) Strand = Plus / Minus Query: 235 cccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcagtc 294 |||||||||||||| || |||||| ||| || | | ||| ||||| | ||| || ||| Sbjct: 583 cccatggcgtacttctgcgtccagctgcgggctgtcgtctcatactttgaccggtccgtc 524 Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagcaac 354 ||||||||||| || |||||||| || | |||||||| ||||| || || ||||||| Sbjct: 523 ttgtacatgtgggcaatctcgggaacaaggggatcatccgggttgggatcggtcagcagg 464 Query: 355 gaacagat 362 |||||||| Sbjct: 463 gaacagat 456
>gb|AY769917.1| Arachis hypogaea ubiquitin-conjugating enzyme (UBC) mRNA, complete cds Length = 780 Score = 46.1 bits (23), Expect = 0.084 Identities = 35/39 (89%) Strand = Plus / Minus Query: 294 cttgtacatgtgagcgatctcgggcaccaaaggatcatc 332 ||||||||| ||||| |||||||||| ||||||||||| Sbjct: 516 cttgtacatatgagcaatctcgggcattaaaggatcatc 478
>ref|XM_752036.1| Ustilago maydis 521 ubiquitin-conjugating enzyme E2-16 kDa (UM00982.1) partial mRNA Length = 444 Score = 46.1 bits (23), Expect = 0.084 Identities = 59/71 (83%) Strand = Plus / Minus Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagc 351 |||||||||| || ||||||||||| || | ||||||||||| || ||||| || ||| Sbjct: 386 gtcttgtacaagttggcgatctcgggaacaagcggatcatcaggatttgggtcagtgagc 327 Query: 352 aacgaacagat 362 | ||||||||| Sbjct: 326 atcgaacagat 316
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 46.1 bits (23), Expect = 0.084 Identities = 23/23 (100%) Strand = Plus / Minus Query: 367 aggaggacctttgatatggtcaa 389 ||||||||||||||||||||||| Sbjct: 6896291 aggaggacctttgatatggtcaa 6896269
>dbj|AP006156.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:B1043F11 Length = 167137 Score = 46.1 bits (23), Expect = 0.084 Identities = 23/23 (100%) Strand = Plus / Minus Query: 367 aggaggacctttgatatggtcaa 389 ||||||||||||||||||||||| Sbjct: 124186 aggaggacctttgatatggtcaa 124164
>dbj|AK065902.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013047C20, full insert sequence Length = 896 Score = 46.1 bits (23), Expect = 0.084 Identities = 23/23 (100%) Strand = Plus / Minus Query: 367 aggaggacctttgatatggtcaa 389 ||||||||||||||||||||||| Sbjct: 473 aggaggacctttgatatggtcaa 451
>dbj|AK059627.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-030-H11, full insert sequence Length = 899 Score = 46.1 bits (23), Expect = 0.084 Identities = 23/23 (100%) Strand = Plus / Minus Query: 367 aggaggacctttgatatggtcaa 389 ||||||||||||||||||||||| Sbjct: 465 aggaggacctttgatatggtcaa 443
>ref|XM_954840.1| Neurospora crassa OR74A hypothetical protein ( (XM_016084) hypothetical protein XP_016084 [Homo sapiens] ) (NCU02289.1) partial mRNA Length = 444 Score = 44.1 bits (22), Expect = 0.33 Identities = 73/90 (81%) Strand = Plus / Minus Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332 ||||||| |||| || || |||||||||| ||| || ||||||||||| | || || || Sbjct: 405 ctcgtacctggcgcggtctgtcttgtacacgtgcgcaatctcgggcacaagcgggtcgtc 346 Query: 333 agggttcgggtccgtcagcaacgaacagat 362 |||||| || ||||||| || ||| ||||| Sbjct: 345 agggttgggatccgtcaacatcgagcagat 316
>ref|XM_331064.1| Neurospora crassa OR74A hypothetical protein ( (XM_016084) hypothetical protein XP_016084 [Homo sapiens] ) (NCU02289.1) partial mRNA Length = 444 Score = 44.1 bits (22), Expect = 0.33 Identities = 73/90 (81%) Strand = Plus / Minus Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332 ||||||| |||| || || |||||||||| ||| || ||||||||||| | || || || Sbjct: 405 ctcgtacctggcgcggtctgtcttgtacacgtgcgcaatctcgggcacaagcgggtcgtc 346 Query: 333 agggttcgggtccgtcagcaacgaacagat 362 |||||| || ||||||| || ||| ||||| Sbjct: 345 agggttgggatccgtcaacatcgagcagat 316
>ref|XM_655273.1| Aspergillus nidulans FGSC A4 ubiquitin-conjugating enzyme E2-16 kDa (AN2761.2), mRNA Length = 444 Score = 44.1 bits (22), Expect = 0.33 Identities = 43/50 (86%) Strand = Plus / Minus Query: 289 tcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338 ||||||||||||| ||||| ||||| ||||||| ||| ||||| ||||| Sbjct: 389 tcagtcttgtacacatgagcaatctcaggcaccagagggtcatccgggtt 340
>gb|AY491500.1| Capsicum annuum ubiquitin-conjugating enzyme E2 mRNA, complete cds Length = 779 Score = 44.1 bits (22), Expect = 0.33 Identities = 49/58 (84%) Strand = Plus / Minus Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtca 349 ||||||||||| ||||| ||||| || |||| ||| ||||| ||||| || ||||||| Sbjct: 431 gtcttgtacatatgagcaatctcaggaaccagagggtcatcggggtttggatccgtca 374
>emb|CR733525.2|CNS0GSRO Tetraodon nigroviridis full-length cDNA Length = 1352 Score = 44.1 bits (22), Expect = 0.33 Identities = 34/38 (89%) Strand = Plus / Minus Query: 307 gcgatctcgggcaccaaaggatcatcagggttcgggtc 344 |||||||| ||||||| || ||||||||||||||||| Sbjct: 746 gcgatctctggcaccagtgggtcatcagggttcgggtc 709
>emb|CR732722.2|CNS0GSBA Tetraodon nigroviridis full-length cDNA Length = 1355 Score = 44.1 bits (22), Expect = 0.33 Identities = 34/38 (89%) Strand = Plus / Minus Query: 307 gcgatctcgggcaccaaaggatcatcagggttcgggtc 344 |||||||| ||||||| || ||||||||||||||||| Sbjct: 748 gcgatctctggcaccagtgggtcatcagggttcgggtc 711
>emb|CR731170.1|CNS0GR47 Tetraodon nigroviridis full-length cDNA Length = 1336 Score = 44.1 bits (22), Expect = 0.33 Identities = 34/38 (89%) Strand = Plus / Minus Query: 307 gcgatctcgggcaccaaaggatcatcagggttcgggtc 344 |||||||| ||||||| || ||||||||||||||||| Sbjct: 738 gcgatctctggcaccagtgggtcatcagggttcgggtc 701
>emb|CR728345.2|CNS0GOXR Tetraodon nigroviridis full-length cDNA Length = 1345 Score = 44.1 bits (22), Expect = 0.33 Identities = 34/38 (89%) Strand = Plus / Minus Query: 307 gcgatctcgggcaccaaaggatcatcagggttcgggtc 344 |||||||| ||||||| || ||||||||||||||||| Sbjct: 746 gcgatctctggcaccagtgggtcatcagggttcgggtc 709
>emb|CR724467.2|CNS0GLY1 Tetraodon nigroviridis full-length cDNA Length = 1349 Score = 44.1 bits (22), Expect = 0.33 Identities = 34/38 (89%) Strand = Plus / Minus Query: 307 gcgatctcgggcaccaaaggatcatcagggttcgggtc 344 |||||||| ||||||| || ||||||||||||||||| Sbjct: 746 gcgatctctggcaccagtgggtcatcagggttcgggtc 709
>emb|CR708686.2|CNS0G9RU Tetraodon nigroviridis full-length cDNA Length = 654 Score = 44.1 bits (22), Expect = 0.33 Identities = 34/38 (89%) Strand = Plus / Minus Query: 307 gcgatctcgggcaccaaaggatcatcagggttcgggtc 344 |||||||| ||||||| || ||||||||||||||||| Sbjct: 54 gcgatctctggcaccagtgggtcatcagggttcgggtc 17
>emb|CR673935.2|CNS0FIZ9 Tetraodon nigroviridis full-length cDNA Length = 1374 Score = 44.1 bits (22), Expect = 0.33 Identities = 34/38 (89%) Strand = Plus / Minus Query: 307 gcgatctcgggcaccaaaggatcatcagggttcgggtc 344 |||||||| ||||||| || ||||||||||||||||| Sbjct: 736 gcgatctctggcaccagtgggtcatcagggttcgggtc 699
>emb|CR661341.2|CNS0F99F Tetraodon nigroviridis full-length cDNA Length = 1098 Score = 44.1 bits (22), Expect = 0.33 Identities = 34/38 (89%) Strand = Plus / Minus Query: 307 gcgatctcgggcaccaaaggatcatcagggttcgggtc 344 |||||||| ||||||| || ||||||||||||||||| Sbjct: 735 gcgatctctggcaccagtgggtcatcagggttcgggtc 698
>emb|CR651495.2|CNS0F1NX Tetraodon nigroviridis full-length cDNA Length = 1105 Score = 44.1 bits (22), Expect = 0.33 Identities = 34/38 (89%) Strand = Plus / Minus Query: 307 gcgatctcgggcaccaaaggatcatcagggttcgggtc 344 |||||||| ||||||| || ||||||||||||||||| Sbjct: 738 gcgatctctggcaccattgggtcatcagggttcgggtc 701
>emb|CR648302.2|CNS0EZ78 Tetraodon nigroviridis full-length cDNA Length = 1099 Score = 44.1 bits (22), Expect = 0.33 Identities = 34/38 (89%) Strand = Plus / Minus Query: 307 gcgatctcgggcaccaaaggatcatcagggttcgggtc 344 |||||||| ||||||| || ||||||||||||||||| Sbjct: 732 gcgatctctggcaccagtgggtcatcagggttcgggtc 695
>emb|CR647212.2|CNS0EYCY Tetraodon nigroviridis full-length cDNA Length = 1080 Score = 44.1 bits (22), Expect = 0.33 Identities = 34/38 (89%) Strand = Plus / Minus Query: 307 gcgatctcgggcaccaaaggatcatcagggttcgggtc 344 |||||||| ||||||| || ||||||||||||||||| Sbjct: 714 gcgatctctggcaccagtgggtcatcagggttcgggtc 677
>gb|AY082005.1| Gossypium hirsutum ubiquitin-conjugating enzyme E2 (UBC2) mRNA, complete cds Length = 850 Score = 44.1 bits (22), Expect = 0.33 Identities = 70/86 (81%) Strand = Plus / Minus Query: 277 tacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcaggg 336 ||||| |||||||||||||| |||||||| || ||||| | || | || ||||||||| Sbjct: 569 tactttgcccgatcagtcttatacatgtgcgcaatctccagaacaagtgggtcatcaggg 510 Query: 337 ttcgggtccgtcagcaacgaacagat 362 || || || |||| |||||| ||||| Sbjct: 509 tttggatcagtcaacaacgagcagat 484
>gb|AY082007.1| Gossypium hirsutum ubiquitin-conjugating enzyme E2 (UBC2) gene, complete cds Length = 1953 Score = 44.1 bits (22), Expect = 0.33 Identities = 70/86 (81%) Strand = Plus / Minus Query: 277 tacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcaggg 336 ||||| |||||||||||||| |||||||| || ||||| | || | || ||||||||| Sbjct: 1749 tactttgcccgatcagtcttatacatgtgcgcaatctccagaacaagtgggtcatcaggg 1690 Query: 337 ttcgggtccgtcagcaacgaacagat 362 || || || |||| |||||| ||||| Sbjct: 1689 tttggatcagtcaacaacgagcagat 1664
>gb|AY105836.1| Zea mays PCO130472 mRNA sequence Length = 915 Score = 44.1 bits (22), Expect = 0.33 Identities = 22/22 (100%) Strand = Plus / Minus Query: 367 aggaggacctttgatatggtca 388 |||||||||||||||||||||| Sbjct: 523 aggaggacctttgatatggtca 502
>ref|NM_111704.1| Arabidopsis thaliana ubiquitin conjugating enzyme/ ubiquitin-like activating enzyme AT3G08700 mRNA, complete cds Length = 450 Score = 42.1 bits (21), Expect = 1.3 Identities = 42/49 (85%) Strand = Plus / Minus Query: 304 tgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352 ||||| ||||| ||||| | |||||||| ||||||||||| ||||||| Sbjct: 377 tgagctatctccggcacaagaggatcatttgggttcgggtcagtcagca 329
>gb|BC040758.1| Mus musculus cDNA sequence BC040758, mRNA (cDNA clone IMAGE:4216169) Length = 1758 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 280 ttggcccgatcagtcttgtacatgt 304 |||||||||||||| |||||||||| Sbjct: 1386 ttggcccgatcagtattgtacatgt 1362
>gb|BC034067.1| Mus musculus cDNA sequence BC040758, mRNA (cDNA clone IMAGE:4216169), partial cds Length = 1758 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 280 ttggcccgatcagtcttgtacatgt 304 |||||||||||||| |||||||||| Sbjct: 1386 ttggcccgatcagtattgtacatgt 1362
>ref|XM_461820.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0G06941g) partial mRNA Length = 444 Score = 42.1 bits (21), Expect = 1.3 Identities = 39/45 (86%) Strand = Plus / Minus Query: 294 cttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338 |||||| || |||||||| || |||||||||||||| || ||||| Sbjct: 384 cttgtaaatatgagcgatttctggcaccaaaggatcgtcggggtt 340
>emb|CR382139.1| Debaryomyces hansenii chromosome G of strain CBS767 of Debaryomyces hansenii Length = 2051428 Score = 42.1 bits (21), Expect = 1.3 Identities = 39/45 (86%) Strand = Plus / Plus Query: 294 cttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338 |||||| || |||||||| || |||||||||||||| || ||||| Sbjct: 551046 cttgtaaatatgagcgatttctggcaccaaaggatcgtcggggtt 551090
>dbj|AK144400.1| Mus musculus adult male intestinal mucosa cDNA, RIKEN full-length enriched library, clone:G630055D06 product:similar to Protocadherin LKC [Homo sapiens], full insert sequence Length = 4121 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 280 ttggcccgatcagtcttgtacatgt 304 |||||||||||||| |||||||||| Sbjct: 3772 ttggcccgatcagtattgtacatgt 3748
>gb|BT024821.1| Arabidopsis thaliana At3g08700 gene, complete cds Length = 450 Score = 42.1 bits (21), Expect = 1.3 Identities = 42/49 (85%) Strand = Plus / Minus Query: 304 tgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352 ||||| ||||| ||||| | |||||||| ||||||||||| ||||||| Sbjct: 377 tgagctatctccggcacaagaggatcatttgggttcgggtcagtcagca 329
>gb|AC159745.5| Mus musculus 6 BAC RP23-394N3 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 185824 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 acacagagatttaacttaata 21 ||||||||||||||||||||| Sbjct: 168117 acacagagatttaacttaata 168097
>ref|NM_001033364.1| Mus musculus cDNA sequence BC040758 (BC040758), mRNA Length = 4121 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 280 ttggcccgatcagtcttgtacatgt 304 |||||||||||||| |||||||||| Sbjct: 3772 ttggcccgatcagtattgtacatgt 3748
>gb|U66493.1|MAU66493 Metarhizium anisopliae ubiquitin conjugating enzyme (MET-UBC1) mRNA, complete cds Length = 405 Score = 42.1 bits (21), Expect = 1.3 Identities = 36/41 (87%) Strand = Plus / Minus Query: 304 tgagcgatctcgggcaccaaaggatcatcagggttcgggtc 344 ||||| |||||||| || | ||||||||||||||| ||||| Sbjct: 335 tgagcaatctcgggtacaagaggatcatcagggttggggtc 295
>gb|DQ027026.1| Arabidopsis thaliana ubiquitinating enzyme (At3g08700) mRNA, complete cds Length = 450 Score = 42.1 bits (21), Expect = 1.3 Identities = 42/49 (85%) Strand = Plus / Minus Query: 304 tgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352 ||||| ||||| ||||| | |||||||| ||||||||||| ||||||| Sbjct: 377 tgagctatctccggcacaagaggatcatttgggttcgggtcagtcagca 329
>gb|DQ294262.1| Solanum tuberosum clone 130D10 ubiquitin-conjugating enzyme E2-like protein mRNA, complete cds Length = 806 Score = 42.1 bits (21), Expect = 1.3 Identities = 93/117 (79%) Strand = Plus / Minus Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332 |||||| ||||||| |||||||||||||| ||||| || || || || | |||||||| Sbjct: 484 ctcgtatttggccctgtcagtcttgtacatatgagcaatttctggtacaagtggatcatc 425 Query: 333 agggttcgggtccgtcagcaacgaacagattgacaggaggacctttgatatggtcaa 389 ||||| || || |||| | || ||||| |||| |||||||| ||||||||||| Sbjct: 424 tgggtttggatctgtcaatagagagcagatggacaacaggaccttagatatggtcaa 368
>gb|AC153922.6| Mus musculus 6 BAC RP23-81P16 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 234722 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 1 acacagagatttaacttaata 21 ||||||||||||||||||||| Sbjct: 69285 acacagagatttaacttaata 69265
>ref|XM_662484.1| Cryptosporidium hominis TU502 ubiquitin-conjugating enzyme (Chro.40073) partial mRNA Length = 357 Score = 40.1 bits (20), Expect = 5.2 Identities = 38/44 (86%) Strand = Plus / Minus Query: 289 tcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332 |||||||| |||| |||||||||||| || || | ||||||||| Sbjct: 302 tcagtcttatacaagtgagcgatctcaggtactagaggatcatc 259
>emb|AL353900.14| Human DNA sequence from clone RP11-202C2 on chromosome 10 Contains part of the gene for VPS10 domain receptor protein SORCS 3 (SORCS3), complete sequence Length = 158737 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 67 ttgacatggcaagagtacat 86 |||||||||||||||||||| Sbjct: 92343 ttgacatggcaagagtacat 92362
>emb|X92663.1|DMUBCD2 D.melanogaster mRNA for ubiquitin-conjugating enzyme UbcD2 Length = 1222 Score = 40.1 bits (20), Expect = 5.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 361 attgacaggaggacctttgatatggtca 388 |||||||| | ||||||||||||||||| Sbjct: 863 attgacagcaagacctttgatatggtca 836
>dbj|AB226249.1| Aspergillus oryzae cDNA, contig sequence: AoEST3108 Length = 1024 Score = 40.1 bits (20), Expect = 5.2 Identities = 65/80 (81%) Strand = Plus / Minus Query: 289 tcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtc 348 ||||||||||||| || || || || |||||||| || || || ||||| ||||| || Sbjct: 551 tcagtcttgtacacatgcgcaatttcaggcaccaacgggtcgtctgggttggggtctgta 492 Query: 349 agcaacgaacagattgacag 368 |||| ||||||||| ||||| Sbjct: 491 agcatcgaacagatggacag 472
>dbj|AP007167.1| Aspergillus oryzae RIB40 genomic DNA, SC020 Length = 1824958 Score = 40.1 bits (20), Expect = 5.2 Identities = 65/80 (81%) Strand = Plus / Plus Query: 289 tcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtc 348 ||||||||||||| || || || || |||||||| || || || ||||| ||||| || Sbjct: 204387 tcagtcttgtacacatgcgcaatttcaggcaccaacgggtcgtctgggttggggtctgta 204446 Query: 349 agcaacgaacagattgacag 368 |||| ||||||||| ||||| Sbjct: 204447 agcatcgaacagatggacag 204466
>ref|NM_164943.1| Drosophila melanogaster Ubiquitin conjugating enzyme 2 CG6720-RB, transcript variant B (UbcD2), mRNA Length = 1350 Score = 40.1 bits (20), Expect = 5.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 361 attgacaggaggacctttgatatggtca 388 |||||||| | ||||||||||||||||| Sbjct: 667 attgacagcaagacctttgatatggtca 640
>gb|AY094899.1| Drosophila melanogaster RE74673 full insert cDNA Length = 1644 Score = 40.1 bits (20), Expect = 5.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 361 attgacaggaggacctttgatatggtca 388 |||||||| | ||||||||||||||||| Sbjct: 943 attgacagcaagacctttgatatggtca 916
>ref|NM_057789.3| Drosophila melanogaster Ubiquitin conjugating enzyme 2 CG6720-RA, transcript variant A (UbcD2), mRNA Length = 1625 Score = 40.1 bits (20), Expect = 5.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 361 attgacaggaggacctttgatatggtca 388 |||||||| | ||||||||||||||||| Sbjct: 942 attgacagcaagacctttgatatggtca 915
>dbj|AK146659.1| Mus musculus 16 days embryo kidney cDNA, RIKEN full-length enriched library, clone:I920039M22 product:ubiquitin-conjugating enzyme E2D 2, full insert sequence Length = 3458 Score = 40.1 bits (20), Expect = 5.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 305 gagcgatctcgggcaccaaaggatcatc 332 |||| ||||| ||||||||||||||||| Sbjct: 1993 gagcaatctcaggcaccaaaggatcatc 1966
>ref|XM_625662.1| Cryptosporidium parvum Iowa II ubiquitin-conjugating enzyme (cgd4_570), partial mRNA Length = 486 Score = 40.1 bits (20), Expect = 5.2 Identities = 38/44 (86%) Strand = Plus / Minus Query: 289 tcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332 |||||||| |||| |||||||||||| || || | ||||||||| Sbjct: 431 tcagtcttatacaagtgagcgatctcaggtactagaggatcatc 388
>gb|AC007147.8|AC007147 Drosophila melanogaster, chromosome 2L, region 32A-, BAC clone BACR19N18, complete sequence Length = 196248 Score = 40.1 bits (20), Expect = 5.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 361 attgacaggaggacctttgatatggtca 388 |||||||| | ||||||||||||||||| Sbjct: 151264 attgacagcaagacctttgatatggtca 151237
>gb|AE003629.2| Drosophila melanogaster chromosome 2L, section 38 of 83 of the complete sequence Length = 261176 Score = 40.1 bits (20), Expect = 5.2 Identities = 26/28 (92%) Strand = Plus / Plus Query: 361 attgacaggaggacctttgatatggtca 388 |||||||| | ||||||||||||||||| Sbjct: 259493 attgacagcaagacctttgatatggtca 259520 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,202,923 Number of Sequences: 3902068 Number of extensions: 2202923 Number of successful extensions: 37205 Number of sequences better than 10.0: 183 Number of HSP's better than 10.0 without gapping: 184 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 36844 Number of HSP's gapped (non-prelim): 326 length of query: 389 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 367 effective length of database: 17,147,199,772 effective search space: 6293022316324 effective search space used: 6293022316324 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)