ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl02e08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY736121.1| Triticum aestivum ubiquitin-conjugating enzyme mR... 281 8e-73
2dbj|AK119682.1| Oryza sativa (japonica cultivar-group) cDNA clon... 198 9e-48
3ref|XM_474269.1| Oryza sativa (japonica cultivar-group), predic... 196 4e-47
4emb|AL606619.3|OSJN00032 Oryza sativa genomic DNA, chromosome 4,... 178 9e-42
5dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 178 9e-42
6dbj|AK104783.1| Oryza sativa (japonica cultivar-group) cDNA clon... 178 9e-42
7dbj|AK060954.1| Oryza sativa (japonica cultivar-group) cDNA clon... 178 9e-42
8emb|AL732340.3| Oryza sativa genomic DNA, chromosome 4, BAC clon... 178 9e-42
9gb|BT016295.1| Zea mays clone Contig128 mRNA sequence 141 2e-30
10gb|AY109692.1| Zea mays CL301_1 mRNA sequence 141 2e-30
11dbj|D17786.1|RICKN6922 Oryza sativa KN69 mRNA for ubiquitin-conj... 131 2e-27
12gb|AY083611.1| Oryza sativa elicitor and UV light related transc... 117 3e-23
13ref|XM_464900.1| Oryza sativa (japonica cultivar-group), mRNA 111 2e-21
14dbj|AK121248.1| Oryza sativa (japonica cultivar-group) cDNA clon... 111 2e-21
15dbj|AB074412.1| Oryza sativa (japonica cultivar-group) mRNA for ... 111 2e-21
16dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 103 4e-19
17dbj|AP005777.2| Oryza sativa (japonica cultivar-group) genomic D... 103 4e-19
18gb|DQ207855.1| Solanum tuberosum clone 078A09 ubiquitin-conjugat... 100 7e-18
19ref|NM_192451.1| Oryza sativa (japonica cultivar-group), predic... 96 1e-16
20dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 96 1e-16
21dbj|AP003291.3| Oryza sativa (japonica cultivar-group) genomic D... 96 1e-16
22dbj|AP003294.2| Oryza sativa (japonica cultivar-group) genomic D... 96 1e-16
23dbj|AK099284.1| Oryza sativa (japonica cultivar-group) cDNA clon... 96 1e-16
24dbj|AK063826.1| Oryza sativa (japonica cultivar-group) cDNA clon... 96 1e-16
25emb|AJ867286.1| Oryza sativa (indica cultivar-group) mRNA for ub... 96 1e-16
26dbj|AB074411.1| Oryza sativa (japonica cultivar-group) mRNA for ... 96 1e-16
27ref|XM_463908.1| Oryza sativa (japonica cultivar-group), mRNA 90 6e-15
28dbj|AK120237.1| Oryza sativa (japonica cultivar-group) cDNA clon... 90 6e-15
29gb|BT017507.1| Zea mays clone EL01N0417C02.c mRNA sequence 88 2e-14
30gb|AF154650.1| Nicotiana tabacum clone PR35 mRNA sequence 88 2e-14
31gb|AY106353.1| Zea mays PCO068301 mRNA sequence 88 2e-14
32ref|NM_124709.2| Arabidopsis thaliana UBC10; ubiquitin conjugati... 86 1e-13
33ref|NM_180850.1| Arabidopsis thaliana UBC10; ubiquitin conjugati... 86 1e-13
34emb|Z14991.1|ATUBC10 A.thaliana UBC10 mRNA for ubiquitin conjuga... 86 1e-13
35gb|AY113937.1| Arabidopsis thaliana putative E2, ubiquitin-conju... 86 1e-13
36gb|AF326872.1| Arabidopsis thaliana putative E2, ubiquitin-conju... 86 1e-13
37gb|AY129488.1| Arabidopsis thaliana AT5g53300/K19E1_10 mRNA, com... 86 1e-13
38gb|AY065059.1| Arabidopsis thaliana AT5g53300/K19E1_10 mRNA, com... 86 1e-13
39gb|AY039566.1| Arabidopsis thaliana AT5g53300/K19E1_10 mRNA, com... 86 1e-13
40gb|AF325005.2|AF325005 Arabidopsis thaliana AT5g53300 (AT5g53300... 86 1e-13
41gb|AF324718.2|AF324718 Arabidopsis thaliana AT5g53300 (AT5g53300... 86 1e-13
42emb|BX833981.1|CNS0A0DI Arabidopsis thaliana Full-length cDNA Co... 86 1e-13
43gb|AY086109.1| Arabidopsis thaliana clone 21455 mRNA, complete s... 86 1e-13
44dbj|AP004078.3| Oryza sativa (japonica cultivar-group) genomic D... 86 1e-13
45dbj|AP005851.2| Oryza sativa (japonica cultivar-group) genomic D... 86 1e-13
46dbj|AB013388.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 86 1e-13
47gb|DQ027024.1| Arabidopsis thaliana ubiquitinating enzyme (At5g5... 86 1e-13
48gb|L00640.1|ATHUBCC Arabidopsis thaliana ubiquitin conjugating e... 86 1e-13
49ref|NM_179131.1| Arabidopsis thaliana UBC9 (UBIQUITIN CONJUGATIN... 84 4e-13
50ref|NM_118934.1| Arabidopsis thaliana UBC9 (UBIQUITIN CONJUGATIN... 84 4e-13
51gb|AY142644.1| Arabidopsis thaliana E2 ubiquitin-conjugating enz... 84 4e-13
52emb|Z14990.1|ATUBC9 A.thaliana UBC9 mRNA for ubiquitin conjugati... 84 4e-13
53gb|AY080741.1| Arabidopsis thaliana putative E2, ubiquitin-conju... 84 4e-13
54emb|X72626.1|ATUCEE2B A.thaliana UbcAT4b mRNA for ubiquitin conj... 84 4e-13
55emb|AL161572.2|ATCHRIV68 Arabidopsis thaliana DNA chromosome 4, ... 84 4e-13
56emb|AL035524.1|ATT13J8 Arabidopsis thaliana DNA chromosome 4, BA... 84 4e-13
57gb|AF325019.2|AF325019 Arabidopsis thaliana AT4g27960 (AT4g27960... 84 4e-13
58gb|AY086447.1| Arabidopsis thaliana clone 25162 mRNA, complete s... 84 4e-13
59gb|DQ027023.1| Arabidopsis thaliana ubiquitinating enzyme (At4g2... 84 4e-13
60gb|L00639.1|ATHUBCB Arabidopsis thaliana ubiquitin conjugating e... 84 4e-13
61dbj|AP004929.1| Lotus japonicus genomic DNA, chromosome 3, clone... 82 2e-12
62gb|AY083170.1| Malus x domestica ubiquitin conjugating-like enzy... 80 6e-12
63emb|BX829864.1|CNS0A1IT Arabidopsis thaliana Full-length cDNA Co... 80 6e-12
64ref|NM_111703.2| Arabidopsis thaliana ubiquitin conjugating enzy... 78 2e-11
65emb|Z14992.1|ATUBC11 A.thaliana UBC11 mRNA for ubiquitin conjuga... 78 2e-11
66gb|AY091223.1| Arabidopsis thaliana putative ubiquitin conjugati... 78 2e-11
67gb|AY063869.1| Arabidopsis thaliana putative E2, ubiquitin-conju... 78 2e-11
68gb|AC012562.5|AC012562 Arabidopsis thaliana chromosome 3 BAC F17... 78 2e-11
69gb|DQ027025.1| Arabidopsis thaliana ubiquitinating enzyme (At3g0... 78 2e-11
70gb|L00641.1|ATHUBCD Arabidopsis thaliana ubiquitin conjugating e... 78 2e-11
71gb|AY486137.1| Capsicum annuum ubiquitin-conjugating protein mRN... 76 9e-11
72gb|BT013767.1| Lycopersicon esculentum clone 132651R, mRNA sequence 74 4e-10
73ref|XM_445894.1| Candida glabrata CBS138, CAGL0E04752g partial mRNA 74 4e-10
74emb|CR380951.1| Candida glabrata strain CBS138 chromosome E comp... 74 4e-10
75gb|DQ284472.1| Solanum tuberosum clone 116D11 ubiquitin-conjugat... 74 4e-10
76gb|L23762.1|TOM1KUC Lycopersicon esculentum ubiquitin carrier pr... 74 4e-10
77ref|XM_571364.1| Cryptococcus neoformans var. neoformans JEC21 u... 72 1e-09
78emb|Z14993.1|ATUBC12 A.thaliana UBC12 gene 72 1e-09
79gb|L00642.1|ATHUBCE Arabidopsis thaliana ubiquitin conjugating e... 72 1e-09
80gb|DQ222513.1| Solanum tuberosum clone 117E03 ubiquitin conjugat... 70 6e-09
81gb|AF532622.1| Glycine max ubiquitin-conjugation enzyme gene, co... 68 2e-08
82gb|AE017346.1| Cryptococcus neoformans var. neoformans JEC21 chr... 68 2e-08
83gb|BT013204.1| Lycopersicon esculentum clone 134378F, mRNA sequence 68 2e-08
84gb|AY109411.1| Zea mays CL25406_3 mRNA sequence 68 2e-08
85ref|NM_124997.2| Arabidopsis thaliana ubiquitin conjugating enzy... 66 9e-08
86ref|NM_180867.1| Arabidopsis thaliana ubiquitin conjugating enzy... 66 9e-08
87gb|AY489135.1| Capsicum annuum ubiquitin-conjugating enzyme 8 mR... 66 9e-08
88ref|XM_390981.1| Gibberella zeae PH-1 chromosome 3 UBC1_COLGL Ub... 66 9e-08
89gb|AC148404.7| Medicago truncatula clone mth2-28d4, complete seq... 66 9e-08
90gb|AY081511.1| Arabidopsis thaliana ubiquitin-conjugating enzyme... 66 9e-08
91gb|AY059806.1| Arabidopsis thaliana ubiquitin-conjugating enzyme... 66 9e-08
92emb|BX833149.1|CNS09Z3U Arabidopsis thaliana Full-length cDNA Co... 66 9e-08
93gb|AY084220.1| Arabidopsis thaliana clone 10022 mRNA, complete s... 66 9e-08
94gb|DQ027043.1| Arabidopsis thaliana ubiquitinating enzyme (At5g5... 66 9e-08
95gb|DQ249816.1| Capsicum annuum ubiquitin-conjugating enzyme E2 m... 66 9e-08
96dbj|AB011476.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 64 4e-07
97emb|X73419.1|LEUBC L.esculentum mRNA for ubiquitin conjugating e... 62 1e-06
98gb|AY389716.1| Hyacinthus orientalis ubiquitin-conjugating enzym... 60 6e-06
99gb|AF176040.1|AF176040 Mesembryanthemum crystallinum ubiquitin-c... 60 6e-06
100ref|NM_001036151.1| Arabidopsis thaliana ubiquitin conjugating e... 58 2e-05
101ref|NM_105097.3| Arabidopsis thaliana ubiquitin conjugating enzy... 58 2e-05
102gb|BT016331.1| Zea mays clone Contig164 mRNA sequence 58 2e-05
103gb|AY133670.1| Arabidopsis thaliana At1g64230/F22C12_17 mRNA, co... 58 2e-05
104gb|AF480945.1| Arabidopsis thaliana ubiquitin conjugating enzyme... 58 2e-05
105gb|AF385718.1|AF385718 Arabidopsis thaliana At1g64230/F22C12_17 ... 58 2e-05
106dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 58 2e-05
107emb|BX815683.1|CNS0ABHQ Arabidopsis thaliana Full-length cDNA Co... 58 2e-05
108emb|BX815644.1|CNS0ABEX Arabidopsis thaliana Full-length cDNA Co... 58 2e-05
109emb|BX816916.1|CNS0ABT7 Arabidopsis thaliana Full-length cDNA Co... 58 2e-05
110emb|BX816699.1|CNS0ABXP Arabidopsis thaliana Full-length cDNA Co... 58 2e-05
111gb|AY082008.1| Gossypium arboreum ubiquitin-conjugating enzyme E... 58 2e-05
112gb|AY082006.1| Gossypium hirsutum ubiquitin-conjugating enzyme E... 58 2e-05
113gb|AY082004.1| Gossypium hirsutum ubiquitin-conjugating enzyme E... 58 2e-05
114gb|AC007764.2|AC007764 Genomic sequence for Arabidopsis thaliana... 58 2e-05
115dbj|AP003618.3| Oryza sativa (japonica cultivar-group) genomic D... 58 2e-05
116dbj|AP004743.2| Oryza sativa (japonica cultivar-group) genomic D... 58 2e-05
117dbj|AK066232.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 2e-05
118gb|AY104017.1| Zea mays PCO119482 mRNA sequence 58 2e-05
119gb|DQ027041.1| Arabidopsis thaliana ubiquitinating enzyme (At1g6... 58 2e-05
120gb|AF034946.1|AF034946 Zea mays ubiquitin conjugating enzyme (UB... 58 2e-05
121gb|U15971.1|OSU15971 Oryza sativa ubiquitin conjugating enzyme (... 54 3e-04
122ref|XM_454516.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E12595g ... 52 0.001
123emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 52 0.001
124gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 52 0.001
125gb|AY082010.1| Gossypium raimondii ubiquitin-conjugating enzyme ... 52 0.001
126gb|AY082009.1| Gossypium thurberi ubiquitin-conjugating enzyme E... 52 0.001
127ref|NM_210385.1| Eremothecium gossypii AER173Cp (AER173C), mRNA 52 0.001
128gb|AY104144.1| Zea mays PCO100898 mRNA sequence 52 0.001
129gb|AF030296.1|AF030296 Glomerella cingulata ubiquitin conjugatin... 52 0.001
130gb|U17250.1|BCSC1 Brassica oleracea ubiquitine conjugating enzym... 52 0.001
131gb|AY220735.1| Hordeum vulgare ubiquitin-conjugating enzyme (UBC... 50 0.005
132gb|DQ350764.1| Ajellomyces capsulatus ubiquitin-conjugating enzy... 50 0.005
133gb|AY639585.1| Picea abies ubiquitin-conjugating enzyme UBC1 mRN... 50 0.005
134gb|AY952317.1| Triticum aestivum cultivar 7269-10 immature spike... 48 0.021
135gb|AY769917.1| Arachis hypogaea ubiquitin-conjugating enzyme (UB... 46 0.084
136ref|XM_752036.1| Ustilago maydis 521 ubiquitin-conjugating enzym... 46 0.084
137dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.084
138dbj|AP006156.2| Oryza sativa (japonica cultivar-group) genomic D... 46 0.084
139dbj|AK065902.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.084
140dbj|AK059627.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.084
141ref|XM_954840.1| Neurospora crassa OR74A hypothetical protein ( ... 44 0.33
142ref|XM_331064.1| Neurospora crassa OR74A hypothetical protein ( ... 44 0.33
143ref|XM_655273.1| Aspergillus nidulans FGSC A4 ubiquitin-conjugat... 44 0.33
144gb|AY491500.1| Capsicum annuum ubiquitin-conjugating enzyme E2 m... 44 0.33
145emb|CR733525.2|CNS0GSRO Tetraodon nigroviridis full-length cDNA 44 0.33
146emb|CR732722.2|CNS0GSBA Tetraodon nigroviridis full-length cDNA 44 0.33
147emb|CR731170.1|CNS0GR47 Tetraodon nigroviridis full-length cDNA 44 0.33
148emb|CR728345.2|CNS0GOXR Tetraodon nigroviridis full-length cDNA 44 0.33
149emb|CR724467.2|CNS0GLY1 Tetraodon nigroviridis full-length cDNA 44 0.33
150emb|CR708686.2|CNS0G9RU Tetraodon nigroviridis full-length cDNA 44 0.33
151emb|CR673935.2|CNS0FIZ9 Tetraodon nigroviridis full-length cDNA 44 0.33
152emb|CR661341.2|CNS0F99F Tetraodon nigroviridis full-length cDNA 44 0.33
153emb|CR651495.2|CNS0F1NX Tetraodon nigroviridis full-length cDNA 44 0.33
154emb|CR648302.2|CNS0EZ78 Tetraodon nigroviridis full-length cDNA 44 0.33
155emb|CR647212.2|CNS0EYCY Tetraodon nigroviridis full-length cDNA 44 0.33
156gb|AY082005.1| Gossypium hirsutum ubiquitin-conjugating enzyme E... 44 0.33
157gb|AY082007.1| Gossypium hirsutum ubiquitin-conjugating enzyme E... 44 0.33
158gb|AY105836.1| Zea mays PCO130472 mRNA sequence 44 0.33
159ref|NM_111704.1| Arabidopsis thaliana ubiquitin conjugating enzy... 42 1.3
160gb|BC040758.1| Mus musculus cDNA sequence BC040758, mRNA (cDNA c... 42 1.3
161gb|BC034067.1| Mus musculus cDNA sequence BC040758, mRNA (cDNA c... 42 1.3
162ref|XM_461820.1| Debaryomyces hansenii CBS767 hypothetical prote... 42 1.3
163emb|CR382139.1| Debaryomyces hansenii chromosome G of strain CBS... 42 1.3
164dbj|AK144400.1| Mus musculus adult male intestinal mucosa cDNA, ... 42 1.3
165gb|BT024821.1| Arabidopsis thaliana At3g08700 gene, complete cds 42 1.3
166gb|AC159745.5| Mus musculus 6 BAC RP23-394N3 (Roswell Park Cance... 42 1.3
167ref|NM_001033364.1| Mus musculus cDNA sequence BC040758 (BC04075... 42 1.3
168gb|U66493.1|MAU66493 Metarhizium anisopliae ubiquitin conjugatin... 42 1.3
169gb|DQ027026.1| Arabidopsis thaliana ubiquitinating enzyme (At3g0... 42 1.3
170gb|DQ294262.1| Solanum tuberosum clone 130D10 ubiquitin-conjugat... 42 1.3
171gb|AC153922.6| Mus musculus 6 BAC RP23-81P16 (Roswell Park Cance... 42 1.3
172ref|XM_662484.1| Cryptosporidium hominis TU502 ubiquitin-conjuga... 40 5.2
173emb|AL353900.14| Human DNA sequence from clone RP11-202C2 on chr... 40 5.2
174emb|X92663.1|DMUBCD2 D.melanogaster mRNA for ubiquitin-conjugati... 40 5.2
175dbj|AB226249.1| Aspergillus oryzae cDNA, contig sequence: AoEST3108 40 5.2
176dbj|AP007167.1| Aspergillus oryzae RIB40 genomic DNA, SC020 40 5.2
177ref|NM_164943.1| Drosophila melanogaster Ubiquitin conjugating e... 40 5.2
178gb|AY094899.1| Drosophila melanogaster RE74673 full insert cDNA 40 5.2
179ref|NM_057789.3| Drosophila melanogaster Ubiquitin conjugating e... 40 5.2
180dbj|AK146659.1| Mus musculus 16 days embryo kidney cDNA, RIKEN f... 40 5.2
181ref|XM_625662.1| Cryptosporidium parvum Iowa II ubiquitin-conjug... 40 5.2
182gb|AC007147.8|AC007147 Drosophila melanogaster, chromosome 2L, r... 40 5.2
183gb|AE003629.2| Drosophila melanogaster chromosome 2L, section 38... 40 5.2

>gb|AY736121.1| Triticum aestivum ubiquitin-conjugating enzyme mRNA, complete cds
          Length = 460

 Score =  281 bits (142), Expect = 8e-73
 Identities = 157/162 (96%)
 Strand = Plus / Minus

                                                                       
Query: 228 gctctagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccg 287
           ||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||
Sbjct: 460 gctctagcccatggcgtacttctgtgtccaggagcgcgccgtggactcgtacttggcccg 401

                                                                       
Query: 288 atcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgt 347
           ||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||
Sbjct: 400 atcagtcttgtacatgtgagcgatctcgggcaccagaggatcatcggggttcgggtccgt 341

                                                     
Query: 348 cagcaacgaacagattgacaggaggacctttgatatggtcaa 389
           ||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 340 cagcaacgaacagattgacagcaggacctttgatatggtcaa 299



to top

>dbj|AK119682.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-A01, full
           insert sequence
          Length = 832

 Score =  198 bits (100), Expect = 9e-48
 Identities = 145/160 (90%)
 Strand = Plus / Minus

                                                                       
Query: 227 ggctctagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggccc 286
           |||| ||||||||||||||||| |||||||||||||| || | ||| || ||||||||||
Sbjct: 606 ggctttagcccatggcgtacttctgtgtccaggagcgagcggtggattcatacttggccc 547

                                                                       
Query: 287 gatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccg 346
            ||||||||||||||||||||| ||||| |||||||| |||||||| |||||||||||||
Sbjct: 546 tatcagtcttgtacatgtgagcaatctccggcaccaacggatcatcggggttcgggtccg 487

                                                   
Query: 347 tcagcaacgaacagattgacaggaggacctttgatatggt 386
           ||||||  ||||| ||||||||||||||||||||||||||
Sbjct: 486 tcagcagtgaacaaattgacaggaggacctttgatatggt 447



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 33  gtcaggtagaacagactacc 52
           ||||||||||||||||||||
Sbjct: 783 gtcaggtagaacagactacc 764



to top

>ref|XM_474269.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 447

 Score =  196 bits (99), Expect = 4e-47
 Identities = 141/155 (90%)
 Strand = Plus / Minus

                                                                       
Query: 232 tagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatca 291
           ||||||||||||||||| |||||||||||||| || | ||| || |||||||||| ||||
Sbjct: 446 tagcccatggcgtacttctgtgtccaggagcgagcggtggattcatacttggccctatca 387

                                                                       
Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagc 351
           ||||||||||||||||| ||||| |||||||| |||||||| ||||||||||||||||||
Sbjct: 386 gtcttgtacatgtgagcaatctccggcaccaacggatcatcggggttcgggtccgtcagc 327

                                              
Query: 352 aacgaacagattgacaggaggacctttgatatggt 386
           |  ||||| ||||||||||||||||||||||||||
Sbjct: 326 agtgaacaaattgacaggaggacctttgatatggt 292



to top

>emb|AL606619.3|OSJN00032 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0043A12,
             complete sequence
          Length = 190432

 Score =  178 bits (90), Expect = 9e-42
 Identities = 135/150 (90%)
 Strand = Plus / Plus

                                                                         
Query: 227   ggctctagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggccc 286
             |||| ||||||||||||||||| |||||||||||||| || | ||| || ||||||||||
Sbjct: 33583 ggctttagcccatggcgtacttctgtgtccaggagcgagcggtggattcatacttggccc 33642

                                                                         
Query: 287   gatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccg 346
              ||||||||||||||||||||| ||||| |||||||| |||||||| |||||||||||||
Sbjct: 33643 tatcagtcttgtacatgtgagcaatctccggcaccaacggatcatcggggttcgggtccg 33702

                                           
Query: 347   tcagcaacgaacagattgacaggaggacct 376
             ||||||  ||||| ||||||||||||||||
Sbjct: 33703 tcagcagtgaacaaattgacaggaggacct 33732



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 33    gtcaggtagaacagactacc 52
             ||||||||||||||||||||
Sbjct: 33406 gtcaggtagaacagactacc 33425



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  178 bits (90), Expect = 9e-42
 Identities = 135/150 (90%)
 Strand = Plus / Plus

                                                                            
Query: 227      ggctctagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggccc 286
                |||| ||||||||||||||||| |||||||||||||| || | ||| || ||||||||||
Sbjct: 34122201 ggctttagcccatggcgtacttctgtgtccaggagcgagcggtggattcatacttggccc 34122260

                                                                            
Query: 287      gatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccg 346
                 ||||||||||||||||||||| ||||| |||||||| |||||||| |||||||||||||
Sbjct: 34122261 tatcagtcttgtacatgtgagcaatctccggcaccaacggatcatcggggttcgggtccg 34122320

                                              
Query: 347      tcagcaacgaacagattgacaggaggacct 376
                ||||||  ||||| ||||||||||||||||
Sbjct: 34122321 tcagcagtgaacaaattgacaggaggacct 34122350



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 33       gtcaggtagaacagactacc 52
                ||||||||||||||||||||
Sbjct: 34122024 gtcaggtagaacagactacc 34122043



to top

>dbj|AK104783.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-D03, full
           insert sequence
          Length = 1071

 Score =  178 bits (90), Expect = 9e-42
 Identities = 135/150 (90%)
 Strand = Plus / Minus

                                                                       
Query: 227 ggctctagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggccc 286
           |||| ||||||||||||||||| |||||||||||||| || | ||| || ||||||||||
Sbjct: 845 ggctttagcccatggcgtacttctgtgtccaggagcgagcggtggattcatacttggccc 786

                                                                       
Query: 287 gatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccg 346
            ||||||||||||||||||||| ||||| |||||||| |||||||| |||||||||||||
Sbjct: 785 tatcagtcttgtacatgtgagcaatctccggcaccaacggatcatcggggttcgggtccg 726

                                         
Query: 347 tcagcaacgaacagattgacaggaggacct 376
           ||||||  ||||| ||||||||||||||||
Sbjct: 725 tcagcagtgaacaaattgacaggaggacct 696



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gtcaggtagaacagactacc 52
            ||||||||||||||||||||
Sbjct: 1022 gtcaggtagaacagactacc 1003



to top

>dbj|AK060954.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-201-G05, full
           insert sequence
          Length = 1071

 Score =  178 bits (90), Expect = 9e-42
 Identities = 135/150 (90%)
 Strand = Plus / Minus

                                                                       
Query: 227 ggctctagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggccc 286
           |||| ||||||||||||||||| |||||||||||||| || | ||| || ||||||||||
Sbjct: 845 ggctttagcccatggcgtacttctgtgtccaggagcgagcggtggattcatacttggccc 786

                                                                       
Query: 287 gatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccg 346
            ||||||||||||||||||||| ||||| |||||||| |||||||| |||||||||||||
Sbjct: 785 tatcagtcttgtacatgtgagcaatctccggcaccaacggatcatcggggttcgggtccg 726

                                         
Query: 347 tcagcaacgaacagattgacaggaggacct 376
           ||||||  ||||| ||||||||||||||||
Sbjct: 725 tcagcagtgaacaaattgacaggaggacct 696



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 33   gtcaggtagaacagactacc 52
            ||||||||||||||||||||
Sbjct: 1022 gtcaggtagaacagactacc 1003



to top

>emb|AL732340.3| Oryza sativa genomic DNA, chromosome 4, BAC clone: B0811B10, complete
             sequence
          Length = 99356

 Score =  178 bits (90), Expect = 9e-42
 Identities = 135/150 (90%)
 Strand = Plus / Plus

                                                                         
Query: 227   ggctctagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggccc 286
             |||| ||||||||||||||||| |||||||||||||| || | ||| || ||||||||||
Sbjct: 39291 ggctttagcccatggcgtacttctgtgtccaggagcgagcggtggattcatacttggccc 39350

                                                                         
Query: 287   gatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccg 346
              ||||||||||||||||||||| ||||| |||||||| |||||||| |||||||||||||
Sbjct: 39351 tatcagtcttgtacatgtgagcaatctccggcaccaacggatcatcggggttcgggtccg 39410

                                           
Query: 347   tcagcaacgaacagattgacaggaggacct 376
             ||||||  ||||| ||||||||||||||||
Sbjct: 39411 tcagcagtgaacaaattgacaggaggacct 39440



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 33    gtcaggtagaacagactacc 52
             ||||||||||||||||||||
Sbjct: 39114 gtcaggtagaacagactacc 39133



to top

>gb|BT016295.1| Zea mays clone Contig128 mRNA sequence
          Length = 788

 Score =  141 bits (71), Expect = 2e-30
 Identities = 131/151 (86%)
 Strand = Plus / Minus

                                                                       
Query: 230 tctagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgat 289
           ||||||||||||| ||||| |||||||||||||| || | |||||| ||||||||||  |
Sbjct: 573 tctagcccatggcatacttctgtgtccaggagcgtgcggtggactcatacttggccctgt 514

                                                                       
Query: 290 cagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtca 349
           | ||||||||||||||||| ||||| || || | ||||||||||||||| |||||||| |
Sbjct: 513 cggtcttgtacatgtgagcaatctcagggacaagaggatcatcagggtttgggtccgtga 454

                                          
Query: 350 gcaacgaacagattgacaggaggacctttga 380
           |||  || |||||||||||||| ||||||||
Sbjct: 453 gcagtgagcagattgacaggagaacctttga 423



to top

>gb|AY109692.1| Zea mays CL301_1 mRNA sequence
          Length = 912

 Score =  141 bits (71), Expect = 2e-30
 Identities = 131/151 (86%)
 Strand = Plus / Minus

                                                                       
Query: 230 tctagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgat 289
           ||||||||||||| ||||| |||||||||||||| || | |||||| ||||||||||  |
Sbjct: 572 tctagcccatggcatacttctgtgtccaggagcgtgcggtggactcatacttggccctgt 513

                                                                       
Query: 290 cagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtca 349
           | ||||||||||||||||| ||||| || || | ||||||||||||||| |||||||| |
Sbjct: 512 cggtcttgtacatgtgagcaatctcagggacaagaggatcatcagggtttgggtccgtga 453

                                          
Query: 350 gcaacgaacagattgacaggaggacctttga 380
           |||  || |||||||||||||| ||||||||
Sbjct: 452 gcagtgagcagattgacaggagaacctttga 422



to top

>dbj|D17786.1|RICKN6922 Oryza sativa KN69 mRNA for ubiquitin-conjugating enzyme, partial
           CDS
          Length = 311

 Score =  131 bits (66), Expect = 2e-27
 Identities = 99/110 (90%)
 Strand = Plus / Minus

                                                                       
Query: 277 tacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcaggg 336
           |||||||||| ||||||||||||||||||||| ||||| |||||||| ||||||||   |
Sbjct: 296 tacttggccctatcagtcttgtacatgtgagcaatctccggcaccaacggatcatcgccg 237

                                                             
Query: 337 ttcgggtccgtcagcaacgaacagattgacaggaggacctttgatatggt 386
           ||||||||||||||||  ||||| |||||||| |||||||||||||||||
Sbjct: 236 ttcgggtccgtcagcagtgaacaaattgacagcaggacctttgatatggt 187



to top

>gb|AY083611.1| Oryza sativa elicitor and UV light related transcription factor
           (Elr) mRNA, complete cds
          Length = 576

 Score =  117 bits (59), Expect = 3e-23
 Identities = 100/111 (90%), Gaps = 2/111 (1%)
 Strand = Plus / Minus

                                                                       
Query: 277 tacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcaggg 336
           |||||||||| ||||||||||||||||| ||| ||||| |||||||| |||||||| |||
Sbjct: 524 tacttggccctatcagtcttgtacatgtaagcaatctccggcaccaacggatcatcgggg 465

                                                              
Query: 337 ttcgggtccgtcagcaacgaac-agattgacaggaggacctttgatatggt 386
           ||||||||||||||||  |||| | ||||||| ||||||||||||||||||
Sbjct: 464 ttcgggtccgtcagcagtgaacaaaattgaca-gaggacctttgatatggt 415



to top

>ref|XM_464900.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 728

 Score =  111 bits (56), Expect = 2e-21
 Identities = 104/120 (86%)
 Strand = Plus / Minus

                                                                       
Query: 270 ggactcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatc 329
           ||||||||||||||||||||||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 443 ggactcgtacttggcccgatcagtcttgtacatgtgagcaatctctggaaccaatggatc 384

                                                                       
Query: 330 atcagggttcgggtccgtcagcaacgaacagattgacaggaggacctttgatatggtcaa 389
           |||||| || || ||||||| || ||| || ||||| || || |||||||| || |||||
Sbjct: 383 atcaggatttggatccgtcaacagcgagcaaattgagagtagcacctttgaaatagtcaa 324



to top

>dbj|AK121248.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023101B08, full
           insert sequence
          Length = 729

 Score =  111 bits (56), Expect = 2e-21
 Identities = 104/120 (86%)
 Strand = Plus / Minus

                                                                       
Query: 270 ggactcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatc 329
           ||||||||||||||||||||||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 443 ggactcgtacttggcccgatcagtcttgtacatgtgagcaatctctggaaccaatggatc 384

                                                                       
Query: 330 atcagggttcgggtccgtcagcaacgaacagattgacaggaggacctttgatatggtcaa 389
           |||||| || || ||||||| || ||| || ||||| || || |||||||| || |||||
Sbjct: 383 atcaggatttggatccgtcaacagcgagcaaattgagagtagcacctttgaaatagtcaa 324



to top

>dbj|AB074412.1| Oryza sativa (japonica cultivar-group) mRNA for
           ubiquitin-conjugating enzyme OsUBC5b, complete cds
          Length = 574

 Score =  111 bits (56), Expect = 2e-21
 Identities = 104/120 (86%)
 Strand = Plus / Minus

                                                                       
Query: 270 ggactcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatc 329
           ||||||||||||||||||||||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 439 ggactcgtacttggcccgatcagtcttgtacatgtgagcaatctctggaaccaatggatc 380

                                                                       
Query: 330 atcagggttcgggtccgtcagcaacgaacagattgacaggaggacctttgatatggtcaa 389
           |||||| || || ||||||| || ||| || ||||| || || |||||||| || |||||
Sbjct: 379 atcaggatttggatccgtcaacagcgagcaaattgagagtagcacctttgaaatagtcaa 320



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score =  103 bits (52), Expect = 4e-19
 Identities = 73/80 (91%)
 Strand = Plus / Minus

                                                                           
Query: 270     ggactcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatc 329
               ||||||||||||||||||||||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 9118269 ggactcgtacttggcccgatcagtcttgtacatgtgagcaatctctggaaccaatggatc 9118210

                                   
Query: 330     atcagggttcgggtccgtca 349
               |||||| || || |||||||
Sbjct: 9118209 atcaggatttggatccgtca 9118190



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 73/83 (87%)
 Strand = Plus / Minus

                                                                           
Query: 286     cgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtcc 345
               |||||||||||| |||| ||||||||||| |||||||  ||||| || ||||||||||||
Sbjct: 1079316 cgatcagtcttgcacatatgagcgatctccggcaccagcggatcgtccgggttcgggtcc 1079257

                                      
Query: 346     gtcagcaacgaacagattgacag 368
               ||||||| ||| ||||| |||||
Sbjct: 1079256 gtcagcagcgagcagatcgacag 1079234



to top

>dbj|AP005777.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBb0026F09
          Length = 124371

 Score =  103 bits (52), Expect = 4e-19
 Identities = 73/80 (91%)
 Strand = Plus / Minus

                                                                         
Query: 270   ggactcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatc 329
             ||||||||||||||||||||||||||||||||||||||| ||||| || ||||| |||||
Sbjct: 21032 ggactcgtacttggcccgatcagtcttgtacatgtgagcaatctctggaaccaatggatc 20973

                                 
Query: 330   atcagggttcgggtccgtca 349
             |||||| || || |||||||
Sbjct: 20972 atcaggatttggatccgtca 20953



to top

>gb|DQ207855.1| Solanum tuberosum clone 078A09 ubiquitin-conjugating enzyme 8-like
           mRNA, complete cds
          Length = 757

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 80/90 (88%)
 Strand = Plus / Minus

                                                                       
Query: 288 atcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgt 347
           ||||||||||||||| ||||| |||||||||||||||||||||||||| || ||||||||
Sbjct: 453 atcagtcttgtacatatgagcaatctcgggcaccaaaggatcatcaggattagggtccgt 394

                                         
Query: 348 cagcaacgaacagattgacaggaggacctt 377
            ||||  || ||||||||||| || |||||
Sbjct: 393 tagcagagagcagattgacagcagcacctt 364



to top

>ref|NM_192451.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1125

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 84/96 (87%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332
           ||||||||||  || ||| |||||||||||||| |||||||| || |||| |||||||||
Sbjct: 858 ctcgtacttgtgcctatctgtcttgtacatgtgggcgatctcagggaccagaggatcatc 799

                                               
Query: 333 agggttcgggtccgtcagcaacgaacagattgacag 368
           ||||||||| || |||||||  ||||||||||||||
Sbjct: 798 agggttcggatcagtcagcagggaacagattgacag 763



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 84/96 (87%)
 Strand = Plus / Plus

                                                                            
Query: 273      ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332
                ||||||||||  || ||| |||||||||||||| |||||||| || |||| |||||||||
Sbjct: 26774618 ctcgtacttgtgcctatctgtcttgtacatgtgggcgatctcagggaccagaggatcatc 26774677

                                                    
Query: 333      agggttcgggtccgtcagcaacgaacagattgacag 368
                ||||||||| || |||||||  ||||||||||||||
Sbjct: 26774678 agggttcggatcagtcagcagggaacagattgacag 26774713



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                         
Query: 294      cttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcag 350
                ||||||| |||| ||||| || || |||| |||||||||||||||||| || |||||
Sbjct: 26766406 cttgtacgtgtgggcgatttcagggaccagaggatcatcagggttcggatcagtcag 26766462



to top

>dbj|AP003291.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0684E06
          Length = 147004

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 84/96 (87%)
 Strand = Plus / Plus

                                                                         
Query: 273   ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332
             ||||||||||  || ||| |||||||||||||| |||||||| || |||| |||||||||
Sbjct: 10267 ctcgtacttgtgcctatctgtcttgtacatgtgggcgatctcagggaccagaggatcatc 10326

                                                 
Query: 333   agggttcgggtccgtcagcaacgaacagattgacag 368
             ||||||||| || |||||||  ||||||||||||||
Sbjct: 10327 agggttcggatcagtcagcagggaacagattgacag 10362



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                     
Query: 294  cttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcag 350
            ||||||| |||| ||||| || || |||| |||||||||||||||||| || |||||
Sbjct: 2055 cttgtacgtgtgggcgatttcagggaccagaggatcatcagggttcggatcagtcag 2111



to top

>dbj|AP003294.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0694A04
          Length = 141476

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 84/96 (87%)
 Strand = Plus / Plus

                                                                          
Query: 273    ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332
              ||||||||||  || ||| |||||||||||||| |||||||| || |||| |||||||||
Sbjct: 121710 ctcgtacttgtgcctatctgtcttgtacatgtgggcgatctcagggaccagaggatcatc 121769

                                                  
Query: 333    agggttcgggtccgtcagcaacgaacagattgacag 368
              ||||||||| || |||||||  ||||||||||||||
Sbjct: 121770 agggttcggatcagtcagcagggaacagattgacag 121805



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                       
Query: 294    cttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcag 350
              ||||||| |||| ||||| || || |||| |||||||||||||||||| || |||||
Sbjct: 113498 cttgtacgtgtgggcgatttcagggaccagaggatcatcagggttcggatcagtcag 113554



to top

>dbj|AK099284.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023129D13, full
           insert sequence
          Length = 754

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 84/96 (87%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332
           ||||||||||  || ||| |||||||||||||| |||||||| || |||| |||||||||
Sbjct: 510 ctcgtacttgtgcctatctgtcttgtacatgtgggcgatctcagggaccagaggatcatc 451

                                               
Query: 333 agggttcgggtccgtcagcaacgaacagattgacag 368
           ||||||||| || |||||||  ||||||||||||||
Sbjct: 450 agggttcggatcagtcagcagggaacagattgacag 415



to top

>dbj|AK063826.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-122-A09, full
           insert sequence
          Length = 767

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 84/96 (87%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332
           ||||||||||  || ||| |||||||||||||| |||||||| || |||| |||||||||
Sbjct: 520 ctcgtacttgtgcctatctgtcttgtacatgtgggcgatctcagggaccagaggatcatc 461

                                               
Query: 333 agggttcgggtccgtcagcaacgaacagattgacag 368
           ||||||||| || |||||||  ||||||||||||||
Sbjct: 460 agggttcggatcagtcagcagggaacagattgacag 425



to top

>emb|AJ867286.1| Oryza sativa (indica cultivar-group) mRNA for ubiquitin conjugating
           enzyme E2 (ubc4 gene)
          Length = 444

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 84/96 (87%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332
           ||||||||||  || ||| |||||||||||||| |||||||| || |||| |||||||||
Sbjct: 405 ctcgtacttgtgcctatctgtcttgtacatgtgggcgatctcagggaccagaggatcatc 346

                                               
Query: 333 agggttcgggtccgtcagcaacgaacagattgacag 368
           ||||||||| || |||||||  ||||||||||||||
Sbjct: 345 agggttcggatcagtcagcagggaacagattgacag 310



to top

>dbj|AB074411.1| Oryza sativa (japonica cultivar-group) mRNA for
           ubiquitin-conjugating enzyme OsUBC5a, complete cds
          Length = 731

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 84/96 (87%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332
           ||||||||||  || ||| |||||||||||||| |||||||| || |||| |||||||||
Sbjct: 508 ctcgtacttgtgcctatctgtcttgtacatgtgggcgatctcagggaccagaggatcatc 449

                                               
Query: 333 agggttcgggtccgtcagcaacgaacagattgacag 368
           ||||||||| || |||||||  ||||||||||||||
Sbjct: 448 agggttcggatcagtcagcagggaacagattgacag 413



to top

>ref|XM_463908.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 815

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 87/101 (86%)
 Strand = Plus / Minus

                                                                       
Query: 286 cgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtcc 345
           |||||||||||| |||| ||||||||||| |||||||  ||||| || ||||||||||||
Sbjct: 479 cgatcagtcttgcacatatgagcgatctccggcaccagcggatcgtccgggttcgggtcc 420

                                                    
Query: 346 gtcagcaacgaacagattgacaggaggacctttgatatggt 386
           ||||||| ||| ||||| ||||| || ||||| || |||||
Sbjct: 419 gtcagcagcgagcagatcgacagaagaaccttggagatggt 379



to top

>dbj|AK120237.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013043N18, full
           insert sequence
          Length = 815

 Score = 89.7 bits (45), Expect = 6e-15
 Identities = 87/101 (86%)
 Strand = Plus / Minus

                                                                       
Query: 286 cgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtcc 345
           |||||||||||| |||| ||||||||||| |||||||  ||||| || ||||||||||||
Sbjct: 479 cgatcagtcttgcacatatgagcgatctccggcaccagcggatcgtccgggttcgggtcc 420

                                                    
Query: 346 gtcagcaacgaacagattgacaggaggacctttgatatggt 386
           ||||||| ||| ||||| ||||| || ||||| || |||||
Sbjct: 419 gtcagcagcgagcagatcgacagaagaaccttggagatggt 379



to top

>gb|BT017507.1| Zea mays clone EL01N0417C02.c mRNA sequence
          Length = 727

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 286 cgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtcc 345
           |||||||||||||||| |||||| ||||| || ||||| ||||| |||||||| ||||||
Sbjct: 495 cgatcagtcttgtacaagtgagcaatctctgggaccaacggatcgtcagggtttgggtcc 436

                                           
Query: 346 gtcagcaacgaacagattgacaggaggacctt 377
           ||||| |  ||||| ||||| |||||||||||
Sbjct: 435 gtcagaagggaacaaattgagaggaggacctt 404



to top

>gb|AF154650.1| Nicotiana tabacum clone PR35 mRNA sequence
          Length = 671

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagc 351
           ||||||||||| ||||| ||||| |||||||||||||||||||| || |||||||| |||
Sbjct: 413 gtcttgtacatatgagcaatctcaggcaccaaaggatcatcaggattagggtccgttagc 354

                                           
Query: 352 aacgaacagattgacaggaggacctttgatat 383
           |  |||||||| |||| ||| ||||| |||||
Sbjct: 353 agagaacagatagacatgagcaccttggatat 322



to top

>gb|AY106353.1| Zea mays PCO068301 mRNA sequence
          Length = 727

 Score = 87.7 bits (44), Expect = 2e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                       
Query: 286 cgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtcc 345
           |||||||||||||||| |||||| ||||| || ||||| ||||| |||||||| ||||||
Sbjct: 533 cgatcagtcttgtacaagtgagcaatctctgggaccaacggatcgtcagggtttgggtcc 474

                                           
Query: 346 gtcagcaacgaacagattgacaggaggacctt 377
           ||||| |  ||||| ||||| |||||||||||
Sbjct: 473 gtcagaagggaacaaattgagaggaggacctt 442



to top

>ref|NM_124709.2| Arabidopsis thaliana UBC10; ubiquitin conjugating enzyme/
           ubiquitin-like activating enzyme AT5G53300 (UBC10)
           transcript variant AT5G53300.2 mRNA, complete cds
          Length = 837

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 232 tagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatca 291
           ||||||||||| ||||| || ||||||   || || | |||||||||||||  |   |||
Sbjct: 548 tagcccatggcatacttctgagtccagcttcgtgcagtggactcgtacttgttcttgtca 489

                                                          
Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338
           ||||||||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 488 gtcttgtacatgtgagctatctcgggcaccaaaggatcatccgggtt 442



to top

>ref|NM_180850.1| Arabidopsis thaliana UBC10; ubiquitin conjugating enzyme/
           ubiquitin-like activating enzyme AT5G53300 (UBC10)
           transcript variant AT5G53300.1 mRNA, complete cds
          Length = 856

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 232 tagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatca 291
           ||||||||||| ||||| || ||||||   || || | |||||||||||||  |   |||
Sbjct: 567 tagcccatggcatacttctgagtccagcttcgtgcagtggactcgtacttgttcttgtca 508

                                                          
Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338
           ||||||||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 507 gtcttgtacatgtgagctatctcgggcaccaaaggatcatccgggtt 461



to top

>emb|Z14991.1|ATUBC10 A.thaliana UBC10 mRNA for ubiquitin conjugating enzyme homolog
          Length = 818

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 232 tagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatca 291
           ||||||||||| ||||| || ||||||   || || | |||||||||||||  |   |||
Sbjct: 578 tagcccatggcatacttctgagtccagcttcgtgcagtggactcgtacttgttcttgtca 519

                                                          
Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338
           ||||||||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 518 gtcttgtacatgtgagctatctcgggcaccaaaggatcatccgggtt 472



to top

>gb|AY113937.1| Arabidopsis thaliana putative E2, ubiquitin-conjugating enzyme
           UBC10 (At5g53300) mRNA, complete cds
          Length = 478

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 232 tagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatca 291
           ||||||||||| ||||| || ||||||   || || | |||||||||||||  |   |||
Sbjct: 446 tagcccatggcatacttctgagtccagcttcgtgcagtggactcgtacttgttcttgtca 387

                                                          
Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338
           ||||||||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 386 gtcttgtacatgtgagctatctcgggcaccaaaggatcatccgggtt 340



to top

>gb|AF326872.1| Arabidopsis thaliana putative E2, ubiquitin-conjugating enzyme
           UBC10 (At5g53300) mRNA, complete cds
          Length = 768

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 232 tagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatca 291
           ||||||||||| ||||| || ||||||   || || | |||||||||||||  |   |||
Sbjct: 540 tagcccatggcatacttctgagtccagcttcgtgcagtggactcgtacttgttcttgtca 481

                                                          
Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338
           ||||||||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 480 gtcttgtacatgtgagctatctcgggcaccaaaggatcatccgggtt 434



to top

>gb|AY129488.1| Arabidopsis thaliana AT5g53300/K19E1_10 mRNA, complete cds
          Length = 447

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 232 tagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatca 291
           ||||||||||| ||||| || ||||||   || || | |||||||||||||  |   |||
Sbjct: 446 tagcccatggcatacttctgagtccagcttcgtgcagtggactcgtacttgttcttgtca 387

                                                          
Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338
           ||||||||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 386 gtcttgtacatgtgagctatctcgggcaccaaaggatcatccgggtt 340



to top

>gb|AY065059.1| Arabidopsis thaliana AT5g53300/K19E1_10 mRNA, complete cds
          Length = 752

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 232 tagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatca 291
           ||||||||||| ||||| || ||||||   || || | |||||||||||||  |   |||
Sbjct: 540 tagcccatggcatacttctgagtccagcttcgtgcagtggactcgtacttgttcttgtca 481

                                                          
Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338
           ||||||||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 480 gtcttgtacatgtgagctatctcgggcaccaaaggatcatccgggtt 434



to top

>gb|AY039566.1| Arabidopsis thaliana AT5g53300/K19E1_10 mRNA, complete cds
          Length = 713

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 232 tagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatca 291
           ||||||||||| ||||| || ||||||   || || | |||||||||||||  |   |||
Sbjct: 544 tagcccatggcatacttctgagtccagcttcgtgcagtggactcgtacttgttcttgtca 485

                                                          
Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338
           ||||||||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 484 gtcttgtacatgtgagctatctcgggcaccaaaggatcatccgggtt 438



to top

>gb|AF325005.2|AF325005 Arabidopsis thaliana AT5g53300 (AT5g53300/K19E1_10) mRNA, complete
           cds
          Length = 731

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 232 tagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatca 291
           ||||||||||| ||||| || ||||||   || || | |||||||||||||  |   |||
Sbjct: 535 tagcccatggcatacttctgagtccagcttcgtgcagtggactcgtacttgttcttgtca 476

                                                          
Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338
           ||||||||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 475 gtcttgtacatgtgagctatctcgggcaccaaaggatcatccgggtt 429



to top

>gb|AF324718.2|AF324718 Arabidopsis thaliana AT5g53300 (AT5g53300/K19E1_10) mRNA, complete
           cds
          Length = 748

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 232 tagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatca 291
           ||||||||||| ||||| || ||||||   || || | |||||||||||||  |   |||
Sbjct: 536 tagcccatggcatacttctgagtccagcttcgtgcagtggactcgtacttgttcttgtca 477

                                                          
Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338
           ||||||||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 476 gtcttgtacatgtgagctatctcgggcaccaaaggatcatccgggtt 430



to top

>emb|BX833981.1|CNS0A0DI Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL88ZC07 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 769

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 232 tagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatca 291
           ||||||||||| ||||| || ||||||   || || | |||||||||||||  |   |||
Sbjct: 533 tagcccatggcatacttctgagtccagcttcgtgcagtggactcgtacttgttcttgtca 474

                                                          
Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338
           ||||||||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 473 gtcttgtacatgtgagctatctcgggcaccaaaggatcatccgggtt 427



to top

>gb|AY086109.1| Arabidopsis thaliana clone 21455 mRNA, complete sequence
          Length = 709

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 97/115 (84%)
 Strand = Plus / Minus

                                                                       
Query: 235 cccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcagtc 294
           ||||| ||||||||||||||||||   | ||| |  ||||||||||||| || ||| |||
Sbjct: 546 cccattgcgtacttttgtgtccagcttctcgcagttgactcgtacttggacctatctgtc 487

                                                                  
Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtca 349
           |||||||||||||| ||||| ||||| | ||||||||| ||||| ||||| ||||
Sbjct: 486 ttgtacatgtgagctatctccggcacaagaggatcatctgggtttgggtcagtca 432



to top

>dbj|AP004078.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1020_C02
          Length = 124578

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 73/83 (87%)
 Strand = Plus / Minus

                                                                         
Query: 286   cgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtcc 345
             |||||||||||| |||| ||||||||||| |||||||  ||||| || ||||||||||||
Sbjct: 31840 cgatcagtcttgcacatatgagcgatctccggcaccagcggatcgtccgggttcgggtcc 31781

                                    
Query: 346   gtcagcaacgaacagattgacag 368
             ||||||| ||| ||||| |||||
Sbjct: 31780 gtcagcagcgagcagatcgacag 31758



to top

>dbj|AP005851.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBb0088N06
          Length = 123454

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 73/83 (87%)
 Strand = Plus / Minus

                                                                         
Query: 286   cgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtcc 345
             |||||||||||| |||| ||||||||||| |||||||  ||||| || ||||||||||||
Sbjct: 68024 cgatcagtcttgcacatatgagcgatctccggcaccagcggatcgtccgggttcgggtcc 67965

                                    
Query: 346   gtcagcaacgaacagattgacag 368
             ||||||| ||| ||||| |||||
Sbjct: 67964 gtcagcagcgagcagatcgacag 67942



to top

>dbj|AB013388.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K19E1
          Length = 73428

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 91/107 (85%)
 Strand = Plus / Plus

                                                                         
Query: 232   tagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatca 291
             ||||||||||| ||||| || ||||||   || || | |||||||||||||  |   |||
Sbjct: 46992 tagcccatggcatacttctgagtccagcttcgtgcagtggactcgtacttgttcttgtca 47051

                                                            
Query: 292   gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338
             ||||||||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 47052 gtcttgtacatgtgagctatctcgggcaccaaaggatcatccgggtt 47098



to top

>gb|DQ027024.1| Arabidopsis thaliana ubiquitinating enzyme (At5g53300) mRNA,
           complete cds
          Length = 447

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 232 tagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatca 291
           ||||||||||| ||||| || ||||||   || || | |||||||||||||  |   |||
Sbjct: 446 tagcccatggcatacttctgagtccagcttcgtgcagtggactcgtacttgttcttgtca 387

                                                          
Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338
           ||||||||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 386 gtcttgtacatgtgagctatctcgggcaccaaaggatcatccgggtt 340



to top

>gb|L00640.1|ATHUBCC Arabidopsis thaliana ubiquitin conjugating enzyme mRNA, complete
           cds
          Length = 818

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 232 tagcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatca 291
           ||||||||||| ||||| || ||||||   || || | |||||||||||||  |   |||
Sbjct: 578 tagcccatggcatacttctgagtccagcttcgtgcagtggactcgtacttgttcttgtca 519

                                                          
Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338
           ||||||||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 518 gtcttgtacatgtgagctatctcgggcaccaaaggatcatccgggtt 472



to top

>ref|NM_179131.1| Arabidopsis thaliana UBC9 (UBIQUITIN CONJUGATING ENZYME 9);
           ubiquitin conjugating enzyme/ ubiquitin-like activating
           enzyme AT4G27960 (UBC9) transcript variant AT4G27960.1
           mRNA, complete cds
          Length = 686

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 108/130 (83%)
 Strand = Plus / Minus

                                                                       
Query: 233 agcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcag 292
           |||||||||| |||||||| |||||||  || || | |||||||||||||  |   || |
Sbjct: 524 agcccatggcatacttttgggtccaggtccgagcagtggactcgtacttgttcttgtctg 465

                                                                       
Query: 293 tcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352
           |||||||||||||||| ||||| || |||||||||||||| ||||| || ||||| | ||
Sbjct: 464 tcttgtacatgtgagctatctcagggaccaaaggatcatctgggtttggatccgttaaca 405

                     
Query: 353 acgaacagat 362
           | ||||||||
Sbjct: 404 aagaacagat 395



to top

>ref|NM_118934.1| Arabidopsis thaliana UBC9 (UBIQUITIN CONJUGATING ENZYME 9);
           ubiquitin conjugating enzyme/ ubiquitin-like activating
           enzyme AT4G27960 (UBC9) transcript variant AT4G27960.2
           mRNA, complete cds
          Length = 896

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 108/130 (83%)
 Strand = Plus / Minus

                                                                       
Query: 233 agcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcag 292
           |||||||||| |||||||| |||||||  || || | |||||||||||||  |   || |
Sbjct: 662 agcccatggcatacttttgggtccaggtccgagcagtggactcgtacttgttcttgtctg 603

                                                                       
Query: 293 tcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352
           |||||||||||||||| ||||| || |||||||||||||| ||||| || ||||| | ||
Sbjct: 602 tcttgtacatgtgagctatctcagggaccaaaggatcatctgggtttggatccgttaaca 543

                     
Query: 353 acgaacagat 362
           | ||||||||
Sbjct: 542 aagaacagat 533



to top

>gb|AY142644.1| Arabidopsis thaliana E2 ubiquitin-conjugating enzyme 9 (UBC9)
           (At4g27960) mRNA, complete cds
          Length = 478

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 108/130 (83%)
 Strand = Plus / Minus

                                                                       
Query: 233 agcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcag 292
           |||||||||| |||||||| |||||||  || || | |||||||||||||  |   || |
Sbjct: 445 agcccatggcatacttttgggtccaggtccgagcagtggactcgtacttgttcttgtctg 386

                                                                       
Query: 293 tcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352
           |||||||||||||||| ||||| || |||||||||||||| ||||| || ||||| | ||
Sbjct: 385 tcttgtacatgtgagctatctcagggaccaaaggatcatctgggtttggatccgttaaca 326

                     
Query: 353 acgaacagat 362
           | ||||||||
Sbjct: 325 aagaacagat 316



to top

>emb|Z14990.1|ATUBC9 A.thaliana UBC9 mRNA for ubiquitin conjugating enzyme homolog
          Length = 687

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 108/130 (83%)
 Strand = Plus / Minus

                                                                       
Query: 233 agcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcag 292
           |||||||||| |||||||| |||||||  || || | |||||||||||||  |   || |
Sbjct: 495 agcccatggcatacttttgggtccaggtccgagcagtggactcgtacttgttcttgtctg 436

                                                                       
Query: 293 tcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352
           |||||||||||||||| ||||| || |||||||||||||| ||||| || ||||| | ||
Sbjct: 435 tcttgtacatgtgagctatctcagggaccaaaggatcatctgggtttggatccgttaaca 376

                     
Query: 353 acgaacagat 362
           | ||||||||
Sbjct: 375 aagaacagat 366



to top

>gb|AY080741.1| Arabidopsis thaliana putative E2, ubiquitin-conjugating enzyme UBC9
           (At4g27960) mRNA, complete cds
          Length = 688

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 108/130 (83%)
 Strand = Plus / Minus

                                                                       
Query: 233 agcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcag 292
           |||||||||| |||||||| |||||||  || || | |||||||||||||  |   || |
Sbjct: 521 agcccatggcatacttttgggtccaggtccgagcagtggactcgtacttgttcttgtctg 462

                                                                       
Query: 293 tcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352
           |||||||||||||||| ||||| || |||||||||||||| ||||| || ||||| | ||
Sbjct: 461 tcttgtacatgtgagctatctcagggaccaaaggatcatctgggtttggatccgttaaca 402

                     
Query: 353 acgaacagat 362
           | ||||||||
Sbjct: 401 aagaacagat 392



to top

>emb|X72626.1|ATUCEE2B A.thaliana UbcAT4b mRNA for ubiquitin conjugating enzyme E2
          Length = 643

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 108/130 (83%)
 Strand = Plus / Minus

                                                                       
Query: 233 agcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcag 292
           |||||||||| |||||||| |||||||  || || | |||||||||||||  |   || |
Sbjct: 479 agcccatggcatacttttgggtccaggtccgagcagtggactcgtacttgttcttgtctg 420

                                                                       
Query: 293 tcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352
           |||||||||||||||| ||||| || |||||||||||||| ||||| || ||||| | ||
Sbjct: 419 tcttgtacatgtgagctatctcagggaccaaaggatcatctgggtttggatccgttaaca 360

                     
Query: 353 acgaacagat 362
           | ||||||||
Sbjct: 359 aagaacagat 350



to top

>emb|AL161572.2|ATCHRIV68 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 68
          Length = 199749

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 108/130 (83%)
 Strand = Plus / Plus

                                                                         
Query: 233   agcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcag 292
             |||||||||| |||||||| |||||||  || || | |||||||||||||  |   || |
Sbjct: 31550 agcccatggcatacttttgggtccaggtccgagcagtggactcgtacttgttcttgtctg 31609

                                                                         
Query: 293   tcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352
             |||||||||||||||| ||||| || |||||||||||||| ||||| || ||||| | ||
Sbjct: 31610 tcttgtacatgtgagctatctcagggaccaaaggatcatctgggtttggatccgttaaca 31669

                       
Query: 353   acgaacagat 362
             | ||||||||
Sbjct: 31670 aagaacagat 31679



to top

>emb|AL035524.1|ATT13J8 Arabidopsis thaliana DNA chromosome 4, BAC clone T13J8 (ESSAII project)
          Length = 83693

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 108/130 (83%)
 Strand = Plus / Plus

                                                                         
Query: 233   agcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcag 292
             |||||||||| |||||||| |||||||  || || | |||||||||||||  |   || |
Sbjct: 26414 agcccatggcatacttttgggtccaggtccgagcagtggactcgtacttgttcttgtctg 26473

                                                                         
Query: 293   tcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352
             |||||||||||||||| ||||| || |||||||||||||| ||||| || ||||| | ||
Sbjct: 26474 tcttgtacatgtgagctatctcagggaccaaaggatcatctgggtttggatccgttaaca 26533

                       
Query: 353   acgaacagat 362
             | ||||||||
Sbjct: 26534 aagaacagat 26543



to top

>gb|AF325019.2|AF325019 Arabidopsis thaliana AT4g27960 (AT4g27960/T13J8_70) mRNA, complete
           cds
          Length = 896

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 108/130 (83%)
 Strand = Plus / Minus

                                                                       
Query: 233 agcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcag 292
           |||||||||| |||||||| |||||||  || || | |||||||||||||  |   || |
Sbjct: 662 agcccatggcatacttttgggtccaggtccgagcagtggactcgtacttgttcttgtctg 603

                                                                       
Query: 293 tcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352
           |||||||||||||||| ||||| || |||||||||||||| ||||| || ||||| | ||
Sbjct: 602 tcttgtacatgtgagctatctcagggaccaaaggatcatctgggtttggatccgttaaca 543

                     
Query: 353 acgaacagat 362
           | ||||||||
Sbjct: 542 aagaacagat 533



to top

>gb|AY086447.1| Arabidopsis thaliana clone 25162 mRNA, complete sequence
          Length = 743

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 48/50 (96%)
 Strand = Plus / Minus

                                                             
Query: 289 tcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338
           |||||||||||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 487 tcagtcttgtacatgtgagctatctcgggcaccaaaggatcatccgggtt 438



to top

>gb|DQ027023.1| Arabidopsis thaliana ubiquitinating enzyme (At4g27960) mRNA,
           complete cds
          Length = 537

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 108/130 (83%)
 Strand = Plus / Minus

                                                                       
Query: 233 agcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcag 292
           |||||||||| |||||||| |||||||  || || | |||||||||||||  |   || |
Sbjct: 535 agcccatggcatacttttgggtccaggtccgagcagtggactcgtacttgttcttgtctg 476

                                                                       
Query: 293 tcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352
           |||||||||||||||| ||||| || |||||||||||||| ||||| || ||||| | ||
Sbjct: 475 tcttgtacatgtgagctatctcagggaccaaaggatcatctgggtttggatccgttaaca 416

                     
Query: 353 acgaacagat 362
           | ||||||||
Sbjct: 415 aagaacagat 406



to top

>gb|L00639.1|ATHUBCB Arabidopsis thaliana ubiquitin conjugating enzyme mRNA, complete
           cds
          Length = 658

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 108/130 (83%)
 Strand = Plus / Minus

                                                                       
Query: 233 agcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcag 292
           |||||||||| |||||||| |||||||  || || | |||||||||||||  |   || |
Sbjct: 495 agcccatggcatacttttgggtccaggtccgagcagtggactcgtacttgttcttgtctg 436

                                                                       
Query: 293 tcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352
           |||||||||||||||| ||||| || |||||||||||||| ||||| || ||||| | ||
Sbjct: 435 tcttgtacatgtgagctatctcagggaccaaaggatcatctgggtttggatccgttaaca 376

                     
Query: 353 acgaacagat 362
           | ||||||||
Sbjct: 375 aagaacagat 366



to top

>dbj|AP004929.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT06J16, TM0083,
              complete sequence
          Length = 120016

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 68/77 (88%)
 Strand = Plus / Minus

                                                                          
Query: 277    tacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcaggg 336
              |||||||||| ||||||||||||||| ||||| ||||| ||||||| |||||| || |||
Sbjct: 112098 tacttggccctatcagtcttgtacatatgagcaatctcaggcaccagaggatcctctggg 112039

                               
Query: 337    ttcgggtccgtcagcaa 353
              || ||||| ||||||||
Sbjct: 112038 ttggggtctgtcagcaa 112022



to top

>gb|AY083170.1| Malus x domestica ubiquitin conjugating-like enzyme mRNA, partial
           cds
          Length = 174

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatca 333
           ||||||||||| |||||||| ||||||||||| |||||||| ||||| | ||| ||||||
Sbjct: 88  tcgtacttggctcgatcagttttgtacatgtgggcgatctccggcacgagagggtcatca 29

                               
Query: 334 gggttcgggtccgtcagcaa 353
           || || ||||| ||||||||
Sbjct: 28  ggatttgggtcagtcagcaa 9



to top

>emb|BX829864.1|CNS0A1IT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB41ZF02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 708

 Score = 79.8 bits (40), Expect = 6e-12
 Identities = 46/48 (95%)
 Strand = Plus / Minus

                                                           
Query: 291 agtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338
           |||||||||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 462 agtcttgtacatgtgagctatctcgggcaccaaaggatcatccgggtt 415



to top

>ref|NM_111703.2| Arabidopsis thaliana ubiquitin conjugating enzyme/ ubiquitin-like
           activating enzyme AT3G08690 mRNA, complete cds
          Length = 724

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 96/115 (83%)
 Strand = Plus / Minus

                                                                       
Query: 235 cccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcagtc 294
           ||||| ||||||||||||||||||   | ||| |  |||||||||||||  | ||| |||
Sbjct: 546 cccattgcgtacttttgtgtccagcttctcgcagttgactcgtacttggatctatctgtc 487

                                                                  
Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtca 349
           |||||||||||||| ||||| ||||| | ||||||||| ||||| ||||| ||||
Sbjct: 486 ttgtacatgtgagctatctccggcacaagaggatcatctgggtttgggtcagtca 432



to top

>emb|Z14992.1|ATUBC11 A.thaliana UBC11 mRNA for ubiquitin conjugating enzyme homolog
          Length = 543

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 96/115 (83%)
 Strand = Plus / Minus

                                                                       
Query: 235 cccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcagtc 294
           ||||| ||||||||||||||||||   | ||| |  |||||||||||||  | ||| |||
Sbjct: 353 cccattgcgtacttttgtgtccagcttctcgcagttgactcgtacttggatctatctgtc 294

                                                                  
Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtca 349
           |||||||||||||| ||||| ||||| | ||||||||| ||||| ||||| ||||
Sbjct: 293 ttgtacatgtgagctatctccggcacaagaggatcatctgggtttgggtcagtca 239



to top

>gb|AY091223.1| Arabidopsis thaliana putative ubiquitin conjugating enzyme 11
           (UBC11) (At3g08690) mRNA, complete cds
          Length = 478

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 96/115 (83%)
 Strand = Plus / Minus

                                                                       
Query: 235 cccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcagtc 294
           ||||| ||||||||||||||||||   | ||| |  |||||||||||||  | ||| |||
Sbjct: 443 cccattgcgtacttttgtgtccagcttctcgcagttgactcgtacttggatctatctgtc 384

                                                                  
Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtca 349
           |||||||||||||| ||||| ||||| | ||||||||| ||||| ||||| ||||
Sbjct: 383 ttgtacatgtgagctatctccggcacaagaggatcatctgggtttgggtcagtca 329



to top

>gb|AY063869.1| Arabidopsis thaliana putative E2, ubiquitin-conjugating enzyme
           UBC11 (At3g08690) mRNA, complete cds
          Length = 733

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 96/115 (83%)
 Strand = Plus / Minus

                                                                       
Query: 235 cccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcagtc 294
           ||||| ||||||||||||||||||   | ||| |  |||||||||||||  | ||| |||
Sbjct: 539 cccattgcgtacttttgtgtccagcttctcgcagttgactcgtacttggatctatctgtc 480

                                                                  
Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtca 349
           |||||||||||||| ||||| ||||| | ||||||||| ||||| ||||| ||||
Sbjct: 479 ttgtacatgtgagctatctccggcacaagaggatcatctgggtttgggtcagtca 425



to top

>gb|AC012562.5|AC012562 Arabidopsis thaliana chromosome 3 BAC F17O14 genomic sequence, complete
             sequence
          Length = 90721

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 96/115 (83%)
 Strand = Plus / Minus

                                                                         
Query: 235   cccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcagtc 294
             ||||| ||||||||||||||||||   | ||| |  |||||||||||||  | ||| |||
Sbjct: 53408 cccattgcgtacttttgtgtccagcttctcgcagttgactcgtacttggatctatctgtc 53349

                                                                    
Query: 295   ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtca 349
             |||||||||||||| ||||| ||||| | ||||||||| ||||| ||||| ||||
Sbjct: 53348 ttgtacatgtgagctatctccggcacaagaggatcatctgggtttgggtcagtca 53294



 Score = 42.1 bits (21), Expect = 1.3
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                              
Query: 304   tgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352
             ||||| ||||| ||||| | ||||||||  ||||||||||| |||||||
Sbjct: 55395 tgagctatctccggcacaagaggatcatttgggttcgggtcagtcagca 55347



to top

>gb|DQ027025.1| Arabidopsis thaliana ubiquitinating enzyme (At3g08690) mRNA,
           complete cds
          Length = 447

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 96/115 (83%)
 Strand = Plus / Minus

                                                                       
Query: 235 cccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcagtc 294
           ||||| ||||||||||||||||||   | ||| |  |||||||||||||  | ||| |||
Sbjct: 443 cccattgcgtacttttgtgtccagcttctcgcagttgactcgtacttggatctatctgtc 384

                                                                  
Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtca 349
           |||||||||||||| ||||| ||||| | ||||||||| ||||| ||||| ||||
Sbjct: 383 ttgtacatgtgagctatctccggcacaagaggatcatctgggtttgggtcagtca 329



to top

>gb|L00641.1|ATHUBCD Arabidopsis thaliana ubiquitin conjugating enzyme mRNA, 3' end
          Length = 543

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 96/115 (83%)
 Strand = Plus / Minus

                                                                       
Query: 235 cccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcagtc 294
           ||||| ||||||||||||||||||   | ||| |  |||||||||||||  | ||| |||
Sbjct: 353 cccattgcgtacttttgtgtccagcttctcgcagttgactcgtacttggatctatctgtc 294

                                                                  
Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtca 349
           |||||||||||||| ||||| ||||| | ||||||||| ||||| ||||| ||||
Sbjct: 293 ttgtacatgtgagctatctccggcacaagaggatcatctgggtttgggtcagtca 239



to top

>gb|AY486137.1| Capsicum annuum ubiquitin-conjugating protein mRNA, complete cds
          Length = 578

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 95/114 (83%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332
           |||||| |||||||  |||||||||||||||||||| || || || || |  ||||||||
Sbjct: 337 ctcgtatttggccctgtcagtcttgtacatgtgagcaatttctggtacgagcggatcatc 278

                                                                 
Query: 333 agggttcgggtccgtcagcaacgaacagattgacaggaggacctttgatatggt 386
            ||||| |||||||||| ||  || ||||| ||||| |||||||| ||||||||
Sbjct: 277 ggggtttgggtccgtcaacagagagcagatggacagcaggaccttcgatatggt 224



to top

>gb|BT013767.1| Lycopersicon esculentum clone 132651R, mRNA sequence
          Length = 844

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 94/113 (83%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatca 333
           ||||| |||||||  |||||||||||||||||||| || || || || | ||||||||| 
Sbjct: 566 tcgtatttggccctgtcagtcttgtacatgtgagcaatttcaggtacaagaggatcatct 507

                                                                
Query: 334 gggttcgggtccgtcagcaacgaacagattgacaggaggacctttgatatggt 386
           ||||| ||||| |||| ||  || ||||| ||||| |||||||| ||||||||
Sbjct: 506 gggtttgggtctgtcaacagagagcagatggacagcaggaccttggatatggt 454



to top

>ref|XM_445894.1| Candida glabrata CBS138, CAGL0E04752g partial mRNA
          Length = 444

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 88/105 (83%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332
           ||||||||| || | |||||||||||| ||||| |||||||| || ||||||||||| ||
Sbjct: 405 ctcgtacttagctctatcagtcttgtagatgtgggcgatctctggaaccaaaggatcgtc 346

                                                        
Query: 333 agggttcgggtccgtcagcaacgaacagattgacaggaggacctt 377
            ||||| | ||| |||||||| || ||||| || || ||||||||
Sbjct: 345 tgggttggcgtctgtcagcaaggagcagatggaaagcaggacctt 301



to top

>emb|CR380951.1| Candida glabrata strain CBS138 chromosome E complete sequence
          Length = 687501

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 88/105 (83%)
 Strand = Plus / Plus

                                                                          
Query: 273    ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332
              ||||||||| || | |||||||||||| ||||| |||||||| || ||||||||||| ||
Sbjct: 456004 ctcgtacttagctctatcagtcttgtagatgtgggcgatctctggaaccaaaggatcgtc 456063

                                                           
Query: 333    agggttcgggtccgtcagcaacgaacagattgacaggaggacctt 377
               ||||| | ||| |||||||| || ||||| || || ||||||||
Sbjct: 456064 tgggttggcgtctgtcagcaaggagcagatggaaagcaggacctt 456108



to top

>gb|DQ284472.1| Solanum tuberosum clone 116D11 ubiquitin-conjugating protein-like
           mRNA, complete cds
          Length = 531

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 94/113 (83%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatca 333
           ||||| |||||||  |||||||||||||||||||| || || || || | ||||||||| 
Sbjct: 326 tcgtatttggccctgtcagtcttgtacatgtgagcaatttcaggtacaagaggatcatct 267

                                                                
Query: 334 gggttcgggtccgtcagcaacgaacagattgacaggaggacctttgatatggt 386
           ||||| ||||| |||| ||  || ||||| ||||| |||||||| ||||||||
Sbjct: 266 gggtttgggtctgtcaacagagagcagatggacagcaggaccttggatatggt 214



to top

>gb|L23762.1|TOM1KUC Lycopersicon esculentum ubiquitin carrier protein (Ubc) mRNA,
           complete cds
          Length = 825

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 94/113 (83%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatca 333
           ||||| |||||||  |||||||||||||||||||| || || || || | ||||||||| 
Sbjct: 570 tcgtatttggccctgtcagtcttgtacatgtgagcaatttcaggtacaagaggatcatct 511

                                                                
Query: 334 gggttcgggtccgtcagcaacgaacagattgacaggaggacctttgatatggt 386
           ||||| ||||| |||| ||  || ||||| ||||| |||||||| ||||||||
Sbjct: 510 gggtttgggtctgtcaacagagagcagatggacagcaggaccttggatatggt 458



to top

>ref|XM_571364.1| Cryptococcus neoformans var. neoformans JEC21 ubiquitin-conjugating
           enzyme e2-16 kda (CNF02760) partial mRNA
          Length = 655

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 310 atctcgggcaccaaaggatcatcagggttcgggtccgtcagcaacgaacagattgacagg 369
           |||||||||||||||||||| |||||||| |||||||||| ||  |||||||| ||||  
Sbjct: 429 atctcgggcaccaaaggatcgtcagggttagggtccgtcaacatggaacagatggacaac 370

                               
Query: 370 aggacctttgatatggtcaa 389
           | |||||| || ||||||||
Sbjct: 369 aagaccttcgaaatggtcaa 350



to top

>emb|Z14993.1|ATUBC12 A.thaliana UBC12 gene
          Length = 1010

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 105/128 (82%)
 Strand = Plus / Minus

                                                                        
Query: 235  cccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcagtc 294
            |||||||| || ||||| |||||||  || || | |||||||||||||  |   || |||
Sbjct: 1010 cccatggcatatttttgggtccaggtccgagcagtggactcgtacttgttcttgtctgtc 951

                                                                        
Query: 295  ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagcaac 354
            |||||||||||||| ||||| || |||||||||||||| ||||| || ||||| | ||| 
Sbjct: 950  ttgtacatgtgagctatctcagggaccaaaggatcatctgggtttggatccgttaacaaa 891

                    
Query: 355  gaacagat 362
            ||||||||
Sbjct: 890  gaacagat 883



to top

>gb|L00642.1|ATHUBCE Arabidopsis thaliana ubiquitin conjugating enzyme gene, exons 1-4
          Length = 1010

 Score = 71.9 bits (36), Expect = 1e-09
 Identities = 105/128 (82%)
 Strand = Plus / Minus

                                                                        
Query: 235  cccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcagtc 294
            |||||||| || ||||| |||||||  || || | |||||||||||||  |   || |||
Sbjct: 1010 cccatggcatatttttgggtccaggtccgagcagtggactcgtacttgttcttgtctgtc 951

                                                                        
Query: 295  ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagcaac 354
            |||||||||||||| ||||| || |||||||||||||| ||||| || ||||| | ||| 
Sbjct: 950  ttgtacatgtgagctatctcagggaccaaaggatcatctgggtttggatccgttaacaaa 891

                    
Query: 355  gaacagat 362
            ||||||||
Sbjct: 890  gaacagat 883



to top

>gb|DQ222513.1| Solanum tuberosum clone 117E03 ubiquitin conjugating enzyme E2-like
           mRNA, complete cds
          Length = 835

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 65/75 (86%)
 Strand = Plus / Minus

                                                                       
Query: 288 atcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgt 347
           |||||| |||||||| ||||| ||||| ||||||||||| |||||||| || ||||| ||
Sbjct: 435 atcagttttgtacatatgagcaatctccggcaccaaagggtcatcaggattagggtctgt 376

                          
Query: 348 cagcaacgaacagat 362
           |||||  ||||||||
Sbjct: 375 cagcagagaacagat 361



to top

>gb|AF532622.1| Glycine max ubiquitin-conjugation enzyme gene, complete cds
          Length = 929

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 106/130 (81%)
 Strand = Plus / Minus

                                                                       
Query: 233 agcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcag 292
           |||||||||| ||||| || ||||||  ||| || | || ||| ||||||||||| ||||
Sbjct: 628 agcccatggcatacttctgggtccagctgcgtgcagtggcctcatacttggcccggtcag 569

                                                                       
Query: 293 tcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352
           | ||||||||||||||||| || || || |  ||||||||||| || || || |||||||
Sbjct: 568 ttttgtacatgtgagcgatttccggaacaagtggatcatcaggatttggatcagtcagca 509

                     
Query: 353 acgaacagat 362
           | || |||||
Sbjct: 508 atgagcagat 499



to top

>gb|AE017346.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 6, complete
              sequence
          Length = 1438950

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                        
Query: 310    atctcgggcaccaaaggatcatcagggttcgggtccgtcagcaacgaacagattgaca 367
              |||||||||||||||||||| |||||||| |||||||||| ||  |||||||| ||||
Sbjct: 790689 atctcgggcaccaaaggatcgtcagggttagggtccgtcaacatggaacagatggaca 790632



to top

>gb|BT013204.1| Lycopersicon esculentum clone 134378F, mRNA sequence
          Length = 774

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtca 349
           ||||||||||| ||||| ||||| ||||||||||||||||| ||||| || |||||||
Sbjct: 430 gtcttgtacatatgagcaatctcaggcaccaaaggatcatcggggtttggatccgtca 373



to top

>gb|AY109411.1| Zea mays CL25406_3 mRNA sequence
          Length = 1037

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 94/114 (82%)
 Strand = Plus / Plus

                                                                       
Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332
           ||||||||||  ||| || |||||||||||||| || |||||||| |||| |||||| ||
Sbjct: 128 ctcgtacttgttccggtccgtcttgtacatgtgcgctatctcggggaccagaggatcgtc 187

                                                                 
Query: 333 agggttcgggtccgtcagcaacgaacagattgacaggaggacctttgatatggt 386
            |||||||| || |||||||  || ||||| ||||| || ||||| || |||||
Sbjct: 188 ggggttcggatcggtcagcagggagcagatggacagcagcaccttggagatggt 241



to top

>ref|NM_124997.2| Arabidopsis thaliana ubiquitin conjugating enzyme/ ubiquitin-like
           activating enzyme AT5G56150 transcript variant
           AT5G56150.2 mRNA, complete cds
          Length = 744

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 93/113 (82%)
 Strand = Plus / Minus

                                                                       
Query: 270 ggactcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatc 329
           ||||||||||||| | || || |||||||| ||||| || || || || |||||||||||
Sbjct: 486 ggactcgtacttgactcggtctgtcttgtagatgtgcgctatttcaggaaccaaaggatc 427

                                                                
Query: 330 atcagggttcgggtccgtcagcaacgaacagattgacaggaggacctttgata 382
            |||||||| || ||||||||||| || || || ||||| || ||||| ||||
Sbjct: 426 gtcagggtttggatccgtcagcaatgagcatatcgacagaagaaccttggata 374



to top

>ref|NM_180867.1| Arabidopsis thaliana ubiquitin conjugating enzyme/ ubiquitin-like
           activating enzyme AT5G56150 transcript variant
           AT5G56150.1 mRNA, complete cds
          Length = 751

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 93/113 (82%)
 Strand = Plus / Minus

                                                                       
Query: 270 ggactcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatc 329
           ||||||||||||| | || || |||||||| ||||| || || || || |||||||||||
Sbjct: 493 ggactcgtacttgactcggtctgtcttgtagatgtgcgctatttcaggaaccaaaggatc 434

                                                                
Query: 330 atcagggttcgggtccgtcagcaacgaacagattgacaggaggacctttgata 382
            |||||||| || ||||||||||| || || || ||||| || ||||| ||||
Sbjct: 433 gtcagggtttggatccgtcagcaatgagcatatcgacagaagaaccttggata 381



to top

>gb|AY489135.1| Capsicum annuum ubiquitin-conjugating enzyme 8 mRNA, complete cds
          Length = 713

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                    
Query: 288 atcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtc 344
           ||||||||||||||| ||||| ||||| ||||| |||||||||||||| || |||||
Sbjct: 449 atcagtcttgtacatatgagctatctcaggcactaaaggatcatcaggattagggtc 393



to top

>ref|XM_390981.1| Gibberella zeae PH-1 chromosome 3 UBC1_COLGL Ubiquitin-conjugating
           enzyme E2-16 kDa (Ubiquitin-protein ligase) (Ubiquitin
           carrier protein) (Colletotrichum hard-s> (FG10805.1)
           partial mRNA
          Length = 420

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 84/101 (83%)
 Strand = Plus / Minus

                                                                       
Query: 289 tcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtc 348
           ||||||||||| |  || ||||||||||||||||||||||| |||||||| || ||||| 
Sbjct: 365 tcagtcttgtagacatgggcgatctcgggcaccaaaggatcgtcagggttgggatccgtt 306

                                                    
Query: 349 agcaacgaacagattgacaggaggacctttgatatggtcaa 389
           ||||  || ||||| ||||| || || || || ||||||||
Sbjct: 305 agcattgagcagatggacagaagaactttagagatggtcaa 265



to top

>gb|AC148404.7| Medicago truncatula clone mth2-28d4, complete sequence
          Length = 111252

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                         
Query: 292   gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagc 351
             |||||||||||||| || || || ||||||||||||||||| ||||| || || ||||||
Sbjct: 92556 gtcttgtacatgtgggcaatatcaggcaccaaaggatcatctgggtttggatctgtcagc 92497

                              
Query: 352   aacgaacagattgacag 368
             |  || |||||||||||
Sbjct: 92496 agagagcagattgacag 92480



to top

>gb|AY081511.1| Arabidopsis thaliana ubiquitin-conjugating enzyme-like protein
           (MDA7.21) mRNA, complete cds
          Length = 479

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 93/113 (82%)
 Strand = Plus / Minus

                                                                       
Query: 270 ggactcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatc 329
           ||||||||||||| | || || |||||||| ||||| || || || || |||||||||||
Sbjct: 408 ggactcgtacttgactcggtctgtcttgtagatgtgcgctatttcaggaaccaaaggatc 349

                                                                
Query: 330 atcagggttcgggtccgtcagcaacgaacagattgacaggaggacctttgata 382
            |||||||| || ||||||||||| || || || ||||| || ||||| ||||
Sbjct: 348 gtcagggtttggatccgtcagcaatgagcatatcgacagaagaaccttggata 296



to top

>gb|AY059806.1| Arabidopsis thaliana ubiquitin-conjugating enzyme-like protein
           (MDA7.21) mRNA, complete cds
          Length = 717

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 93/113 (82%)
 Strand = Plus / Minus

                                                                       
Query: 270 ggactcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatc 329
           ||||||||||||| | || || |||||||| ||||| || || || || |||||||||||
Sbjct: 487 ggactcgtacttgactcggtctgtcttgtagatgtgcgctatttcaggaaccaaaggatc 428

                                                                
Query: 330 atcagggttcgggtccgtcagcaacgaacagattgacaggaggacctttgata 382
            |||||||| || ||||||||||| || || || ||||| || ||||| ||||
Sbjct: 427 gtcagggtttggatccgtcagcaatgagcatatcgacagaagaaccttggata 375



to top

>emb|BX833149.1|CNS09Z3U Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL36ZD09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 707

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 93/113 (82%)
 Strand = Plus / Minus

                                                                       
Query: 270 ggactcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatc 329
           ||||||||||||| | || || |||||||| ||||| || || || || |||||||||||
Sbjct: 476 ggactcgtacttgactcgttctgtcttgtagatgtgcgctatttcaggaaccaaaggatc 417

                                                                
Query: 330 atcagggttcgggtccgtcagcaacgaacagattgacaggaggacctttgata 382
            |||||||| || ||||||||||| || || || ||||| || ||||| ||||
Sbjct: 416 gtcagggtttggatccgtcagcaatgagcatatggacagaagaaccttggata 364



to top

>gb|AY084220.1| Arabidopsis thaliana clone 10022 mRNA, complete sequence
          Length = 750

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 93/113 (82%)
 Strand = Plus / Minus

                                                                       
Query: 270 ggactcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatc 329
           ||||||||||||| | || || |||||||| ||||| || || || || |||||||||||
Sbjct: 493 ggactcgtacttgactcggtctgtcttgtagatgtgcgctatttcaggaaccaaaggatc 434

                                                                
Query: 330 atcagggttcgggtccgtcagcaacgaacagattgacaggaggacctttgata 382
            |||||||| || ||||||||||| || || || ||||| || ||||| ||||
Sbjct: 433 gtcagggtttggatccgtcagcaatgagcatatcgacagaagaaccttggata 381



to top

>gb|DQ027043.1| Arabidopsis thaliana ubiquitinating enzyme (At5g56150) mRNA,
           complete cds
          Length = 447

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 93/113 (82%)
 Strand = Plus / Minus

                                                                       
Query: 270 ggactcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatc 329
           ||||||||||||| | || || |||||||| ||||| || || || || |||||||||||
Sbjct: 408 ggactcgtacttgactcggtctgtcttgtagatgtgcgctatttcaggaaccaaaggatc 349

                                                                
Query: 330 atcagggttcgggtccgtcagcaacgaacagattgacaggaggacctttgata 382
            |||||||| || ||||||||||| || || || ||||| || ||||| ||||
Sbjct: 348 gtcagggtttggatccgtcagcaatgagcatatcgacagaagaaccttggata 296



to top

>gb|DQ249816.1| Capsicum annuum ubiquitin-conjugating enzyme E2 mRNA, complete cds
          Length = 678

 Score = 65.9 bits (33), Expect = 9e-08
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                    
Query: 288 atcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtc 344
           ||||||||||||||| ||||| ||||| ||||| |||||||||||||| || |||||
Sbjct: 460 atcagtcttgtacatatgagctatctcaggcactaaaggatcatcaggattagggtc 404



to top

>dbj|AB011476.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MDA7
          Length = 82033

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 71/84 (84%)
 Strand = Plus / Minus

                                                                         
Query: 270   ggactcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatc 329
             ||||||||||||| | || || |||||||| ||||| || || || || |||||||||||
Sbjct: 65245 ggactcgtacttgactcggtctgtcttgtagatgtgcgctatttcaggaaccaaaggatc 65186

                                     
Query: 330   atcagggttcgggtccgtcagcaa 353
              |||||||| || |||||||||||
Sbjct: 65185 gtcagggtttggatccgtcagcaa 65162



to top

>emb|X73419.1|LEUBC L.esculentum mRNA for ubiquitin conjugating enzyme E2
          Length = 686

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 64/75 (85%)
 Strand = Plus / Minus

                                                                       
Query: 288 atcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgt 347
           |||||| |||||||| ||||| ||||| ||||||||||| ||||| || || ||||| ||
Sbjct: 402 atcagttttgtacatatgagcaatctccggcaccaaagggtcatcgggattagggtctgt 343

                          
Query: 348 cagcaacgaacagat 362
           |||||  ||||||||
Sbjct: 342 cagcagagaacagat 328



to top

>gb|AY389716.1| Hyacinthus orientalis ubiquitin-conjugating enzyme 9 mRNA, partial
           cds
          Length = 650

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

                                                                     
Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtca 349
           |||||||||||||| ||||| || || ||||| |||||||| ||||| ||||||||||
Sbjct: 363 gtcttgtacatgtgcgcgatttctggaaccaacggatcatctgggtttgggtccgtca 306



to top

>gb|AF176040.1|AF176040 Mesembryanthemum crystallinum ubiquitin-conjugating enzyme UBC2
           (Ubc2) mRNA, complete cds
          Length = 809

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 288 atcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgt 347
           ||||||||||||||||||||||||||| || || |  ||||||||||| || ||||| ||
Sbjct: 470 atcagtcttgtacatgtgagcgatctctgggacaagcggatcatcaggatttgggtcggt 411

             
Query: 348 ca 349
           ||
Sbjct: 410 ca 409



to top

>ref|NM_001036151.1| Arabidopsis thaliana ubiquitin conjugating enzyme/ ubiquitin-like
           activating enzyme AT1G64230 transcript variant
           AT1G64230.2 mRNA, complete cds
          Length = 885

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgt 347
           |||||||||||||| ||||| || ||||| |||||||| ||||| ||||||||
Sbjct: 505 ttgtacatgtgagcaatctctggaaccaatggatcatctgggtttgggtccgt 453



to top

>ref|NM_105097.3| Arabidopsis thaliana ubiquitin conjugating enzyme/ ubiquitin-like
           activating enzyme AT1G64230 transcript variant
           AT1G64230.1 mRNA, complete cds
          Length = 846

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgt 347
           |||||||||||||| ||||| || ||||| |||||||| ||||| ||||||||
Sbjct: 517 ttgtacatgtgagcaatctctggaaccaatggatcatctgggtttgggtccgt 465



to top

>gb|BT016331.1| Zea mays clone Contig164 mRNA sequence
          Length = 860

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 116/145 (80%)
 Strand = Plus / Minus

                                                                       
Query: 233 agcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcag 292
           ||||||| |||||||| || ||||||  ||| ||||  ||||||||||| | ||| || |
Sbjct: 545 agcccatcgcgtacttctgcgtccagctgcgggccgtcgactcgtacttcggccggtccg 486

                                                                       
Query: 293 tcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352
           ||||||||||||| || ||||| || || | ||| || || ||||| ||||| |||||||
Sbjct: 485 tcttgtacatgtgggcaatctccgggacaagagggtcgtccgggttggggtcggtcagca 426

                                    
Query: 353 acgaacagattgacaggaggacctt 377
             || ||||| || || ||||||||
Sbjct: 425 gggagcagatggagagcaggacctt 401



to top

>gb|AY133670.1| Arabidopsis thaliana At1g64230/F22C12_17 mRNA, complete cds
          Length = 447

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgt 347
           |||||||||||||| ||||| || ||||| |||||||| ||||| ||||||||
Sbjct: 383 ttgtacatgtgagcaatctctggaaccaatggatcatctgggtttgggtccgt 331



to top

>gb|AF480945.1| Arabidopsis thaliana ubiquitin conjugating enzyme UBC9A (UBC9A)
           mRNA, complete cds
          Length = 723

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgt 347
           |||||||||||||| ||||| || ||||| |||||||| ||||| ||||||||
Sbjct: 470 ttgtacatgtgagcaatctctggaaccaatggatcatctgggtttgggtccgt 418



to top

>gb|AF385718.1|AF385718 Arabidopsis thaliana At1g64230/F22C12_17 mRNA, complete cds
          Length = 738

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgt 347
           |||||||||||||| ||||| || ||||| |||||||| ||||| ||||||||
Sbjct: 509 ttgtacatgtgagcaatctctggaaccaatggatcatctgggtttgggtccgt 457



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 80/97 (82%)
 Strand = Plus / Plus

                                                                            
Query: 280      ttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttc 339
                |||||||||||||||||||||||||| || ||||| || || |  || || || ||||| 
Sbjct: 17797623 ttggcccgatcagtcttgtacatgtgcgcaatctccggaactagcgggtcgtctgggttt 17797682

                                                     
Query: 340      gggtccgtcagcaacgaacagattgacaggaggacct 376
                ||||||||||| |  ||||| ||||| ||||| ||||
Sbjct: 17797683 gggtccgtcagtagagaacaaattgagaggagtacct 17797719



to top

>emb|BX815683.1|CNS0ABHQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS83ZF06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 776

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgt 347
           |||||||||||||| ||||| || ||||| |||||||| ||||| ||||||||
Sbjct: 487 ttgtacatgtgagcaatctctggaaccaatggatcatctgggtttgggtccgt 435



to top

>emb|BX815644.1|CNS0ABEX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS7ZD08 of Adult vegetative tissue of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1496

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 295  ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgt 347
            |||||||||||||| ||||| || ||||| |||||||| ||||| ||||||||
Sbjct: 1287 ttgtacatgtgagcaatctctggaaccaatggatcatctgggtttgggtccgt 1235



to top

>emb|BX816916.1|CNS0ABT7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH76ZE04 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 467

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgt 347
           |||||||||||||| ||||| || ||||| |||||||| ||||| ||||||||
Sbjct: 217 ttgtacatgtgagcaatctctggaaccaatggatcatctgggtttgggtccgt 165



to top

>emb|BX816699.1|CNS0ABXP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH63ZG10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 782

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgt 347
           |||||||||||||| ||||| || ||||| |||||||| ||||| ||||||||
Sbjct: 516 ttgtacatgtgagcaatctctggaaccaatggatcatctgggtttgggtccgt 464



to top

>gb|AY082008.1| Gossypium arboreum ubiquitin-conjugating enzyme E2 gene, complete cds
          Length = 1985

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 74/89 (83%)
 Strand = Plus / Minus

                                                                        
Query: 274  tcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatca 333
            |||||||| |||||||||||||| |||||||| || ||||| || || |  || ||||||
Sbjct: 1823 tcgtactttgcccgatcagtcttatacatgtgtgcaatctccggaacaagtgggtcatca 1764

                                         
Query: 334  gggttcgggtccgtcagcaacgaacagat 362
            ||||| || || |||| |||||| |||||
Sbjct: 1763 gggtttggatcagtcaacaacgagcagat 1735



to top

>gb|AY082006.1| Gossypium hirsutum ubiquitin-conjugating enzyme E2 (UBC1) gene,
            complete cds
          Length = 1982

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 74/89 (83%)
 Strand = Plus / Minus

                                                                        
Query: 274  tcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatca 333
            |||||||| |||||||||||||| |||||||| || ||||| || || |  || ||||||
Sbjct: 1820 tcgtactttgcccgatcagtcttatacatgtgtgcaatctccggaacaagtgggtcatca 1761

                                         
Query: 334  gggttcgggtccgtcagcaacgaacagat 362
            ||||| || || |||| |||||| |||||
Sbjct: 1760 gggtttggatcagtcaacaacgagcagat 1732



to top

>gb|AY082004.1| Gossypium hirsutum ubiquitin-conjugating enzyme E2 (UBC1) mRNA,
           complete cds
          Length = 773

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 74/89 (83%)
 Strand = Plus / Minus

                                                                       
Query: 274 tcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatca 333
           |||||||| |||||||||||||| |||||||| || ||||| || || |  || ||||||
Sbjct: 593 tcgtactttgcccgatcagtcttatacatgtgtgcaatctccggaacaagtgggtcatca 534

                                        
Query: 334 gggttcgggtccgtcagcaacgaacagat 362
           ||||| || || |||| |||||| |||||
Sbjct: 533 gggtttggatcagtcaacaacgagcagat 505



to top

>gb|AC007764.2|AC007764 Genomic sequence for Arabidopsis thaliana BAC F22C12 from chromosome I,
             complete sequence
          Length = 111222

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                  
Query: 295   ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgt 347
             |||||||||||||| ||||| || ||||| |||||||| ||||| ||||||||
Sbjct: 15738 ttgtacatgtgagcaatctctggaaccaatggatcatctgggtttgggtccgt 15790



to top

>dbj|AP003618.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
            clone:P0561B08
          Length = 161083

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 80/97 (82%)
 Strand = Plus / Plus

                                                                        
Query: 280  ttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttc 339
            |||||||||||||||||||||||||| || ||||| || || |  || || || ||||| 
Sbjct: 2812 ttggcccgatcagtcttgtacatgtgcgcaatctccggaactagcgggtcgtctgggttt 2871

                                                 
Query: 340  gggtccgtcagcaacgaacagattgacaggaggacct 376
            ||||||||||| |  ||||| ||||| ||||| ||||
Sbjct: 2872 gggtccgtcagtagagaacaaattgagaggagtacct 2908



to top

>dbj|AP004743.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBb0026G06
          Length = 123129

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 80/97 (82%)
 Strand = Plus / Plus

                                                                         
Query: 280   ttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttc 339
             |||||||||||||||||||||||||| || ||||| || || |  || || || ||||| 
Sbjct: 68045 ttggcccgatcagtcttgtacatgtgcgcaatctccggaactagcgggtcgtctgggttt 68104

                                                  
Query: 340   gggtccgtcagcaacgaacagattgacaggaggacct 376
             ||||||||||| |  ||||| ||||| ||||| ||||
Sbjct: 68105 gggtccgtcagtagagaacaaattgagaggagtacct 68141



to top

>dbj|AK066232.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013057M05, full
            insert sequence
          Length = 2141

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 80/97 (82%)
 Strand = Plus / Minus

                                                                        
Query: 280  ttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttc 339
            |||||||||||||||||||||||||| || ||||| || || |  || || || ||||| 
Sbjct: 1930 ttggcccgatcagtcttgtacatgtgcgcaatctccggaactagcgggtcgtctgggttt 1871

                                                 
Query: 340  gggtccgtcagcaacgaacagattgacaggaggacct 376
            ||||||||||| |  ||||| ||||| ||||| ||||
Sbjct: 1870 gggtccgtcagtagagaacaaattgagaggagtacct 1834



to top

>gb|AY104017.1| Zea mays PCO119482 mRNA sequence
          Length = 885

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 116/145 (80%)
 Strand = Plus / Minus

                                                                       
Query: 233 agcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcag 292
           ||||||| |||||||| || ||||||  ||| ||||  ||||||||||| | ||| || |
Sbjct: 582 agcccatcgcgtacttctgcgtccagctgcgggccgtcgactcgtacttcggccggtccg 523

                                                                       
Query: 293 tcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352
           ||||||||||||| || ||||| || || | ||| || || ||||| ||||| |||||||
Sbjct: 522 tcttgtacatgtgggcaatctccgggacaagagggtcgtccgggttggggtcggtcagca 463

                                    
Query: 353 acgaacagattgacaggaggacctt 377
             || ||||| || || ||||||||
Sbjct: 462 gggagcagatggagagcaggacctt 438



to top

>gb|DQ027041.1| Arabidopsis thaliana ubiquitinating enzyme (At1g64230) mRNA,
           complete cds
          Length = 447

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgt 347
           |||||||||||||| ||||| || ||||| |||||||| ||||| ||||||||
Sbjct: 383 ttgtacatgtgagcaatctctggaaccaatggatcatctgggtttgggtccgt 331



to top

>gb|AF034946.1|AF034946 Zea mays ubiquitin conjugating enzyme (UBC) mRNA, complete cds
          Length = 781

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 116/145 (80%)
 Strand = Plus / Minus

                                                                       
Query: 233 agcccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcag 292
           ||||||| |||||||| || ||||||  ||| ||||  ||||||||||| | ||| || |
Sbjct: 485 agcccatcgcgtacttctgcgtccagctgcgggccgtcgactcgtacttcggccggtccg 426

                                                                       
Query: 293 tcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352
           ||||||||||||| || ||||| || || | ||| || || ||||| ||||| |||||||
Sbjct: 425 tcttgtacatgtgggcaatctccgggacaagagggtcgtccgggttggggtcggtcagca 366

                                    
Query: 353 acgaacagattgacaggaggacctt 377
             || ||||| || || ||||||||
Sbjct: 365 gggagcagatggagagcaggacctt 341



to top

>gb|U15971.1|OSU15971 Oryza sativa ubiquitin conjugating enzyme (UBC) gene, complete cds
          Length = 2088

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 280  ttggcccgatcagtcttgtacatgtgagcgatctc 314
            |||||||||||||||||||||||||| || |||||
Sbjct: 1925 ttggcccgatcagtcttgtacatgtgcgccatctc 1891



to top

>ref|XM_454516.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E12595g predicted mRNA
          Length = 447

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332
           ||||||||| || | ||| ||||| ||||  |||||||| || || ||||||||||||||
Sbjct: 408 ctcgtacttagctctatcggtcttatacaaatgagcgatttcagggaccaaaggatcatc 349

                 
Query: 333 agggtt 338
           ||||||
Sbjct: 348 agggtt 343



to top

>emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL Y-1140
               of Kluyveromyces lactis
          Length = 2234072

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                           
Query: 273     ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332
               ||||||||| || | ||| ||||| ||||  |||||||| || || ||||||||||||||
Sbjct: 1117702 ctcgtacttagctctatcggtcttatacaaatgagcgatttcagggaccaaaggatcatc 1117643

                     
Query: 333     agggtt 338
               ||||||
Sbjct: 1117642 agggtt 1117637



to top

>gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome V,
              complete sequence
          Length = 1519138

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 74/90 (82%)
 Strand = Plus / Plus

                                                                          
Query: 273    ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332
              |||||||||||||| ||| |||||||| |||||||| || || || ||||| || || ||
Sbjct: 960459 ctcgtacttggccctatccgtcttgtagatgtgagcaatttccggaaccaacgggtcgtc 960518

                                            
Query: 333    agggttcgggtccgtcagcaacgaacagat 362
               ||||| | |||||||| ||| || |||||
Sbjct: 960519 cgggttggcgtccgtcaacaaagagcagat 960548



to top

>gb|AY082010.1| Gossypium raimondii ubiquitin-conjugating enzyme E2 gene, complete
            cds
          Length = 2013

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 71/86 (82%)
 Strand = Plus / Minus

                                                                        
Query: 277  tacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcaggg 336
            ||||| |||||||||||||| |||||||| || ||||| || || |  || |||||||||
Sbjct: 1809 tactttgcccgatcagtcttatacatgtgcgcaatctccggaacaagtgggtcatcaggg 1750

                                      
Query: 337  ttcgggtccgtcagcaacgaacagat 362
            || || || |||| |||||| |||||
Sbjct: 1749 tttggatcagtcaacaacgagcagat 1724



to top

>gb|AY082009.1| Gossypium thurberi ubiquitin-conjugating enzyme E2 gene, complete cds
          Length = 2016

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 71/86 (82%)
 Strand = Plus / Minus

                                                                        
Query: 277  tacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcaggg 336
            ||||| |||||||||||||| |||||||| || ||||| || || |  || |||||||||
Sbjct: 1812 tactttgcccgatcagtcttatacatgtgcgcaatctccggaacaagtgggtcatcaggg 1753

                                      
Query: 337  ttcgggtccgtcagcaacgaacagat 362
            || || || |||| |||||| |||||
Sbjct: 1752 tttggatcagtcaacaacgagcagat 1727



to top

>ref|NM_210385.1| Eremothecium gossypii AER173Cp (AER173C), mRNA
          Length = 444

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 74/90 (82%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332
           |||||||||||||| ||| |||||||| |||||||| || || || ||||| || || ||
Sbjct: 405 ctcgtacttggccctatccgtcttgtagatgtgagcaatttccggaaccaacgggtcgtc 346

                                         
Query: 333 agggttcgggtccgtcagcaacgaacagat 362
            ||||| | |||||||| ||| || |||||
Sbjct: 345 cgggttggcgtccgtcaacaaagagcagat 316



to top

>gb|AY104144.1| Zea mays PCO100898 mRNA sequence
          Length = 831

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctc 314
           ||||||||| | |||||| ||||||||||||||||| |||||
Sbjct: 538 ctcgtacttaggccgatccgtcttgtacatgtgagcaatctc 497



to top

>gb|AF030296.1|AF030296 Glomerella cingulata ubiquitin conjugating enzyme UBC1 (UBC1) mRNA,
           complete cds
          Length = 961

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                       
Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagc 351
           |||||||| | ||| ||||||||||| || |  || || || ||||| ||||||||||||
Sbjct: 591 gtcttgtagacgtgtgcgatctcggggacgagcggttcgtcggggttggggtccgtcagc 532

                                                 
Query: 352 aacgaacagattgacaggaggacctttgatatggtcaa 389
           | ||| ||||| || || |||||||| || ||||||||
Sbjct: 531 atcgagcagatggagagcaggaccttagagatggtcaa 494



to top

>gb|U17250.1|BCSC1 Brassica oleracea ubiquitine conjugating enzyme mRNA, partial cds
          Length = 607

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 92/114 (80%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332
           |||||||||| | || || ||||||||  ||||||| || || || |||| |||||||||
Sbjct: 348 ctcgtacttgactcggtctgtcttgtaggtgtgagctatttctggaaccagaggatcatc 289

                                                                 
Query: 333 agggttcgggtccgtcagcaacgaacagattgacaggaggacctttgatatggt 386
           |||||| || || |||||||  || || || || || |||||||| ||||||||
Sbjct: 288 agggtttggatctgtcagcagtgagcatatcgaaagaaggaccttggatatggt 235



to top

>gb|AY220735.1| Hordeum vulgare ubiquitin-conjugating enzyme (UBC) mRNA, complete
           cds
          Length = 758

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 76/93 (81%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332
           ||||||||| | |||||| |||||||||||||| || ||||| || || | ||| || ||
Sbjct: 507 ctcgtacttagaccgatccgtcttgtacatgtgggcaatctcagggacgagagggtcgtc 448

                                            
Query: 333 agggttcgggtccgtcagcaacgaacagattga 365
            ||||| ||||| || |||| ||| ||||||||
Sbjct: 447 cgggttagggtcggtaagcagcgagcagattga 415



to top

>gb|DQ350764.1| Ajellomyces capsulatus ubiquitin-conjugating enzyme E2-like protein
            (UBC1) gene, partial sequence
          Length = 1874

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                        
Query: 286  cgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtcc 345
            ||||| |||||||| |  ||||| || || || |||||||||||||| ||||||||||| 
Sbjct: 1383 cgatcggtcttgtaaacatgagcaatttcaggtaccaaaggatcatccgggttcgggtct 1324

                             
Query: 346  gtcagcaacgaacagat 362
            || ||||  ||||||||
Sbjct: 1323 gtgagcatggaacagat 1307



to top

>gb|AY639585.1| Picea abies ubiquitin-conjugating enzyme UBC1 mRNA, complete cds
          Length = 478

 Score = 50.1 bits (25), Expect = 0.005
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                       
Query: 289 tcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtc 348
           |||||||||||||| ||||| ||||| || || | ||||||||| ||||| || ||||||
Sbjct: 278 tcagtcttgtacatatgagcaatctctggtacaagaggatcatctgggtttggatccgtc 219

            
Query: 349 a 349
           |
Sbjct: 218 a 218



to top

>gb|AY952317.1| Triticum aestivum cultivar 7269-10 immature spike
           ubiquitin-conjugating enzyme 2 mRNA, complete cds
          Length = 853

 Score = 48.1 bits (24), Expect = 0.021
 Identities = 102/128 (79%)
 Strand = Plus / Minus

                                                                       
Query: 235 cccatggcgtacttttgtgtccaggagcgcgccggggactcgtacttggcccgatcagtc 294
           |||||||||||||| || ||||||  ||| || |  | ||| ||||| | ||| || |||
Sbjct: 583 cccatggcgtacttctgcgtccagctgcgggctgtcgtctcatactttgaccggtccgtc 524

                                                                       
Query: 295 ttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagcaac 354
           ||||||||||| || |||||||| || |  |||||||| ||||| || || |||||||  
Sbjct: 523 ttgtacatgtgggcaatctcgggaacaaggggatcatccgggttgggatcggtcagcagg 464

                   
Query: 355 gaacagat 362
           ||||||||
Sbjct: 463 gaacagat 456



to top

>gb|AY769917.1| Arachis hypogaea ubiquitin-conjugating enzyme (UBC) mRNA, complete
           cds
          Length = 780

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 294 cttgtacatgtgagcgatctcgggcaccaaaggatcatc 332
           ||||||||| ||||| ||||||||||  |||||||||||
Sbjct: 516 cttgtacatatgagcaatctcgggcattaaaggatcatc 478



to top

>ref|XM_752036.1| Ustilago maydis 521 ubiquitin-conjugating enzyme E2-16 kDa
           (UM00982.1) partial mRNA
          Length = 444

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagc 351
           |||||||||| ||  ||||||||||| || |  ||||||||||| || ||||| || |||
Sbjct: 386 gtcttgtacaagttggcgatctcgggaacaagcggatcatcaggatttgggtcagtgagc 327

                      
Query: 352 aacgaacagat 362
           | |||||||||
Sbjct: 326 atcgaacagat 316



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
               sequence
          Length = 22696651

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 367     aggaggacctttgatatggtcaa 389
               |||||||||||||||||||||||
Sbjct: 6896291 aggaggacctttgatatggtcaa 6896269



to top

>dbj|AP006156.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:B1043F11
          Length = 167137

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 367    aggaggacctttgatatggtcaa 389
              |||||||||||||||||||||||
Sbjct: 124186 aggaggacctttgatatggtcaa 124164



to top

>dbj|AK065902.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013047C20, full
           insert sequence
          Length = 896

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 367 aggaggacctttgatatggtcaa 389
           |||||||||||||||||||||||
Sbjct: 473 aggaggacctttgatatggtcaa 451



to top

>dbj|AK059627.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-030-H11, full
           insert sequence
          Length = 899

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 367 aggaggacctttgatatggtcaa 389
           |||||||||||||||||||||||
Sbjct: 465 aggaggacctttgatatggtcaa 443



to top

>ref|XM_954840.1| Neurospora crassa OR74A hypothetical protein ( (XM_016084)
           hypothetical protein XP_016084 [Homo sapiens] )
           (NCU02289.1) partial mRNA
          Length = 444

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 73/90 (81%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332
           ||||||| |||| || || |||||||||| ||| || ||||||||||| |  || || ||
Sbjct: 405 ctcgtacctggcgcggtctgtcttgtacacgtgcgcaatctcgggcacaagcgggtcgtc 346

                                         
Query: 333 agggttcgggtccgtcagcaacgaacagat 362
           |||||| || ||||||| || ||| |||||
Sbjct: 345 agggttgggatccgtcaacatcgagcagat 316



to top

>ref|XM_331064.1| Neurospora crassa OR74A hypothetical protein ( (XM_016084)
           hypothetical protein XP_016084 [Homo sapiens] )
           (NCU02289.1) partial mRNA
          Length = 444

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 73/90 (81%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332
           ||||||| |||| || || |||||||||| ||| || ||||||||||| |  || || ||
Sbjct: 405 ctcgtacctggcgcggtctgtcttgtacacgtgcgcaatctcgggcacaagcgggtcgtc 346

                                         
Query: 333 agggttcgggtccgtcagcaacgaacagat 362
           |||||| || ||||||| || ||| |||||
Sbjct: 345 agggttgggatccgtcaacatcgagcagat 316



to top

>ref|XM_655273.1| Aspergillus nidulans FGSC A4 ubiquitin-conjugating enzyme E2-16 kDa
           (AN2761.2), mRNA
          Length = 444

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 289 tcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338
           |||||||||||||  ||||| ||||| ||||||| ||| ||||| |||||
Sbjct: 389 tcagtcttgtacacatgagcaatctcaggcaccagagggtcatccgggtt 340



to top

>gb|AY491500.1| Capsicum annuum ubiquitin-conjugating enzyme E2 mRNA, complete cds
          Length = 779

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 292 gtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtca 349
           ||||||||||| ||||| ||||| || |||| ||| ||||| ||||| || |||||||
Sbjct: 431 gtcttgtacatatgagcaatctcaggaaccagagggtcatcggggtttggatccgtca 374



to top

>emb|CR733525.2|CNS0GSRO Tetraodon nigroviridis full-length cDNA
          Length = 1352

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 307 gcgatctcgggcaccaaaggatcatcagggttcgggtc 344
           |||||||| |||||||  || |||||||||||||||||
Sbjct: 746 gcgatctctggcaccagtgggtcatcagggttcgggtc 709



to top

>emb|CR732722.2|CNS0GSBA Tetraodon nigroviridis full-length cDNA
          Length = 1355

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 307 gcgatctcgggcaccaaaggatcatcagggttcgggtc 344
           |||||||| |||||||  || |||||||||||||||||
Sbjct: 748 gcgatctctggcaccagtgggtcatcagggttcgggtc 711



to top

>emb|CR731170.1|CNS0GR47 Tetraodon nigroviridis full-length cDNA
          Length = 1336

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 307 gcgatctcgggcaccaaaggatcatcagggttcgggtc 344
           |||||||| |||||||  || |||||||||||||||||
Sbjct: 738 gcgatctctggcaccagtgggtcatcagggttcgggtc 701



to top

>emb|CR728345.2|CNS0GOXR Tetraodon nigroviridis full-length cDNA
          Length = 1345

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 307 gcgatctcgggcaccaaaggatcatcagggttcgggtc 344
           |||||||| |||||||  || |||||||||||||||||
Sbjct: 746 gcgatctctggcaccagtgggtcatcagggttcgggtc 709



to top

>emb|CR724467.2|CNS0GLY1 Tetraodon nigroviridis full-length cDNA
          Length = 1349

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 307 gcgatctcgggcaccaaaggatcatcagggttcgggtc 344
           |||||||| |||||||  || |||||||||||||||||
Sbjct: 746 gcgatctctggcaccagtgggtcatcagggttcgggtc 709



to top

>emb|CR708686.2|CNS0G9RU Tetraodon nigroviridis full-length cDNA
          Length = 654

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 307 gcgatctcgggcaccaaaggatcatcagggttcgggtc 344
           |||||||| |||||||  || |||||||||||||||||
Sbjct: 54  gcgatctctggcaccagtgggtcatcagggttcgggtc 17



to top

>emb|CR673935.2|CNS0FIZ9 Tetraodon nigroviridis full-length cDNA
          Length = 1374

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 307 gcgatctcgggcaccaaaggatcatcagggttcgggtc 344
           |||||||| |||||||  || |||||||||||||||||
Sbjct: 736 gcgatctctggcaccagtgggtcatcagggttcgggtc 699



to top

>emb|CR661341.2|CNS0F99F Tetraodon nigroviridis full-length cDNA
          Length = 1098

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 307 gcgatctcgggcaccaaaggatcatcagggttcgggtc 344
           |||||||| |||||||  || |||||||||||||||||
Sbjct: 735 gcgatctctggcaccagtgggtcatcagggttcgggtc 698



to top

>emb|CR651495.2|CNS0F1NX Tetraodon nigroviridis full-length cDNA
          Length = 1105

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 307 gcgatctcgggcaccaaaggatcatcagggttcgggtc 344
           |||||||| |||||||  || |||||||||||||||||
Sbjct: 738 gcgatctctggcaccattgggtcatcagggttcgggtc 701



to top

>emb|CR648302.2|CNS0EZ78 Tetraodon nigroviridis full-length cDNA
          Length = 1099

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 307 gcgatctcgggcaccaaaggatcatcagggttcgggtc 344
           |||||||| |||||||  || |||||||||||||||||
Sbjct: 732 gcgatctctggcaccagtgggtcatcagggttcgggtc 695



to top

>emb|CR647212.2|CNS0EYCY Tetraodon nigroviridis full-length cDNA
          Length = 1080

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 307 gcgatctcgggcaccaaaggatcatcagggttcgggtc 344
           |||||||| |||||||  || |||||||||||||||||
Sbjct: 714 gcgatctctggcaccagtgggtcatcagggttcgggtc 677



to top

>gb|AY082005.1| Gossypium hirsutum ubiquitin-conjugating enzyme E2 (UBC2) mRNA,
           complete cds
          Length = 850

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 70/86 (81%)
 Strand = Plus / Minus

                                                                       
Query: 277 tacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcaggg 336
           ||||| |||||||||||||| |||||||| || |||||  | || |  || |||||||||
Sbjct: 569 tactttgcccgatcagtcttatacatgtgcgcaatctccagaacaagtgggtcatcaggg 510

                                     
Query: 337 ttcgggtccgtcagcaacgaacagat 362
           || || || |||| |||||| |||||
Sbjct: 509 tttggatcagtcaacaacgagcagat 484



to top

>gb|AY082007.1| Gossypium hirsutum ubiquitin-conjugating enzyme E2 (UBC2) gene,
            complete cds
          Length = 1953

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 70/86 (81%)
 Strand = Plus / Minus

                                                                        
Query: 277  tacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcaggg 336
            ||||| |||||||||||||| |||||||| || |||||  | || |  || |||||||||
Sbjct: 1749 tactttgcccgatcagtcttatacatgtgcgcaatctccagaacaagtgggtcatcaggg 1690

                                      
Query: 337  ttcgggtccgtcagcaacgaacagat 362
            || || || |||| |||||| |||||
Sbjct: 1689 tttggatcagtcaacaacgagcagat 1664



to top

>gb|AY105836.1| Zea mays PCO130472 mRNA sequence
          Length = 915

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 367 aggaggacctttgatatggtca 388
           ||||||||||||||||||||||
Sbjct: 523 aggaggacctttgatatggtca 502



to top

>ref|NM_111704.1| Arabidopsis thaliana ubiquitin conjugating enzyme/ ubiquitin-like
           activating enzyme AT3G08700 mRNA, complete cds
          Length = 450

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 304 tgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352
           ||||| ||||| ||||| | ||||||||  ||||||||||| |||||||
Sbjct: 377 tgagctatctccggcacaagaggatcatttgggttcgggtcagtcagca 329



to top

>gb|BC040758.1| Mus musculus cDNA sequence BC040758, mRNA (cDNA clone IMAGE:4216169)
          Length = 1758

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 280  ttggcccgatcagtcttgtacatgt 304
            |||||||||||||| ||||||||||
Sbjct: 1386 ttggcccgatcagtattgtacatgt 1362



to top

>gb|BC034067.1| Mus musculus cDNA sequence BC040758, mRNA (cDNA clone IMAGE:4216169),
            partial cds
          Length = 1758

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 280  ttggcccgatcagtcttgtacatgt 304
            |||||||||||||| ||||||||||
Sbjct: 1386 ttggcccgatcagtattgtacatgt 1362



to top

>ref|XM_461820.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0G06941g)
           partial mRNA
          Length = 444

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 294 cttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338
           |||||| || |||||||| || |||||||||||||| || |||||
Sbjct: 384 cttgtaaatatgagcgatttctggcaccaaaggatcgtcggggtt 340



to top

>emb|CR382139.1| Debaryomyces hansenii chromosome G of strain CBS767 of Debaryomyces
              hansenii
          Length = 2051428

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                           
Query: 294    cttgtacatgtgagcgatctcgggcaccaaaggatcatcagggtt 338
              |||||| || |||||||| || |||||||||||||| || |||||
Sbjct: 551046 cttgtaaatatgagcgatttctggcaccaaaggatcgtcggggtt 551090



to top

>dbj|AK144400.1| Mus musculus adult male intestinal mucosa cDNA, RIKEN full-length
            enriched library, clone:G630055D06 product:similar to
            Protocadherin LKC [Homo sapiens], full insert sequence
          Length = 4121

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 280  ttggcccgatcagtcttgtacatgt 304
            |||||||||||||| ||||||||||
Sbjct: 3772 ttggcccgatcagtattgtacatgt 3748



to top

>gb|BT024821.1| Arabidopsis thaliana At3g08700 gene, complete cds
          Length = 450

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 304 tgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352
           ||||| ||||| ||||| | ||||||||  ||||||||||| |||||||
Sbjct: 377 tgagctatctccggcacaagaggatcatttgggttcgggtcagtcagca 329



to top

>gb|AC159745.5| Mus musculus 6 BAC RP23-394N3 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 185824

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 1      acacagagatttaacttaata 21
              |||||||||||||||||||||
Sbjct: 168117 acacagagatttaacttaata 168097



to top

>ref|NM_001033364.1| Mus musculus cDNA sequence BC040758 (BC040758), mRNA
          Length = 4121

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 280  ttggcccgatcagtcttgtacatgt 304
            |||||||||||||| ||||||||||
Sbjct: 3772 ttggcccgatcagtattgtacatgt 3748



to top

>gb|U66493.1|MAU66493 Metarhizium anisopliae ubiquitin conjugating enzyme (MET-UBC1)
           mRNA, complete cds
          Length = 405

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 304 tgagcgatctcgggcaccaaaggatcatcagggttcgggtc 344
           ||||| |||||||| || | ||||||||||||||| |||||
Sbjct: 335 tgagcaatctcgggtacaagaggatcatcagggttggggtc 295



to top

>gb|DQ027026.1| Arabidopsis thaliana ubiquitinating enzyme (At3g08700) mRNA,
           complete cds
          Length = 450

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 304 tgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtcagca 352
           ||||| ||||| ||||| | ||||||||  ||||||||||| |||||||
Sbjct: 377 tgagctatctccggcacaagaggatcatttgggttcgggtcagtcagca 329



to top

>gb|DQ294262.1| Solanum tuberosum clone 130D10 ubiquitin-conjugating enzyme E2-like
           protein mRNA, complete cds
          Length = 806

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 93/117 (79%)
 Strand = Plus / Minus

                                                                       
Query: 273 ctcgtacttggcccgatcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332
           |||||| |||||||  |||||||||||||| ||||| || || || || |  ||||||||
Sbjct: 484 ctcgtatttggccctgtcagtcttgtacatatgagcaatttctggtacaagtggatcatc 425

                                                                    
Query: 333 agggttcgggtccgtcagcaacgaacagattgacaggaggacctttgatatggtcaa 389
            ||||| || || ||||  |  || ||||| ||||  |||||||| |||||||||||
Sbjct: 424 tgggtttggatctgtcaatagagagcagatggacaacaggaccttagatatggtcaa 368



to top

>gb|AC153922.6| Mus musculus 6 BAC RP23-81P16 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 234722

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1     acacagagatttaacttaata 21
             |||||||||||||||||||||
Sbjct: 69285 acacagagatttaacttaata 69265



to top

>ref|XM_662484.1| Cryptosporidium hominis TU502 ubiquitin-conjugating enzyme
           (Chro.40073) partial mRNA
          Length = 357

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 289 tcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332
           |||||||| |||| |||||||||||| || || | |||||||||
Sbjct: 302 tcagtcttatacaagtgagcgatctcaggtactagaggatcatc 259



to top

>emb|AL353900.14| Human DNA sequence from clone RP11-202C2 on chromosome 10 Contains part
             of the gene for VPS10 domain receptor protein SORCS 3
             (SORCS3), complete sequence
          Length = 158737

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 67    ttgacatggcaagagtacat 86
             ||||||||||||||||||||
Sbjct: 92343 ttgacatggcaagagtacat 92362



to top

>emb|X92663.1|DMUBCD2 D.melanogaster mRNA for ubiquitin-conjugating enzyme UbcD2
          Length = 1222

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 361 attgacaggaggacctttgatatggtca 388
           |||||||| | |||||||||||||||||
Sbjct: 863 attgacagcaagacctttgatatggtca 836



to top

>dbj|AB226249.1| Aspergillus oryzae cDNA, contig sequence: AoEST3108
          Length = 1024

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                       
Query: 289 tcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtc 348
           |||||||||||||  || || || || |||||||| || || || ||||| ||||| || 
Sbjct: 551 tcagtcttgtacacatgcgcaatttcaggcaccaacgggtcgtctgggttggggtctgta 492

                               
Query: 349 agcaacgaacagattgacag 368
           |||| ||||||||| |||||
Sbjct: 491 agcatcgaacagatggacag 472



to top

>dbj|AP007167.1| Aspergillus oryzae RIB40 genomic DNA, SC020
          Length = 1824958

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 65/80 (81%)
 Strand = Plus / Plus

                                                                          
Query: 289    tcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatcagggttcgggtccgtc 348
              |||||||||||||  || || || || |||||||| || || || ||||| ||||| || 
Sbjct: 204387 tcagtcttgtacacatgcgcaatttcaggcaccaacgggtcgtctgggttggggtctgta 204446

                                  
Query: 349    agcaacgaacagattgacag 368
              |||| ||||||||| |||||
Sbjct: 204447 agcatcgaacagatggacag 204466



to top

>ref|NM_164943.1| Drosophila melanogaster Ubiquitin conjugating enzyme 2 CG6720-RB,
           transcript variant B (UbcD2), mRNA
          Length = 1350

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 361 attgacaggaggacctttgatatggtca 388
           |||||||| | |||||||||||||||||
Sbjct: 667 attgacagcaagacctttgatatggtca 640



to top

>gb|AY094899.1| Drosophila melanogaster RE74673 full insert cDNA
          Length = 1644

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 361 attgacaggaggacctttgatatggtca 388
           |||||||| | |||||||||||||||||
Sbjct: 943 attgacagcaagacctttgatatggtca 916



to top

>ref|NM_057789.3| Drosophila melanogaster Ubiquitin conjugating enzyme 2 CG6720-RA,
           transcript variant A (UbcD2), mRNA
          Length = 1625

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 361 attgacaggaggacctttgatatggtca 388
           |||||||| | |||||||||||||||||
Sbjct: 942 attgacagcaagacctttgatatggtca 915



to top

>dbj|AK146659.1| Mus musculus 16 days embryo kidney cDNA, RIKEN full-length enriched
            library, clone:I920039M22 product:ubiquitin-conjugating
            enzyme E2D 2, full insert sequence
          Length = 3458

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 305  gagcgatctcgggcaccaaaggatcatc 332
            |||| ||||| |||||||||||||||||
Sbjct: 1993 gagcaatctcaggcaccaaaggatcatc 1966



to top

>ref|XM_625662.1| Cryptosporidium parvum Iowa II ubiquitin-conjugating enzyme
           (cgd4_570), partial mRNA
          Length = 486

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 289 tcagtcttgtacatgtgagcgatctcgggcaccaaaggatcatc 332
           |||||||| |||| |||||||||||| || || | |||||||||
Sbjct: 431 tcagtcttatacaagtgagcgatctcaggtactagaggatcatc 388



to top

>gb|AC007147.8|AC007147 Drosophila melanogaster, chromosome 2L, region 32A-, BAC clone BACR19N18,
              complete sequence
          Length = 196248

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 361    attgacaggaggacctttgatatggtca 388
              |||||||| | |||||||||||||||||
Sbjct: 151264 attgacagcaagacctttgatatggtca 151237



to top

>gb|AE003629.2| Drosophila melanogaster chromosome 2L, section 38 of 83 of the complete
              sequence
          Length = 261176

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 361    attgacaggaggacctttgatatggtca 388
              |||||||| | |||||||||||||||||
Sbjct: 259493 attgacagcaagacctttgatatggtca 259520


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,202,923
Number of Sequences: 3902068
Number of extensions: 2202923
Number of successful extensions: 37205
Number of sequences better than 10.0: 183
Number of HSP's better than 10.0 without gapping: 184
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 36844
Number of HSP's gapped (non-prelim): 326
length of query: 389
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 367
effective length of database: 17,147,199,772
effective search space: 6293022316324
effective search space used: 6293022316324
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top