>gb|AC150424.3| Branchiostoma floridae clone CH302-7J16, complete sequence
          Length = 154657

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 329   cagtctacagtactgtaacagtgat 353
             |||| ||||||||||||||||||||
Sbjct: 10665 cagtgtacagtactgtaacagtgat 10689

>gb|AC068501.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-23C4, complete
              sequence
          Length = 196175

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 324    tatgtcagtctacagtactgt 344
              |||||||||||||||||||||
Sbjct: 172169 tatgtcagtctacagtactgt 172149

>emb|CR855858.5| Zebrafish DNA sequence from clone CH211-113H5 in linkage group 24,
             complete sequence
          Length = 152666

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 57    atttgttgcacatttttgcag 77
             |||||||||||||||||||||
Sbjct: 69812 atttgttgcacatttttgcag 69832

>gb|AC149472.23| Medicago truncatula clone mth2-77f21, complete sequence
          Length = 120151

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 191   ctcctttggtgttggcaatga 211
             |||||||||||||||||||||
Sbjct: 87050 ctcctttggtgttggcaatga 87070

>gb|AC122542.3| Mus musculus BAC clone RP24-572J16 from 9, complete sequence
          Length = 175952

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 187   tgatctcctttggtgttggca 207
             |||||||||||||||||||||
Sbjct: 92566 tgatctcctttggtgttggca 92546

>gb|AC134933.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0579A05,
             complete sequence
          Length = 107407

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 164   acgtttgaacacctagatga 183
             ||||||||||||||||||||
Sbjct: 40843 acgtttgaacacctagatga 40862

>gb|AC137617.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0084P24,
              complete sequence
          Length = 148784

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 164    acgtttgaacacctagatga 183
              ||||||||||||||||||||
Sbjct: 145524 acgtttgaacacctagatga 145543

>gb|AC125275.8| Mus musculus chromosome 7, clone RP24-165E9, complete sequence
          Length = 218429

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 294   ggcaatgtacagatggagag 313
             ||||||||||||||||||||
Sbjct: 91283 ggcaatgtacagatggagag 91302

>gb|AC125146.3| Mus musculus BAC clone RP24-348B1 from chromosome 2, complete sequence
          Length = 212563

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 16    atgttatttccatcaaccaataaa 39
             ||||||||||||||||| ||||||
Sbjct: 46167 atgttatttccatcaacaaataaa 46144

>gb|AC136717.10| Mus musculus chromosome 7, clone RP23-48C24, complete sequence
          Length = 222854

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 155    ttcaccagtacgtttgaaca 174
              ||||||||||||||||||||
Sbjct: 130783 ttcaccagtacgtttgaaca 130764

>gb|AC101879.8| Mus musculus chromosome 7, clone RP23-378H21, complete sequence
          Length = 174481

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 294   ggcaatgtacagatggagag 313
             ||||||||||||||||||||
Sbjct: 43556 ggcaatgtacagatggagag 43537

>gb|AC023946.5| Homo sapiens chromosome 11, clone RP11-567I13, complete sequence
          Length = 187380

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 363   aaaaagttttctttgctgta 382
             ||||||||||||||||||||
Sbjct: 78314 aaaaagttttctttgctgta 78333

>gb|DQ354455.1| Lemur catta breast and ovarian cancer susceptibility 1 (BRCA1)
           gene, partial cds
          Length = 2782

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 1   aaacaaaaggtaattatgtt 20
           ||||||||||||||||||||
Sbjct: 852 aaacaaaaggtaattatgtt 871

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 164      acgtttgaacacctagatga 183
                ||||||||||||||||||||
Sbjct: 20307253 acgtttgaacacctagatga 20307272

>gb|AC104031.6| Homo sapiens chromosome 11, clone RP11-483L5, complete sequence
          Length = 212779

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 363    aaaaagttttctttgctgta 382
              ||||||||||||||||||||
Sbjct: 189249 aaaaagttttctttgctgta 189268

>gb|AY144442.1| Sorghum bicolor BAC 95A23/98N8.1 Rph region, partial sequence
          Length = 268433

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 195    tttggtgttggcaatgatca 214
              ||||||||||||||||||||
Sbjct: 157676 tttggtgttggcaatgatca 157695

>dbj|BS000021.1| Pan troglodytes chromosome 22 clone:PTB-141K15, map 22, complete
             sequences
          Length = 183533

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 167   tttgaacacctagatgatgatgat 190
             |||||||| |||||||||||||||
Sbjct: 72532 tttgaacaactagatgatgatgat 72509

>emb|AL163210.2|HS21C010 Homo sapiens chromosome 21 segment HS21C010
          Length = 340000

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 167    tttgaacacctagatgatgatgat 190
              |||||||| |||||||||||||||
Sbjct: 141805 tttgaacaactagatgatgatgat 141782

>emb|AL953900.7| Mouse DNA sequence from clone RP24-166A20 on chromosome 2, complete
             sequence
          Length = 131582

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 16    atgttatttccatcaaccaataaa 39
             ||||||||||||||||| ||||||
Sbjct: 79719 atgttatttccatcaacaaataaa 79742

>emb|X58438.1|MMMP4G Mouse MP4 gene for a proline-rich protein
          Length = 3768

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 362  gaaaaagttttctttgctgt 381
            ||||||||||||||||||||
Sbjct: 2088 gaaaaagttttctttgctgt 2069

>emb|AJ010598.1|HS135E14 Homo sapiens chromosome 21 PAC RPCIP704E14135Q2, complete sequence
          Length = 135855

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 167   tttgaacacctagatgatgatgat 190
             |||||||| |||||||||||||||
Sbjct: 12471 tttgaacaactagatgatgatgat 12448


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,755,788
Number of Sequences: 3902068
Number of extensions: 3755788
Number of successful extensions: 70498
Number of sequences better than 10.0: 21
Number of HSP's better than 10.0 without gapping: 21
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 70439
Number of HSP's gapped (non-prelim): 59
length of query: 386
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 364
effective length of database: 17,147,199,772
effective search space: 6241580717008
effective search space used: 6241580717008
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)