>gb|AY657321.1| Synthetic construct Peudomonas aeruginosa clone FLH043437.01F
           PA1870 gene, partial cds
          Length = 426

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 245 acgatggttaccagcataacgtcg 268
           |||||||||||||| |||||||||
Sbjct: 206 acgatggttaccaggataacgtcg 229

>emb|AL157363.9| Human DNA sequence from clone RP11-268K3 on chromosome 13 Contains the 3'
              end of the GPC5 gene for glypican 5, complete sequence
          Length = 164732

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 311    cctaggatgctggtccaaga 330
              ||||||||||||||||||||
Sbjct: 163261 cctaggatgctggtccaaga 163280

>emb|BX530073.9| Zebrafish DNA sequence from clone CH211-201D22 in linkage group 21,
             complete sequence
          Length = 47127

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 128   cacaagtagtgttgcttcag 147
             ||||||||||||||||||||
Sbjct: 20711 cacaagtagtgttgcttcag 20692

>gb|AC091894.2| Homo sapiens chromosome 5 clone RP11-138J23, complete sequence
          Length = 175552

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 122    atactgcacaagtagtgttgcttc 145
              |||||||||| |||||||||||||
Sbjct: 154242 atactgcacatgtagtgttgcttc 154265

>gb|AC010588.8| Homo sapiens chromosome 5 clone CTC-409M18, complete sequence
          Length = 131689

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 122    atactgcacaagtagtgttgcttc 145
              |||||||||| |||||||||||||
Sbjct: 123449 atactgcacatgtagtgttgcttc 123426

>gb|AE004613.1| Pseudomonas aeruginosa PAO1, section 174 of 529 of the complete
            genome
          Length = 20342

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 245  acgatggttaccagcataacgtcg 268
            |||||||||||||| |||||||||
Sbjct: 3990 acgatggttaccaggataacgtcg 4013

>gb|AC154123.9| Mus musculus chromosome 5, clone RP24-324D14, complete sequence
          Length = 175751

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 220    catcctgcctcctgtcaatg 239
              ||||||||||||||||||||
Sbjct: 105908 catcctgcctcctgtcaatg 105889

>gb|AC113082.6| Mus musculus chromosome 9, clone RP23-291C4, complete sequence
          Length = 218087

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 172    tttgcgtgtacctcaaacgttgtc 195
              |||||||||||||||||| |||||
Sbjct: 170000 tttgcgtgtacctcaaacattgtc 169977

>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence
          Length = 2914771

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 352     gtgcgcttgagcgccggatg 371
               ||||||||||||||||||||
Sbjct: 2765221 gtgcgcttgagcgccggatg 2765240

>emb|AL671925.4| Mouse DNA sequence from clone RP23-236O21 on chromosome 4, complete
             sequence
          Length = 218429

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 2     catctgaactaaaacatttc 21
             ||||||||||||||||||||
Sbjct: 80816 catctgaactaaaacatttc 80797


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,076,446
Number of Sequences: 3902068
Number of extensions: 3076446
Number of successful extensions: 51727
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 51703
Number of HSP's gapped (non-prelim): 24
length of query: 417
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 395
effective length of database: 17,147,199,772
effective search space: 6773143909940
effective search space used: 6773143909940
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)