>emb|AL132826.18|HSJ581I13 Human DNA sequence from clone RP4-581I13 on chromosome 20 Contains the
              FLRT3 gene for fibronectin leucine rich transmembrane
              protein 3, complete sequence
          Length = 123695

 Score = 42.1 bits (21), Expect = 0.66
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 41     aatttgttttaacatcacaaa 61
              |||||||||||||||||||||
Sbjct: 110861 aatttgttttaacatcacaaa 110841

>ref|NM_129841.3| Arabidopsis thaliana protein binding AT2G42800 mRNA, complete cds
          Length = 1649

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 6  tcataggttttggtgtaaga 25
          ||||||||||||||||||||
Sbjct: 49 tcataggttttggtgtaaga 30

>gb|AC020606.7| Homo sapiens BAC clone RP11-563O5 from 7, complete sequence
          Length = 151822

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 67     tttttcccatggcattcagagaga 90
              |||||||| |||||||||||||||
Sbjct: 112778 tttttcccctggcattcagagaga 112801

>gb|AC146090.2| Pan troglodytes BAC clone RP43-47O15 from 7, complete sequence
          Length = 189400

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 67    tttttcccatggcattcagagaga 90
             |||||||| |||||||||||||||
Sbjct: 94012 tttttcccctggcattcagagaga 93989

>emb|AL513549.13| Human DNA sequence from clone RP11-424H23 on chromosome 6 Contains part
              of a novel gene (FLJ20342), complete sequence
          Length = 131374

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 149    aaagcaaccactgctgctga 168
              ||||||||||||||||||||
Sbjct: 113695 aaagcaaccactgctgctga 113714

>emb|AL139333.10| Human DNA sequence from clone RP11-536I19 on chromosome 6 Contains the
             3' end of a novel gene, the 5' part of a novel gene
             similar to C21ORF5 (KIAA0933) and a CpG island, complete
             sequence
          Length = 98444

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 39    caaatttgttttaacatcacaaat 62
             ||||| ||||||||||||||||||
Sbjct: 86751 caaatatgttttaacatcacaaat 86774

>gb|AC006931.6| Arabidopsis thaliana chromosome 2 clone F7D19 map m551, complete
             sequence
          Length = 115310

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 6     tcataggttttggtgtaaga 25
             ||||||||||||||||||||
Sbjct: 72204 tcataggttttggtgtaaga 72185

>gb|BT023464.1| Arabidopsis thaliana At2g42800 gene, complete cds
          Length = 1602

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 6  tcataggttttggtgtaaga 25
          ||||||||||||||||||||
Sbjct: 46 tcataggttttggtgtaaga 27

>emb|BX818831.1|CNS0A9RH Arabidopsis thaliana Full-length cDNA Complete sequence from
          clone GSLTFB17ZF11 of Flowers and buds of strain col-0
          of Arabidopsis thaliana (thale cress)
          Length = 1611

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 6  tcataggttttggtgtaaga 25
          ||||||||||||||||||||
Sbjct: 50 tcataggttttggtgtaaga 31

>gb|AC157483.2| Pan troglodytes BAC clone CH251-287G22 from chromosome unknown,
             complete sequence
          Length = 163028

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 67    tttttcccatggcattcagagaga 90
             |||||||| |||||||||||||||
Sbjct: 94022 tttttcccctggcattcagagaga 93999

>dbj|AP005269.1| Pan troglodytes DNA, chromosome 7 clone:PTB-102E09, complete sequence
          Length = 172438

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 67    tttttcccatggcattcagagaga 90
             |||||||| |||||||||||||||
Sbjct: 12943 tttttcccctggcattcagagaga 12920


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,792,260
Number of Sequences: 3902068
Number of extensions: 1792260
Number of successful extensions: 119581
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 119564
Number of HSP's gapped (non-prelim): 17
length of query: 206
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 184
effective length of database: 17,147,199,772
effective search space: 3155084758048
effective search space used: 3155084758048
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)