>gb|AF123535.1| Zea mays alcohol dehydrogenase 1 (adh1) gene, adh1-F allele, complete cds
          Length = 160480

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                    
Query: 235    tcttcgtcttcactcgactcgtcggacctccaccttgacccgcctttgccggct 288
              |||||||||||||| ||||||||||| |||||||||||| | ||||||| ||||
Sbjct: 126539 tcttcgtcttcactagactcgtcggatctccaccttgacacacctttgctggct 126486

>gb|AY691949.1| Zea mays alcohol dehydrogenase 1 (adh1A) gene, complete cds; Fourf
              copia_LTR and Huck gypsy_LTR retrotransposons, complete
              sequence; Opie2 copia_LTR retrotransposon Zeon gypsy_LTR
              and Opie1 copia_LTR retrotransposons, complete sequence; Ji
              copia_LTR retrotransposon, complete sequence; and unknown
              protein (adh1B), cyclin H-1 (adh1C), unknown protein
              (adh1D), hypothetical protein (adh1E), and unknown protein
              (adh1F) genes, complete cds
          Length = 126039

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                    
Query: 235    tcttcgtcttcactcgactcgtcggacctccaccttgacccgcctttgccggct 288
              |||||||||||||| ||||||||||| |||||||||||| | ||||||| ||||
Sbjct: 109870 tcttcgtcttcactagactcgtcggatctccaccttgacacacctttgctggct 109817

>ref|XM_469639.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2196

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                           
Query: 409  ccattttgaccagccccattcccacttaagatgaaaggtttctcagc 455
            |||||||||||||| ||  | ||||||||||||||||||||||||||
Sbjct: 1676 ccattttgaccagcacctgtgccacttaagatgaaaggtttctcagc 1630



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                   
Query: 235  tcttcgtcttcactcgactcgtcggacctccaccttgac 273
            |||||||||||||| ||||| ||||| ||||||||||||
Sbjct: 1847 tcttcgtcttcactagactcatcggatctccaccttgac 1809

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                               
Query: 409      ccattttgaccagccccattcccacttaagatgaaaggtttctcagc 455
                |||||||||||||| ||  | ||||||||||||||||||||||||||
Sbjct: 29924373 ccattttgaccagcacctgtgccacttaagatgaaaggtttctcagc 29924419



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                       
Query: 235      tcttcgtcttcactcgactcgtcggacctccaccttgac 273
                |||||||||||||| ||||| ||||| ||||||||||||
Sbjct: 29923453 tcttcgtcttcactagactcatcggatctccaccttgac 29923491

>gb|AY387483.1| Oryza sativa (japonica cultivar-group) BAC OSJNBa0084L17, complete
             sequence
          Length = 159661

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                            
Query: 409   ccattttgaccagccccattcccacttaagatgaaaggtttctcagc 455
             |||||||||||||| ||  | ||||||||||||||||||||||||||
Sbjct: 86233 ccattttgaccagcacctgtgccacttaagatgaaaggtttctcagc 86187



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                    
Query: 235   tcttcgtcttcactcgactcgtcggacctccaccttgac 273
             |||||||||||||| ||||| ||||| ||||||||||||
Sbjct: 87153 tcttcgtcttcactagactcatcggatctccaccttgac 87115

>gb|AC118133.4| Oryza sativa chromosome 3 BAC OSJNBb0016H12 genomic sequence, complete
             sequence
          Length = 139946

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                            
Query: 409   ccattttgaccagccccattcccacttaagatgaaaggtttctcagc 455
             |||||||||||||| ||  | ||||||||||||||||||||||||||
Sbjct: 90314 ccattttgaccagcacctgtgccacttaagatgaaaggtttctcagc 90360



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                    
Query: 235   tcttcgtcttcactcgactcgtcggacctccaccttgac 273
             |||||||||||||| ||||| ||||| ||||||||||||
Sbjct: 89394 tcttcgtcttcactagactcatcggatctccaccttgac 89432

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                               
Query: 409      ccattttgaccagccccattcccacttaagatgaaaggtttctcagc 455
                |||||||||||||| ||  | ||||||||||||||||||||||||||
Sbjct: 30015795 ccattttgaccagcacctgtgccacttaagatgaaaggtttctcagc 30015841



 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                       
Query: 235      tcttcgtcttcactcgactcgtcggacctccaccttgac 273
                |||||||||||||| ||||| ||||| ||||||||||||
Sbjct: 30014875 tcttcgtcttcactagactcatcggatctccaccttgac 30014913

>gb|AY371488.1| Zea mays clone BAC 276N12-123C01, partial sequence
          Length = 213888

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                          
Query: 241    tcttcactcgactcgtcggacctccaccttgacccgcctttgccggctgctccttcacca 300
              |||||||| ||||| ||||| |||||||||||| | ||||||| |||| || || |||||
Sbjct: 194801 tcttcactagactcatcggatctccaccttgacacacctttgctggcttctgctccacca 194742

                  
Query: 301    actg 304
              ||||
Sbjct: 194741 actg 194738

>gb|AF124045.1| Sorghum bicolor BAC clone 110K5, partial sequence
          Length = 78195

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                   
Query: 235   tcttcgtcttcactcgactcgtcggacctccaccttgacccgcctttgccggct 288
             ||||| |||||||| ||||| || || |||||||||||| | ||||||| ||||
Sbjct: 60174 tcttcatcttcactagactcatcagatctccaccttgacacacctttgctggct 60121



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                              
Query: 407   ggccattttgaccagccccattcccacttaagatgaaaggtttctcagc 455
             |||||||||||||  | ||| | ||| ||||||||||||| ||||||||
Sbjct: 59696 ggccattttgacctacaccagttccatttaagatgaaaggcttctcagc 59648

>gb|AC099705.7| Mus musculus chromosome 1, clone RP23-256I3, complete sequence
          Length = 166683

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 194   gggaagcgttgctctccatgta 215
             ||||||||||||||||||||||
Sbjct: 40133 gggaagcgttgctctccatgta 40154

>ref|XM_990329.1| PREDICTED: Mus musculus EF-hand domain (C-terminal) containing 1,
            transcript variant 1 (Efhc1), mRNA
          Length = 1845

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 194  gggaagcgttgctctccatgta 215
            ||||||||||||||||||||||
Sbjct: 1309 gggaagcgttgctctccatgta 1288

>ref|XM_990358.1| PREDICTED: Mus musculus EF-hand domain (C-terminal) containing 1,
            transcript variant 2 (Efhc1), mRNA
          Length = 2146

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 194  gggaagcgttgctctccatgta 215
            ||||||||||||||||||||||
Sbjct: 1610 gggaagcgttgctctccatgta 1589

>ref|XM_920333.2| PREDICTED: Mus musculus EF-hand domain (C-terminal) containing 1,
            transcript variant 4 (Efhc1), mRNA
          Length = 1845

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 194  gggaagcgttgctctccatgta 215
            ||||||||||||||||||||||
Sbjct: 1309 gggaagcgttgctctccatgta 1288

>ref|XM_907335.2| PREDICTED: Mus musculus EF-hand domain (C-terminal) containing 1,
            transcript variant 3 (Efhc1), mRNA
          Length = 2146

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 194  gggaagcgttgctctccatgta 215
            ||||||||||||||||||||||
Sbjct: 1610 gggaagcgttgctctccatgta 1589

>ref|XM_897162.2| PREDICTED: Mus musculus EF-hand domain (C-terminal) containing 1,
            transcript variant 2 (Efhc1), mRNA
          Length = 1845

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 194  gggaagcgttgctctccatgta 215
            ||||||||||||||||||||||
Sbjct: 1309 gggaagcgttgctctccatgta 1288

>ref|XM_129694.7| PREDICTED: Mus musculus EF-hand domain (C-terminal) containing 1,
            transcript variant 1 (Efhc1), mRNA
          Length = 2146

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 194  gggaagcgttgctctccatgta 215
            ||||||||||||||||||||||
Sbjct: 1610 gggaagcgttgctctccatgta 1589

>gb|AC156980.9| Mus musculus chromosome 1, clone RP23-191A12, complete sequence
          Length = 224673

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 194   gggaagcgttgctctccatgta 215
             ||||||||||||||||||||||
Sbjct: 19381 gggaagcgttgctctccatgta 19402

>dbj|AK006489.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
            library, clone:1700029F22 product:DJ304B14.2.1 (NOVEL
            PROTEIN ISOFORM 1) (FRAGMENT) homolog [Homo sapiens],
            full insert sequence
          Length = 2145

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 194  gggaagcgttgctctccatgta 215
            ||||||||||||||||||||||
Sbjct: 1611 gggaagcgttgctctccatgta 1590

>gb|AC129582.10| Mus musculus chromosome 5, clone RP24-485O24, complete sequence
          Length = 184794

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 11     attctctatctcccttgcat 30
              ||||||||||||||||||||
Sbjct: 153025 attctctatctcccttgcat 153044

>gb|AC139240.4| Mus musculus BAC clone RP24-128J14 from chromosome 18, complete
             sequence
          Length = 173054

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 53    aatatttccaagattatctc 72
             ||||||||||||||||||||
Sbjct: 41154 aatatttccaagattatctc 41135

>gb|U41031.1| Caenorhabditis elegans cosmid C16B8, complete sequence
          Length = 28585

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 4     cttcttcattctctatctcc 23
             ||||||||||||||||||||
Sbjct: 21082 cttcttcattctctatctcc 21063

>emb|AL445217.3| Human DNA sequence from clone RP11-335G18 on chromosome 13 Contains
            the 5' end of the EPSTI1 gene for epithelial stromal
            interaction 1 (breast) and the gene for a DNAJ
            domain-containing protein (MCJ), complete sequence
          Length = 161699

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 6    tcttcattctctatctccct 25
            ||||||||||||||||||||
Sbjct: 5688 tcttcattctctatctccct 5707

>emb|AJ000732.1|ATAJ732 Arabidopsis thaliana ASKalpha gene
          Length = 8645

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 368  tctcacgacgaaatcctgca 387
            ||||||||||||||||||||
Sbjct: 1221 tctcacgacgaaatcctgca 1202

>emb|BX511153.9| Zebrafish DNA sequence from clone DKEYP-66D1 in linkage group 2,
             complete sequence
          Length = 146969

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 340   attggagcttttgtcttctc 359
             ||||||||||||||||||||
Sbjct: 38970 attggagcttttgtcttctc 38989

>gb|AF007270.1|F2P16 Arabidopsis thaliana BAC F2P16, complete sequence
          Length = 110946

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 368  tctcacgacgaaatcctgca 387
            ||||||||||||||||||||
Sbjct: 7483 tctcacgacgaaatcctgca 7502

>emb|AL844883.15| Zebrafish DNA sequence from clone DKEY-3J22 in linkage group 18, complete
              sequence
          Length = 189984

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 92     acacaaattaatgttcacat 111
              ||||||||||||||||||||
Sbjct: 145259 acacaaattaatgttcacat 145240

>gb|AC099636.8| Mus musculus chromosome 19, clone RP24-149H13, complete sequence
          Length = 141121

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 4     cttcttcattctctatctcc 23
             ||||||||||||||||||||
Sbjct: 11474 cttcttcattctctatctcc 11455

>gb|AC124632.11| Mus musculus chromosome 19, clone RP23-445I14, complete sequence
          Length = 178671

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 4     cttcttcattctctatctcc 23
             ||||||||||||||||||||
Sbjct: 96894 cttcttcattctctatctcc 96913

>gb|AE008692.1| Zymomonas mobilis subsp. mobilis ZM4, complete genome
          Length = 2056416

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 152     tgcatcatcttctggataat 171
               ||||||||||||||||||||
Sbjct: 1344972 tgcatcatcttctggataat 1344991

>emb|AL844889.5| Mouse DNA sequence from clone RP23-35D6 on chromosome 2, complete
             sequence
          Length = 112292

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 390   atccgatacctttgtttggccattttga 417
             ||||||||||||| ||||||| ||||||
Sbjct: 39238 atccgatacctttttttggcctttttga 39211

>gb|L23969.1|RHM4HYD Rhizobium leguminosarum biovar viciae 4-hydrobxybenzoate hydroxylase
            (pobA) gene, complete cds
          Length = 2000

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 3    gcttcttcattctctatctccctt 26
            ||||||||||||||| ||||||||
Sbjct: 1900 gcttcttcattctctctctccctt 1877


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,704,448
Number of Sequences: 3902068
Number of extensions: 3704448
Number of successful extensions: 68950
Number of sequences better than 10.0: 31
Number of HSP's better than 10.0 without gapping: 31
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 68842
Number of HSP's gapped (non-prelim): 108
length of query: 455
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 433
effective length of database: 17,147,199,772
effective search space: 7424737501276
effective search space used: 7424737501276
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)