ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl02b09
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_642264.1| Dictyostelium discoideum hypothetical protein (... 46 0.091
2gb|AC079352.5| Homo sapiens BAC clone RP11-915C24 from 2, comple... 44 0.36
3emb|AL136962.19| Human DNA sequence from clone RP11-273F15 on ch... 42 1.4
4gb|AC013473.8| Homo sapiens BAC clone RP11-504G5 from 2, complet... 42 1.4
5emb|BX004964.9| Zebrafish DNA sequence from clone DKEY-7I4, comp... 42 1.4
6gb|AC144849.2| Mus musculus BAC clone RP24-482B19 from chromosom... 40 5.6
7gb|AF546992.1| Acorus gramineus NADH dehydrogenase subunit F (nd... 40 5.6
8emb|AL590652.10| Human DNA sequence from clone RP11-79N23 on chr... 40 5.6
9emb|AL450382.7| Human DNA sequence from clone RP11-56A21 on chro... 40 5.6
10emb|AL031595.4|HS671O14 Human DNA sequence from clone RP4-671O14... 40 5.6
11emb|BX571852.20| Zebrafish DNA sequence from clone DKEY-175N6 in... 40 5.6
12gb|AY007647.2| Acorus calamus NADH dehydrogenase subunit F (ndhF... 40 5.6
13gb|AC005662.3| Arabidopsis thaliana chromosome 2 clone F13H10 ma... 40 5.6
14gb|AC067849.6| Homo sapiens chromosome 8, clone RP11-709L14, com... 40 5.6
15gb|AC011179.9| Homo sapiens, clone RP11-11N24, complete sequence 40 5.6
16gb|AC182111.1| Mus musculus BAC clone RP24-415L2 from chromosome... 40 5.6
17ref|NG_001019.4| Homo sapiens immunoglobulin heavy locus (IGH@) ... 40 5.6
18gb|AC163707.3| Gallus gallus BAC clone CH261-71N11 from chromoso... 40 5.6
19gb|AC149597.4| Mus musculus BAC clone RP24-90B12 from Y, complet... 40 5.6
20emb|AJ879453.1| Acorus calamus chloroplast, complete genome 40 5.6
21gb|AC165336.4| Mus musculus BAC clone RP24-470O8 from chromosome... 40 5.6
22dbj|AB019440.1| Homo sapiens DNA for immunoglobulin heavy-chain ... 40 5.6

>ref|XM_642264.1| Dictyostelium discoideum hypothetical protein (DDB0189592), partial
            mRNA
          Length = 3192

 Score = 46.1 bits (23), Expect = 0.091
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 84   tactactaataatagcaccacct 106
            |||||||||||||||||||||||
Sbjct: 2808 tactactaataatagcaccacct 2830



to top

>gb|AC079352.5| Homo sapiens BAC clone RP11-915C24 from 2, complete sequence
          Length = 158180

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 64     aattccagtcaaaatttcagta 85
              ||||||||||||||||||||||
Sbjct: 148557 aattccagtcaaaatttcagta 148578



to top

>emb|AL136962.19| Human DNA sequence from clone RP11-273F15 on chromosome 13 Contains a
              pseudogene similar to part of NADH dehydrogenase 3 (NADH
              dehydrogenase, subunit 3 (complex I)) (MTND3) and a
              non-metastatic cells 1, protein (NM23A) expressed in
              (NME1)(NM23, NM23-H1) pseudogene, complete sequence
          Length = 165655

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 383    attgtacagcaatcaatacatcaga 407
              ||||||||||||| |||||||||||
Sbjct: 138790 attgtacagcaatgaatacatcaga 138766



to top

>gb|AC013473.8| Homo sapiens BAC clone RP11-504G5 from 2, complete sequence
          Length = 170781

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 63     gaattccagtcaaaatttcag 83
              |||||||||||||||||||||
Sbjct: 151617 gaattccagtcaaaatttcag 151637



to top

>emb|BX004964.9| Zebrafish DNA sequence from clone DKEY-7I4, complete sequence
          Length = 211018

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 94     aatagcaccacctaggggaataatgaaca 122
              ||||||||||||||| |||| ||||||||
Sbjct: 179104 aatagcaccacctagtggaacaatgaaca 179076



to top

>gb|AC144849.2| Mus musculus BAC clone RP24-482B19 from chromosome Y, complete
            sequence
          Length = 184015

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 270  aaaacaacagacctccaaaaaatt 293
            ||||||||||||||| ||||||||
Sbjct: 3351 aaaacaacagacctctaaaaaatt 3374



to top

>gb|AF546992.1| Acorus gramineus NADH dehydrogenase subunit F (ndhF) gene, partial
            cds; chloroplast
          Length = 2089

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 72   tcaaaatttcagtactactaataatagc 99
            |||||||||||||| |||||| ||||||
Sbjct: 1363 tcaaaatttcagtagtactaaaaatagc 1390



to top

>emb|AL590652.10| Human DNA sequence from clone RP11-79N23 on chromosome 6 Contains a
             novel gene, complete sequence
          Length = 111616

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 81    cagtactactaataatagca 100
             ||||||||||||||||||||
Sbjct: 28748 cagtactactaataatagca 28729



to top

>emb|AL450382.7| Human DNA sequence from clone RP11-56A21 on chromosome 10 Contains part
              of gene FLJ10824, a solute carrier family 9
              (sodium/hydrogen exchanger) isoform 5 (SLC9A5) pseudogene,
              the ASAH2 gene for N-acylsphingosine amidohydrolase
              (non-lysosomal ceramidase) 2 and a dynein cytoplasmic
              intermediate polypeptide 2 (DNCI2) pseudogene, complete
              sequence
          Length = 162228

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      aaacaagaacggtattcata 21
              ||||||||||||||||||||
Sbjct: 158045 aaacaagaacggtattcata 158064



to top

>emb|AL031595.4|HS671O14 Human DNA sequence from clone RP4-671O14 on chromosome 22q13.2-13.33,
             complete sequence
          Length = 102739

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 64    aattccagtcaaaatttcag 83
             ||||||||||||||||||||
Sbjct: 63406 aattccagtcaaaatttcag 63387



to top

>emb|BX571852.20| Zebrafish DNA sequence from clone DKEY-175N6 in linkage group 10,
             complete sequence
          Length = 178333

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 269   caaaacaacagacctccaaaaaat 292
             |||||||||||||| |||||||||
Sbjct: 32742 caaaacaacagaccaccaaaaaat 32765



to top

>gb|AY007647.2| Acorus calamus NADH dehydrogenase subunit F (ndhF) gene, partial cds;
            chloroplast gene for chloroplast product
          Length = 2078

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 72   tcaaaatttcagtactactaataatagc 99
            |||||||||||||| |||||| ||||||
Sbjct: 1358 tcaaaatttcagtagtactaaaaatagc 1385



to top

>gb|AC005662.3| Arabidopsis thaliana chromosome 2 clone F13H10 map CIC11C08, complete
             sequence
          Length = 96066

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 78    tttcagtactactaataata 97
             ||||||||||||||||||||
Sbjct: 75259 tttcagtactactaataata 75278



to top

>gb|AC067849.6| Homo sapiens chromosome 8, clone RP11-709L14, complete sequence
          Length = 169453

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 377    atgcaaattgtacagcaatcaata 400
              |||| |||||||||||||||||||
Sbjct: 146630 atgccaattgtacagcaatcaata 146607



to top

>gb|AC011179.9| Homo sapiens, clone RP11-11N24, complete sequence
          Length = 153472

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 377   atgcaaattgtacagcaatcaata 400
             |||| |||||||||||||||||||
Sbjct: 56222 atgccaattgtacagcaatcaata 56245



to top

>gb|AC182111.1| Mus musculus BAC clone RP24-415L2 from chromosome y, complete sequence
          Length = 162320

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 270   aaaacaacagacctccaaaaaatt 293
             ||||||||||||||| ||||||||
Sbjct: 21643 aaaacaacagacctctaaaaaatt 21666



to top

>ref|NG_001019.4| Homo sapiens immunoglobulin heavy locus (IGH@) on chromosome 14
          Length = 1279711

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 26     tacatattgtgcatgcgagaataa 49
              ||||||||||||||| ||||||||
Sbjct: 636462 tacatattgtgcatgtgagaataa 636439



to top

>gb|AC163707.3| Gallus gallus BAC clone CH261-71N11 from chromosome ul, complete
             sequence
          Length = 174599

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 270   aaaacaacagacctccaaaa 289
             ||||||||||||||||||||
Sbjct: 82621 aaaacaacagacctccaaaa 82602



to top

>gb|AC149597.4| Mus musculus BAC clone RP24-90B12 from Y, complete sequence
          Length = 198224

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 270   aaaacaacagacctccaaaaaatt 293
             ||||||||||||||| ||||||||
Sbjct: 13002 aaaacaacagacctctaaaaaatt 12979



to top

>emb|AJ879453.1| Acorus calamus chloroplast, complete genome
          Length = 153821

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 72     tcaaaatttcagtactactaataatagc 99
              |||||||||||||| |||||| ||||||
Sbjct: 110864 tcaaaatttcagtagtactaaaaatagc 110837



to top

>gb|AC165336.4| Mus musculus BAC clone RP24-470O8 from chromosome y, complete sequence
          Length = 153266

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 270   aaaacaacagacctccaaaaaatt 293
             ||||||||||||||| ||||||||
Sbjct: 50297 aaaacaacagacctctaaaaaatt 50320



to top

>dbj|AB019440.1| Homo sapiens DNA for immunoglobulin heavy-chain variable region,
             complete sequence, 4 of 5
          Length = 200000

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 26    tacatattgtgcatgcgagaataa 49
             ||||||||||||||| ||||||||
Sbjct: 36462 tacatattgtgcatgtgagaataa 36439


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,654,743
Number of Sequences: 3902068
Number of extensions: 3654743
Number of successful extensions: 66152
Number of sequences better than 10.0: 22
Number of HSP's better than 10.0 without gapping: 22
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 66107
Number of HSP's gapped (non-prelim): 45
length of query: 417
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 395
effective length of database: 17,147,199,772
effective search space: 6773143909940
effective search space used: 6773143909940
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top