ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl02a05
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY483152.1| Hordeum vulgare putative cellulose synthase catal... 658 0.0
2dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 56 1e-04
3dbj|AP005248.4| Oryza sativa (japonica cultivar-group) genomic D... 56 1e-04
4dbj|AP004298.4| Oryza sativa (japonica cultivar-group) genomic D... 56 1e-04
5dbj|AK121193.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
6dbj|AK073561.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
7dbj|AK071976.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
8dbj|AK067386.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
9dbj|AK062154.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
10gb|AC171105.1| Drosophila melanogaster clone CH223-40I08, comple... 50 0.007
11ref|XM_470347.1| Oryza sativa (japonica cultivar-group), mRNA 50 0.007
12gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 50 0.007
13emb|AL031024.1|DMC196F3 Drosophila melanogaster cosmid clone 196F3 50 0.007
14emb|BX927082.9| Zebrafish DNA sequence from clone DKEY-182O15 in... 50 0.007
15ref|NM_130570.2| Drosophila melanogaster CG32810-RB (CG32810), mRNA 50 0.007
16gb|AY070888.1| Drosophila melanogaster LD45918 full length cDNA 50 0.007
17gb|AY069257.1| Drosophila melanogaster GM03763 full length cDNA 50 0.007
18dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 50 0.007
19gb|AC104487.3| Oryza sativa chromosome 3 BAC OSJNBa0042I09 genom... 50 0.007
20dbj|AK100877.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.007
21dbj|AK060814.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.007
22gb|AE003421.2| Drosophila melanogaster chromosome X, section 5 o... 50 0.007
23gb|AC114585.19| Mus musculus chromosome 14, clone RP23-296J16, c... 48 0.026
24gb|AC158939.9| Mus musculus chromosome 5, clone RP23-204A8, comp... 48 0.026
25gb|AC117690.10| Mus musculus chromosome 16, clone RP23-446I8, co... 48 0.026
26gb|AC124436.5| Mus musculus BAC clone RP24-252O24 from chromosom... 48 0.026
27emb|BX470191.8| Zebrafish DNA sequence from clone CH211-89N7 in ... 48 0.026
28gb|AE014176.1| Mus musculus piebald deletion region section 4 of... 48 0.026
29gb|AC104828.4| Homo sapiens BAC clone RP11-804N11 from 4, comple... 48 0.026
30gb|AC091635.1|AC091635 Drosophila melanogaster, chromosome 2R, r... 48 0.026
31gb|AC008347.2|AC008347 Drosophila melanogaster, chromosome 2R, r... 48 0.026
32gb|AC156024.2| Mus musculus BAC clone RP23-89J1 from chromosome ... 48 0.026
33emb|BX001038.6| Zebrafish DNA sequence from clone CH211-12M10 in... 48 0.026
34gb|AC145419.3| Dasypus novemcinctus clone VMRC5-468K1, complete ... 48 0.026
35gb|AC154420.2| Mus musculus BAC clone RP24-212L9 from 14, comple... 48 0.026
36gb|AE003792.3| Drosophila melanogaster chromosome 2R, section 58... 48 0.026
37gb|AC004250.1|AC004250 Drosophila melanogaster (P1 DS05897 (D171... 48 0.026
38gb|AC147634.3| Mus musculus BAC clone RP23-305G22 from 10, compl... 48 0.026
39gb|AC156987.7| Mus musculus chromosome 7, clone RP23-78K13, comp... 46 0.10
40gb|AC161114.4| Mus musculus BAC clone RP24-338A5 from chromosome... 46 0.10
41dbj|AK078692.1| Mus musculus adult male eyeball cDNA, RIKEN full... 46 0.10
42gb|AC157213.2| Mus musculus BAC clone RP23-157N5 from chromosome... 46 0.10
43emb|AL831746.5| Mouse DNA sequence from clone RP23-67O11 on chro... 46 0.10
44emb|AL035331.1|DMC33C11 Drosophila melanogaster cosmid clone 33C11 46 0.10
45gb|AC139293.4| Mus musculus BAC clone RP24-381N4 from chromosome... 44 0.40
46ref|NM_001030622.1| Gallus gallus kinesin family member 3A (KIF3... 44 0.40
47gb|AC152826.2| Mus musculus BAC clone RP23-111C21 from chromosom... 44 0.40
48ref|XM_414646.1| PREDICTED: Gallus gallus similar to Kinesin-lik... 44 0.40
49gb|AC155728.13| Mus musculus 6 BAC RP24-162H1 (Roswell Park Canc... 44 0.40
50gb|U40427.1| Caenorhabditis elegans cosmid F43C9, complete sequence 44 0.40
51emb|AJ851728.1| Gallus gallus mRNA for hypothetical protein, clo... 44 0.40
52emb|AJ621737.1| Gallus gallus partial KIF3A gene for kinesin-lik... 44 0.40
53emb|CR354750.1| Mus musculus chromosome 6, clone tr151 strain 12... 44 0.40
54gb|DQ099567.1| Taenia pisiformis isolate KAP701 5.8S ribosomal R... 44 0.40
55gb|AC007853.4|AC007853 Drosophila melanogaster, chromosome 3R, r... 44 0.40
56gb|AC008206.10|AC008206 Drosophila melanogaster, chromosome 3R, ... 44 0.40
57gb|AE003750.2| Drosophila melanogaster chromosome 3R, section 88... 44 0.40
58gb|AC171917.14| Mus musculus chromosome 8, clone RP23-390K13, co... 44 0.40
59gb|AC171678.8| Mus musculus chromosome 8, clone RP24-104E12, com... 44 0.40
60gb|AC159985.2| Gallus gallus BAC clone CH261-18F10 from chromoso... 44 0.40
61gb|AF380987.1| Musca domestica microsatellite MdCA224 sequence 42 1.6
62gb|AC002565.1|HUAC002565 Human Chromosome 16 BAC clone CIT987SK-... 42 1.6
63emb|Z81311.1|HSU244G10 Human DNA sequence from clone LL0XNC01-24... 42 1.6
64emb|AL365364.19| Human DNA sequence from clone RP11-624L12 on ch... 42 1.6
65gb|AC171138.2| Helobdella robusta clone CH306-1A9, complete sequ... 42 1.6
66emb|BX004828.21| Zebrafish DNA sequence from clone DKEY-185M8, c... 42 1.6
67gb|AC008731.8| Homo sapiens chromosome 16 clone CTD-2515A14, com... 42 1.6
68gb|AC008331.7|AC008331 Drosophila melanogaster, chromosome 2L, r... 42 1.6
69gb|AC007330.6|AC007330 Drosophila melanogaster, chromosome 2R, r... 42 1.6
70gb|AC007413.5|AC007413 Drosophila melanogaster, chromosome 2R, r... 42 1.6
71gb|AC008939.8| Homo sapiens chromosome 5 clone CTD-2316B1, compl... 42 1.6
72emb|AL928824.13| Zebrafish DNA sequence from clone CH211-105D18 ... 42 1.6
73dbj|AK101178.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.6
74gb|AE003622.4| Drosophila melanogaster chromosome 2L, section 31... 42 1.6
75gb|AE003831.3| Drosophila melanogaster chromosome 2R, section 19... 42 1.6
76emb|AJ418551.1|SAU418551 Sparus aurata satellite DNA, clone SAge... 42 1.6
77emb|AL607066.23| Mouse DNA sequence from clone RP23-406N5 on chr... 42 1.6
78gb|AC110195.14| Mus musculus chromosome 3, clone RP24-291L17, co... 40 6.3
79gb|AC152953.1| Mus musculus 10 BAC RP23-403E19 (Roswell Park Can... 40 6.3
80gb|AC167466.6| Mus musculus chromosome 7, clone RP24-220N8, comp... 40 6.3
81gb|AC132347.4| Mus musculus BAC clone RP24-186F6 from chromosome... 40 6.3
82gb|CP000068.1| Trypanosoma brucei chromosome 5, complete sequence 40 6.3
83gb|AC159441.1| Trypanosoma brucei chromosome 5 clone RPCI93-30F7... 40 6.3
84gb|AC159432.1| Trypanosoma brucei chromosome 5 clone RPCI93-28F8... 40 6.3
85gb|AC007818.8| Drosophila melanogaster clone BACR02M05, complete... 40 6.3
86gb|AC008097.5| Drosophila melanogaster clone BACR20D06, complete... 40 6.3
87gb|AC133874.10| Mus musculus chromosome 19, clone RP23-81N16, co... 40 6.3
88gb|AC008346.6| Drosophila melanogaster clone BACR45K04, complete... 40 6.3
89gb|AY560661.1| Aspergillus fumigatus protein O-D-mannosyltransfe... 40 6.3
90ref|NM_001006386.2| Gallus gallus lipin 2 (LPIN2), mRNA 40 6.3
91ref|NM_017712.2| Homo sapiens pyroglutamyl-peptidase I (PGPEP1),... 40 6.3
92ref|NM_006836.1| Homo sapiens GCN1 general control of amino-acid... 40 6.3
93gb|AC122753.11| Mus musculus chromosome 5, clone RP24-492O4, com... 40 6.3
94gb|AC011738.4| Homo sapiens BAC clone RP11-36H20 from 7, complet... 40 6.3
95ref|XM_749868.1| Aspergillus fumigatus Af293 protein mannosyltra... 40 6.3
96emb|CR318600.13| Zebrafish DNA sequence from clone DKEY-37F13 in... 40 6.3
97gb|AC131792.4| Mus musculus BAC clone RP24-468O15 from chromosom... 40 6.3
98emb|CR536619.20| Zebrafish DNA sequence from clone CH211-194H19 ... 40 6.3
99gb|AC102432.9| Mus musculus chromosome 19, clone RP24-114A21, co... 40 6.3
100gb|AC161413.5| Mus musculus chromosome 19, clone RP23-106D17, co... 40 6.3
101gb|AC142312.1| Pan troglodytes BAC clone RP43-47K13 from 7, comp... 40 6.3
102gb|AC118728.12| Mus musculus chromosome 1, clone RP24-168F13, co... 40 6.3
103emb|BX548003.29| Zebrafish DNA sequence from clone DKEY-97I5 in ... 40 6.3
104emb|AL445473.7| Human DNA sequence from clone RP11-214M7 on chro... 40 6.3
105emb|AL356773.12| Human DNA sequence from clone RP11-44E24 on chr... 40 6.3
106emb|AL356578.22| Human DNA sequence from clone RP11-14G9 on chro... 40 6.3
107gb|AC161506.4| Mus musculus chromosome 3, clone RP24-210J6, comp... 40 6.3
108emb|AL713958.11| Mouse DNA sequence from clone RP23-370F7 on chr... 40 6.3
109emb|AL121806.2|DMBR42I17 Drosophila melanogaster BAC clone BACR4... 40 6.3
110emb|AL672084.10| Mouse DNA sequence from clone RP23-223D13 on ch... 40 6.3
111gb|AC148098.3| Medicago truncatula clone mth2-15b16, complete se... 40 6.3
112gb|AC104410.3| Drosophila melanogaster X BAC RP98-10H22 (Roswell... 40 6.3
113gb|AC150207.2| Medicago truncatula chromosome 2 BAC clone mte1-2... 40 6.3
114gb|AE017340.1| Idiomarina loihiensis L2TR, complete genome 40 6.3
115emb|BX663518.10| Zebrafish DNA sequence from clone CH211-214O7 i... 40 6.3
116gb|AY171066.1|AY171065S2 Dictyostelium discoideum extrachromosom... 40 6.3
117gb|AC159620.2| Mus musculus BAC clone RP24-354K18 from chromosom... 40 6.3
118emb|BX539341.8| Zebrafish DNA sequence from clone DKEY-3P4 in li... 40 6.3
119gb|AC073528.26|AC073528 Homo sapiens 12 BAC RP11-8P16 (Roswell P... 40 6.3
120gb|AC009257.3|AC009257 Drosophila melanogaster, chromosome 2R, r... 40 6.3
121gb|AC008217.5|AC008217 Drosophila melanogaster, chromosome 3R, r... 40 6.3
122gb|AC005639.2|AC005639 Drosophila melanogaster, chromosome 2R, r... 40 6.3
123gb|AC105915.5| Homo sapiens BAC clone RP11-69D13 from 4, complet... 40 6.3
124gb|AC110296.3| Homo sapiens BAC clone RP11-120A1 from 4, complet... 40 6.3
125gb|AC008397.7|AC008397 Homo sapiens chromosome 19 clone CTC-251H... 40 6.3
126gb|AC007009.2|AC007009 Homo sapiens BAC clone RP11-560C1 from 7p... 40 6.3
127gb|AC073907.25| Homo sapiens 12 BAC RP11-202G24 (Roswell Park Ca... 40 6.3
128dbj|AK000215.1| Homo sapiens cDNA FLJ20208 fis, clone COLF1623 40 6.3
129emb|CR847530.19| Zebrafish DNA sequence from clone DKEY-14I17 in... 40 6.3
130gb|AC091266.8| Mus musculus chromosome 1, clone RP23-366C1, comp... 40 6.3
131gb|AE003762.4| Drosophila melanogaster chromosome 3R, section 10... 40 6.3
132gb|AE003794.4| Drosophila melanogaster chromosome 2R, section 56... 40 6.3
133gb|AE003461.3| Drosophila melanogaster chromosome 2R, section 69... 40 6.3
134gb|AE003420.2| Drosophila melanogaster chromosome X, section 4 o... 40 6.3
135emb|BX465834.20| Zebrafish DNA sequence from clone CH211-202E12 ... 40 6.3
136gb|AC004812.1|AC004812 Homo sapiens PAC clone 267D11 from 12, co... 40 6.3
137emb|AL805972.11| Mouse DNA sequence from clone RP23-211P15 on ch... 40 6.3
138emb|AL928975.10| Zebrafish DNA sequence from clone CH211-133N4, ... 40 6.3
139emb|AL928573.14| Zebrafish DNA sequence from clone DKEY-11F5, co... 40 6.3
140emb|AL935285.6| Zebrafish DNA sequence from clone DKEY-37A1, com... 40 6.3
141emb|AL929275.8| Mouse DNA sequence from clone RP23-65P13 on chro... 40 6.3
142gb|AC148014.3| Mus musculus BAC clone RP23-118N15 from 19, compl... 40 6.3
143gb|U20162.1|YSCL9931 Saccharomyces cerevisiae chromosome XII cos... 40 6.3
144gb|L32025.1|MUSSYNI Mouse synapsin I gene, exon 1 40 6.3
145emb|AL671853.7| Mouse DNA sequence from clone RP23-275N2 on chro... 40 6.3
146emb|AL671190.10| Mouse DNA sequence from clone RP23-464L12 on ch... 40 6.3

>gb|AY483152.1| Hordeum vulgare putative cellulose synthase catalytic subunit (CesA2)
            mRNA, complete cds
          Length = 3907

 Score =  658 bits (332), Expect = 0.0
 Identities = 359/367 (97%), Gaps = 7/367 (1%)
 Strand = Plus / Minus

                                                                        
Query: 70   aaatacaagttgtttcgagtttgtacatacataataatacatccttcgggcaatagcata 129
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3827 aaatacaagttgtttcgagtttgtacatacataataatacatccttcgggcaatagcata 3768

                                                                        
Query: 130  cagacgacgacagctctcagtttcggctcacttacatacatttttatcctctccatttaa 189
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3767 cagacgacgacagctctcagtttcggctcacttacatacatttttatcctctccatttaa 3708

                                                                        
Query: 190  atcaaggtcaacaaataaagaattgctggctggctggacaatgaaacaacactggaactg 249
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3707 atcaaggtcaacaaataaagaattgctggctggctggacaatgaaacaacactggaactg 3648

                                                                        
Query: 250  actcactgacttgctggctggctggctgtatttctttcttcttcttcgtggccgaactgc 309
            |||||||||||||||    ||||||||||||||||   ||||||||||||||||||||||
Sbjct: 3647 actcactgacttgct----ggctggctgtatttct---ttcttcttcgtggccgaactgc 3595

                                                                        
Query: 310  acagaggtgaaggggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggc 369
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3594 acagaggtgaaggggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggc 3535

                                                                        
Query: 370  ccagctacccaccatggaacaaaaccaataacttaacacttgttgcatgtttgttttcta 429
            |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 3534 ccagctacccaccatggaacaaaaccaatagcttaacacttgttgcatgtttgttttcta 3475

                   
Query: 430  tctacac 436
            |||||||
Sbjct: 3474 tctacac 3468



 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 50/51 (98%)
 Strand = Plus / Minus

                                                               
Query: 4    tagataaataatgtgcagcttcctctattacaaacggcattcttgccttac 54
            ||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 3891 tagataaataatgtgcagcttcctctattacaaaccgcattcttgccttac 3841



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 62/71 (87%), Gaps = 3/71 (4%)
 Strand = Plus / Plus

                                                                            
Query: 323      ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 382
                |||||||||||||||| || ||||||||||  ||||| |||||||||  ||||| |||||
Sbjct: 13688408 ggttgccgcagcctccggtttgcccaaata--ttgcagatatgaggctgagcta-ccacc 13688464

                           
Query: 383      atggaacaaaa 393
                |||| ||||||
Sbjct: 13688465 atgggacaaaa 13688475



to top

>dbj|AP005248.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OSJNBa0084P08
          Length = 158656

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 62/71 (87%), Gaps = 3/71 (4%)
 Strand = Plus / Plus

                                                                          
Query: 323    ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 382
              |||||||||||||||| || ||||||||||  ||||| |||||||||  ||||| |||||
Sbjct: 156027 ggttgccgcagcctccggtttgcccaaata--ttgcagatatgaggctgagcta-ccacc 156083

                         
Query: 383    atggaacaaaa 393
              |||| ||||||
Sbjct: 156084 atgggacaaaa 156094



to top

>dbj|AP004298.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0409D09
          Length = 150485

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 62/71 (87%), Gaps = 3/71 (4%)
 Strand = Plus / Plus

                                                                         
Query: 323   ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 382
             |||||||||||||||| || ||||||||||  ||||| |||||||||  ||||| |||||
Sbjct: 39400 ggttgccgcagcctccggtttgcccaaata--ttgcagatatgaggctgagcta-ccacc 39456

                        
Query: 383   atggaacaaaa 393
             |||| ||||||
Sbjct: 39457 atgggacaaaa 39467



to top

>dbj|AK121193.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086F23, full
            insert sequence
          Length = 4127

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 62/71 (87%), Gaps = 3/71 (4%)
 Strand = Plus / Minus

                                                                        
Query: 323  ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 382
            |||||||||||||||| || ||||||||||  ||||| |||||||||  ||||| |||||
Sbjct: 3691 ggttgccgcagcctccggtttgcccaaata--ttgcagatatgaggctgagcta-ccacc 3635

                       
Query: 383  atggaacaaaa 393
            |||| ||||||
Sbjct: 3634 atgggacaaaa 3624



to top

>dbj|AK073561.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033042D15, full
            insert sequence
          Length = 4208

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 62/71 (87%), Gaps = 3/71 (4%)
 Strand = Plus / Minus

                                                                        
Query: 323  ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 382
            |||||||||||||||| || ||||||||||  ||||| |||||||||  ||||| |||||
Sbjct: 3773 ggttgccgcagcctccggtttgcccaaata--ttgcagatatgaggctgagcta-ccacc 3717

                       
Query: 383  atggaacaaaa 393
            |||| ||||||
Sbjct: 3716 atgggacaaaa 3706



to top

>dbj|AK071976.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013085H01, full
            insert sequence
          Length = 1867

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 62/71 (87%), Gaps = 3/71 (4%)
 Strand = Plus / Minus

                                                                        
Query: 323  ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 382
            |||||||||||||||| || ||||||||||  ||||| |||||||||  ||||| |||||
Sbjct: 1496 ggttgccgcagcctccggtttgcccaaata--ttgcagatatgaggctgagcta-ccacc 1440

                       
Query: 383  atggaacaaaa 393
            |||| ||||||
Sbjct: 1439 atgggacaaaa 1429



to top

>dbj|AK067386.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013099F14, full
            insert sequence
          Length = 3221

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 62/71 (87%), Gaps = 3/71 (4%)
 Strand = Plus / Minus

                                                                        
Query: 323  ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 382
            |||||||||||||||| || ||||||||||  ||||| |||||||||  ||||| |||||
Sbjct: 2785 ggttgccgcagcctccggtttgcccaaata--ttgcagatatgaggctgagcta-ccacc 2729

                       
Query: 383  atggaacaaaa 393
            |||| ||||||
Sbjct: 2728 atgggacaaaa 2718



to top

>dbj|AK062154.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-045-H11, full
            insert sequence
          Length = 1827

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 62/71 (87%), Gaps = 3/71 (4%)
 Strand = Plus / Minus

                                                                        
Query: 323  ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 382
            |||||||||||||||| || ||||||||||  ||||| |||||||||  ||||| |||||
Sbjct: 1391 ggttgccgcagcctccggtttgcccaaata--ttgcagatatgaggctgagcta-ccacc 1335

                       
Query: 383  atggaacaaaa 393
            |||| ||||||
Sbjct: 1334 atgggacaaaa 1324



to top

>gb|AC171105.1| Drosophila melanogaster clone CH223-40I08, complete sequence
          Length = 53089

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                              
Query: 245   aactgactcactgacttgctggctggctggctg 277
             |||||||| ||||||| ||||||||||||||||
Sbjct: 25576 aactgactgactgactggctggctggctggctg 25608



to top

>ref|XM_470347.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 3905

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                     
Query: 2    gctagataaataatgtgcagcttcctctattacaaacggca 42
            |||| |||||||||||||| ||||||||||| || ||||||
Sbjct: 3692 gctacataaataatgtgcatcttcctctattccagacggca 3652



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 60/71 (84%), Gaps = 4/71 (5%)
 Strand = Plus / Minus

                                                                        
Query: 323  ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 382
            ||||| ||||||||||||| ||| |||   | ||||| |||||||||  ||||||| |||
Sbjct: 3474 ggttgtcgcagcctcccgtttgctcaa---tattgcagatatgaggctgagctacc-acc 3419

                       
Query: 383  atggaacaaaa 393
            |||||||||||
Sbjct: 3418 atggaacaaaa 3408



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                         
Query: 2        gctagataaataatgtgcagcttcctctattacaaacggca 42
                |||| |||||||||||||| ||||||||||| || ||||||
Sbjct: 34879215 gctacataaataatgtgcatcttcctctattccagacggca 34879175



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 60/71 (84%), Gaps = 4/71 (5%)
 Strand = Plus / Minus

                                                                            
Query: 323      ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 382
                ||||| ||||||||||||| ||| |||   | ||||| |||||||||  ||||||| |||
Sbjct: 34878997 ggttgtcgcagcctcccgtttgctcaa---tattgcagatatgaggctgagctacc-acc 34878942

                           
Query: 383      atggaacaaaa 393
                |||||||||||
Sbjct: 34878941 atggaacaaaa 34878931



to top

>emb|AL031024.1|DMC196F3 Drosophila melanogaster cosmid clone 196F3
          Length = 35835

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                              
Query: 245   aactgactcactgacttgctggctggctggctg 277
             |||||||| ||||||| ||||||||||||||||
Sbjct: 14538 aactgactgactgactggctggctggctggctg 14506



to top

>emb|BX927082.9| Zebrafish DNA sequence from clone DKEY-182O15 in linkage group 13,
             complete sequence
          Length = 157140

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 220   tggctggacaatgaaacaacactgg 244
             |||||||||||||||||||||||||
Sbjct: 68862 tggctggacaatgaaacaacactgg 68886



to top

>ref|NM_130570.2| Drosophila melanogaster CG32810-RB (CG32810), mRNA
          Length = 3270

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 245  aactgactcactgacttgctggctggctggctg 277
            |||||||| ||||||| ||||||||||||||||
Sbjct: 1580 aactgactgactgactggctggctggctggctg 1548



to top

>gb|AY070888.1| Drosophila melanogaster LD45918 full length cDNA
          Length = 1862

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 245 aactgactcactgacttgctggctggctggctg 277
           |||||||| ||||||| ||||||||||||||||
Sbjct: 633 aactgactgactgactggctggctggctggctg 601



to top

>gb|AY069257.1| Drosophila melanogaster GM03763 full length cDNA
          Length = 3282

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 245  aactgactcactgacttgctggctggctggctg 277
            |||||||| ||||||| ||||||||||||||||
Sbjct: 1578 aactgactgactgactggctggctggctggctg 1546



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                         
Query: 2        gctagataaataatgtgcagcttcctctattacaaacggca 42
                |||| |||||||||||||| ||||||||||| || ||||||
Sbjct: 34969287 gctacataaataatgtgcatcttcctctattccagacggca 34969247



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 60/71 (84%), Gaps = 4/71 (5%)
 Strand = Plus / Minus

                                                                            
Query: 323      ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 382
                ||||| ||||||||||||| ||| |||   | ||||| |||||||||  ||||||| |||
Sbjct: 34969069 ggttgtcgcagcctcccgtttgctcaa---tattgcagatatgaggctgagctacc-acc 34969014

                           
Query: 383      atggaacaaaa 393
                |||||||||||
Sbjct: 34969013 atggaacaaaa 34969003



to top

>gb|AC104487.3| Oryza sativa chromosome 3 BAC OSJNBa0042I09 genomic sequence, complete
              sequence
          Length = 171376

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                       
Query: 2      gctagataaataatgtgcagcttcctctattacaaacggca 42
              |||| |||||||||||||| ||||||||||| || ||||||
Sbjct: 136265 gctacataaataatgtgcatcttcctctattccagacggca 136305



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 60/71 (84%), Gaps = 4/71 (5%)
 Strand = Plus / Plus

                                                                          
Query: 323    ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 382
              ||||| ||||||||||||| ||| |||   | ||||| |||||||||  ||||||| |||
Sbjct: 136483 ggttgtcgcagcctcccgtttgctcaa---tattgcagatatgaggctgagctacc-acc 136538

                         
Query: 383    atggaacaaaa 393
              |||||||||||
Sbjct: 136539 atggaacaaaa 136549



to top

>dbj|AK100877.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023127C10, full
            insert sequence
          Length = 4029

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                     
Query: 2    gctagataaataatgtgcagcttcctctattacaaacggca 42
            |||| |||||||||||||| ||||||||||| || ||||||
Sbjct: 3862 gctacataaataatgtgcatcttcctctattccagacggca 3822



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 60/71 (84%), Gaps = 4/71 (5%)
 Strand = Plus / Minus

                                                                        
Query: 323  ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 382
            ||||| ||||||||||||| ||| |||   | ||||| |||||||||  ||||||| |||
Sbjct: 3644 ggttgtcgcagcctcccgtttgctcaa---tattgcagatatgaggctgagctacc-acc 3589

                       
Query: 383  atggaacaaaa 393
            |||||||||||
Sbjct: 3588 atggaacaaaa 3578



to top

>dbj|AK060814.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-H07, full
            insert sequence
          Length = 1180

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                     
Query: 2    gctagataaataatgtgcagcttcctctattacaaacggca 42
            |||| |||||||||||||| ||||||||||| || ||||||
Sbjct: 1009 gctacataaataatgtgcatcttcctctattccagacggca 969



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 60/71 (84%), Gaps = 4/71 (5%)
 Strand = Plus / Minus

                                                                       
Query: 323 ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 382
           ||||| ||||||||||||| ||| |||   | ||||| |||||||||  ||||||| |||
Sbjct: 791 ggttgtcgcagcctcccgtttgctcaa---tattgcagatatgaggctgagctacc-acc 736

                      
Query: 383 atggaacaaaa 393
           |||||||||||
Sbjct: 735 atggaacaaaa 725



to top

>gb|AE003421.2| Drosophila melanogaster chromosome X, section 5 of 74 of the complete
             sequence
          Length = 304204

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                              
Query: 245   aactgactcactgacttgctggctggctggctg 277
             |||||||| ||||||| ||||||||||||||||
Sbjct: 55250 aactgactgactgactggctggctggctggctg 55218



to top

>gb|AC114585.19| Mus musculus chromosome 14, clone RP23-296J16, complete sequence
          Length = 192819

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                              
Query: 246    actgactcactgacttgctggctggctggctg 277
              ||||||| ||||||| ||||||||||||||||
Sbjct: 163480 actgactgactgactggctggctggctggctg 163449



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                              
Query: 246    actgactcactgacttgctggctggctggctg 277
              ||||||| ||||||| ||||||||||||||||
Sbjct: 163236 actgactgactgactggctggctggctggctg 163205



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                              
Query: 246    actgactcactgacttgctggctggctggctg 277
              ||||||| ||||||| ||||||||||||||||
Sbjct: 163132 actgactgactgactggctggctggctggctg 163101



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 246    actgactcactgacttgctggctggctggctg 277
              ||||||| |||||||  |||||||||||||||
Sbjct: 163484 actgactgactgactgactggctggctggctg 163453



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 246    actgactcactgacttgctggctggctggctg 277
              ||||||| |||| || ||||||||||||||||
Sbjct: 163476 actgactgactggctggctggctggctggctg 163445



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 246    actgactcactgacttgctggctggctggctg 277
              ||||||| |||||||  |||||||||||||||
Sbjct: 163240 actgactgactgactgactggctggctggctg 163209



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 246    actgactcactgacttgctggctggctggctg 277
              ||||||| |||| || ||||||||||||||||
Sbjct: 163232 actgactgactggctggctggctggctggctg 163201



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 246    actgactcactgacttgctggctggctggctg 277
              ||||||| |||||||  |||||||||||||||
Sbjct: 163136 actgactgactgactgactggctggctggctg 163105



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 246    actgactcactgacttgctggctggctggctg 277
              ||||||| |||| || ||||||||||||||||
Sbjct: 163128 actgactgactggctggctggctggctggctg 163097



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 246    actgactcactgacttgctggctggctggctg 277
              ||||||| ||||||| | ||||||||||||||
Sbjct: 162904 actgactgactgactggttggctggctggctg 162873



to top

>gb|AC158939.9| Mus musculus chromosome 5, clone RP23-204A8, complete sequence
          Length = 218847

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                              
Query: 246    actgactcactgacttgctggctggctggctg 277
              ||||||| ||||||| ||||||||||||||||
Sbjct: 108847 actgactgactgactggctggctggctggctg 108878



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 246    actgactcactgacttgctggctggctggctg 277
              ||||||| |||| || ||||||||||||||||
Sbjct: 108851 actgactgactggctggctggctggctggctg 108882



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 246    actgactcactgacttgctggctggctggctg 277
              ||||||| |||||||  |||||||||||||||
Sbjct: 108843 actgactgactgactgactggctggctggctg 108874



to top

>gb|AC117690.10| Mus musculus chromosome 16, clone RP23-446I8, complete sequence
          Length = 189033

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 262   gctggctggctggctgtatttctttctt 289
             ||||||||||||||||| ||||||||||
Sbjct: 48789 gctggctggctggctgtctttctttctt 48816



to top

>gb|AC124436.5| Mus musculus BAC clone RP24-252O24 from chromosome 10, complete
             sequence
          Length = 174497

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                             
Query: 246   actgactcactgacttgctggctggctggctg 277
             ||||||| ||||||| ||||||||||||||||
Sbjct: 31718 actgactgactgactggctggctggctggctg 31749



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 246   actgactcactgacttgctggctggctggctg 277
             ||||||| |||||||  |||||||||||||||
Sbjct: 31714 actgactgactgactgactggctggctggctg 31745



to top

>emb|BX470191.8| Zebrafish DNA sequence from clone CH211-89N7 in linkage group 7,
             complete sequence
          Length = 181294

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                             
Query: 246   actgactcactgacttgctggctggctggctg 277
             ||||||| ||||||| ||||||||||||||||
Sbjct: 76351 actgactgactgactggctggctggctggctg 76382



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 246   actgactcactgacttgctggctggctggctg 277
             ||||||| |||| || ||||||||||||||||
Sbjct: 76355 actgactgactggctggctggctggctggctg 76386



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 246   actgactcactgacttgctggctggctggctg 277
             ||||||| |||||||  |||||||||||||||
Sbjct: 76347 actgactgactgactgactggctggctggctg 76378



to top

>gb|AE014176.1| Mus musculus piebald deletion region section 4 of 11 of the complete
             sequence
          Length = 395229

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 246   actgactcactgacttgctggctggctggctg 277
             ||||||| ||||||| ||||||||||||||||
Sbjct: 60909 actgactgactgactggctggctggctggctg 60878



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 246   actgactcactgacttgctggctggctggctg 277
             ||||||| ||||||| ||||||||||||||||
Sbjct: 60665 actgactgactgactggctggctggctggctg 60634



 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 246   actgactcactgacttgctggctggctggctg 277
             ||||||| ||||||| ||||||||||||||||
Sbjct: 60561 actgactgactgactggctggctggctggctg 60530



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 246   actgactcactgacttgctggctggctggctg 277
             ||||||| |||||||  |||||||||||||||
Sbjct: 60913 actgactgactgactgactggctggctggctg 60882



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 246   actgactcactgacttgctggctggctggctg 277
             ||||||| |||| || ||||||||||||||||
Sbjct: 60905 actgactgactggctggctggctggctggctg 60874



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 246   actgactcactgacttgctggctggctggctg 277
             ||||||| |||||||  |||||||||||||||
Sbjct: 60669 actgactgactgactgactggctggctggctg 60638



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 246   actgactcactgacttgctggctggctggctg 277
             ||||||| |||| || ||||||||||||||||
Sbjct: 60661 actgactgactggctggctggctggctggctg 60630



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 246   actgactcactgacttgctggctggctggctg 277
             ||||||| |||||||  |||||||||||||||
Sbjct: 60565 actgactgactgactgactggctggctggctg 60534



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 246   actgactcactgacttgctggctggctggctg 277
             ||||||| |||| || ||||||||||||||||
Sbjct: 60557 actgactgactggctggctggctggctggctg 60526



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 246   actgactcactgacttgctggctggctggctg 277
             ||||||| ||||||| | ||||||||||||||
Sbjct: 60333 actgactgactgactggttggctggctggctg 60302



to top

>gb|AC104828.4| Homo sapiens BAC clone RP11-804N11 from 4, complete sequence
          Length = 181489

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 340   gtctgcccaaatattttgcatata 363
             ||||||||||||||||||||||||
Sbjct: 85640 gtctgcccaaatattttgcatata 85617



to top

>gb|AC091635.1|AC091635 Drosophila melanogaster, chromosome 2R, region 56F-57A, BAC clone
              BACR10H12, complete sequence
          Length = 166168

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                              
Query: 246    actgactcactgacttgctggctggctggctg 277
              ||||||| ||||||| ||||||||||||||||
Sbjct: 118827 actgactgactgactggctggctggctggctg 118796



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 246    actgactcactgacttgctggctggctggctg 277
              ||||||| |||||||  |||||||||||||||
Sbjct: 118831 actgactgactgactgactggctggctggctg 118800



to top

>gb|AC008347.2|AC008347 Drosophila melanogaster, chromosome 2R, region 57A-57A, BAC clone
             BACR03N16, complete sequence
          Length = 165519

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 246   actgactcactgacttgctggctggctggctg 277
             ||||||| ||||||| ||||||||||||||||
Sbjct: 12163 actgactgactgactggctggctggctggctg 12132



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 246   actgactcactgacttgctggctggctggctg 277
             ||||||| |||||||  |||||||||||||||
Sbjct: 12167 actgactgactgactgactggctggctggctg 12136



to top

>gb|AC156024.2| Mus musculus BAC clone RP23-89J1 from chromosome 16, complete sequence
          Length = 240451

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 262   gctggctggctggctgtatttctttctt 289
             ||||||||||||||||| ||||||||||
Sbjct: 23055 gctggctggctggctgtctttctttctt 23028



to top

>emb|BX001038.6| Zebrafish DNA sequence from clone CH211-12M10 in linkage group 17,
              complete sequence
          Length = 180659

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                              
Query: 246    actgactcactgacttgctggctggctggctg 277
              ||||||| ||||||| ||||||||||||||||
Sbjct: 118912 actgactgactgactggctggctggctggctg 118943



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 246    actgactcactgacttgctggctggctggctg 277
              ||||||| |||| || ||||||||||||||||
Sbjct: 118916 actgactgactggctggctggctggctggctg 118947



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 246    actgactcactgacttgctggctggctggctg 277
              ||||||| |||||||  |||||||||||||||
Sbjct: 118908 actgactgactgactgactggctggctggctg 118939



to top

>gb|AC145419.3| Dasypus novemcinctus clone VMRC5-468K1, complete sequence
          Length = 151116

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 250   actcactgacttgctggctggctggctg 277
             ||||||| ||||||||||||||||||||
Sbjct: 22113 actcacttacttgctggctggctggctg 22086



to top

>gb|AC154420.2| Mus musculus BAC clone RP24-212L9 from 14, complete sequence
          Length = 159591

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                              
Query: 246    actgactcactgacttgctggctggctggctg 277
              ||||||| ||||||| ||||||||||||||||
Sbjct: 111528 actgactgactgactggctggctggctggctg 111559



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 246    actgactcactgacttgctggctggctggctg 277
              ||||||| |||| || ||||||||||||||||
Sbjct: 111532 actgactgactggctggctggctggctggctg 111563



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 246    actgactcactgacttgctggctggctggctg 277
              ||||||| |||||||  |||||||||||||||
Sbjct: 111524 actgactgactgactgactggctggctggctg 111555



to top

>gb|AE003792.3| Drosophila melanogaster chromosome 2R, section 58 of 73 of the complete
              sequence
          Length = 256764

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                              
Query: 246    actgactcactgacttgctggctggctggctg 277
              ||||||| ||||||| ||||||||||||||||
Sbjct: 173756 actgactgactgactggctggctggctggctg 173725



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 246    actgactcactgacttgctggctggctggctg 277
              ||||||| |||||||  |||||||||||||||
Sbjct: 173760 actgactgactgactgactggctggctggctg 173729



to top

>gb|AC004250.1|AC004250 Drosophila melanogaster (P1 DS05897 (D171)) DNA sequence, complete
             sequence
          Length = 39471

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                             
Query: 246   actgactcactgacttgctggctggctggctg 277
             ||||||| ||||||| ||||||||||||||||
Sbjct: 22475 actgactgactgactggctggctggctggctg 22506



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 246   actgactcactgacttgctggctggctggctg 277
             ||||||| |||||||  |||||||||||||||
Sbjct: 22471 actgactgactgactgactggctggctggctg 22502



to top

>gb|AC147634.3| Mus musculus BAC clone RP23-305G22 from 10, complete sequence
          Length = 207157

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                             
Query: 246   actgactcactgacttgctggctggctggctg 277
             ||||||| ||||||| ||||||||||||||||
Sbjct: 72324 actgactgactgactggctggctggctggctg 72293



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 246   actgactcactgacttgctggctggctggctg 277
             ||||||| |||||||  |||||||||||||||
Sbjct: 72328 actgactgactgactgactggctggctggctg 72297



to top

>gb|AC156987.7| Mus musculus chromosome 7, clone RP23-78K13, complete sequence
          Length = 231140

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                             
Query: 262    gctggctggctggctgtatttctttcttctt 292
              ||||||||||||||| | |||||||||||||
Sbjct: 191787 gctggctggctggctttctttctttcttctt 191817



to top

>gb|AC161114.4| Mus musculus BAC clone RP24-338A5 from chromosome 12, complete sequence
          Length = 220746

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 251    ctcactgacttgctggctggctggctg 277
              |||||||||| ||||||||||||||||
Sbjct: 208459 ctcactgactggctggctggctggctg 208433



to top

>dbj|AK078692.1| Mus musculus adult male eyeball cDNA, RIKEN full-length enriched
            library, clone:7530414M05 product:unclassifiable, full
            insert sequence
          Length = 2291

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 251  ctcactgacttgctggctggctggctg 277
            |||||||||| ||||||||||||||||
Sbjct: 1657 ctcactgactggctggctggctggctg 1631



to top

>gb|AC157213.2| Mus musculus BAC clone RP23-157N5 from chromosome 12, complete sequence
          Length = 211304

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 251   ctcactgacttgctggctggctggctg 277
             |||||||||| ||||||||||||||||
Sbjct: 76446 ctcactgactggctggctggctggctg 76420



to top

>emb|AL831746.5| Mouse DNA sequence from clone RP23-67O11 on chromosome 4, complete
              sequence
          Length = 239570

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                             
Query: 247    ctgactcactgacttgctggctggctggctg 277
              |||||| ||||||| ||||||||||||||||
Sbjct: 145721 ctgactgactgactggctggctggctggctg 145751



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 246    actgactcactgacttgctggctggctggctg 277
              |||||||  |||||| ||||||||||||||||
Sbjct: 145780 actgactggctgactggctggctggctggctg 145811



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 246    actgactcactgacttgctggctggctggctg 277
              ||||||| ||||||| |||| |||||||||||
Sbjct: 145772 actgactgactgactggctgactggctggctg 145803



to top

>emb|AL035331.1|DMC33C11 Drosophila melanogaster cosmid clone 33C11
          Length = 37005

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 247  ctgactcactgacttgctggctggctggctg 277
            |||||| ||||||| ||||||||||||||||
Sbjct: 9591 ctgactgactgactggctggctggctggctg 9561



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 246  actgactcactgacttgctggctggctggctg 277
            ||||||| |||| || ||||||||||||||||
Sbjct: 9588 actgactgactggctggctggctggctggctg 9557



to top

>gb|AC139293.4| Mus musculus BAC clone RP24-381N4 from chromosome 8, complete
            sequence
          Length = 161248

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 263  ctggctggctggctgtatttct 284
            ||||||||||||||||||||||
Sbjct: 4518 ctggctggctggctgtatttct 4497



to top

>ref|NM_001030622.1| Gallus gallus kinesin family member 3A (KIF3A), mRNA
          Length = 4163

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 271  ctggctgtatttctttcttcttcttc 296
            |||||| |||||||||||||||||||
Sbjct: 1421 ctggctttatttctttcttcttcttc 1396



to top

>gb|AC152826.2| Mus musculus BAC clone RP23-111C21 from chromosome 8, complete sequence
          Length = 196497

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 262    gctggctggctggctgtatttctttcttct 291
              ||||||||||||||| | ||||||||||||
Sbjct: 109965 gctggctggctggctttctttctttcttct 109936



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 262    gctggctggctggctgtatttctttctt 289
              ||||||||||||||||  ||||||||||
Sbjct: 109969 gctggctggctggctggctttctttctt 109942



to top

>ref|XM_414646.1| PREDICTED: Gallus gallus similar to Kinesin-like protein KIF3A
           (Microtubule plus end-directed kinesin motor 3A)
           (LOC416331), mRNA
          Length = 1218

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 271 ctggctgtatttctttcttcttcttc 296
           |||||| |||||||||||||||||||
Sbjct: 403 ctggctttatttctttcttcttcttc 378



to top

>gb|AC155728.13| Mus musculus 6 BAC RP24-162H1 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 176377

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 275   ctgtatttctttcttcttcttc 296
             ||||||||||||||||||||||
Sbjct: 83827 ctgtatttctttcttcttcttc 83848



to top

>gb|U40427.1| Caenorhabditis elegans cosmid F43C9, complete sequence
          Length = 34037

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 90    ttgtacatacataataatacat 111
             ||||||||||||||||||||||
Sbjct: 13831 ttgtacatacataataatacat 13810



to top

>emb|AJ851728.1| Gallus gallus mRNA for hypothetical protein, clone 22e2
          Length = 4163

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 271  ctggctgtatttctttcttcttcttc 296
            |||||| |||||||||||||||||||
Sbjct: 1421 ctggctttatttctttcttcttcttc 1396



to top

>emb|AJ621737.1| Gallus gallus partial KIF3A gene for kinesin-like protein KIF3A,
            exons 10-12, BAC bW075D23 clone, contig 3
          Length = 1950

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 271  ctggctgtatttctttcttcttcttc 296
            |||||| |||||||||||||||||||
Sbjct: 1507 ctggctttatttctttcttcttcttc 1532



to top

>emb|CR354750.1| Mus musculus chromosome 6, clone tr151 strain 129/Sv, complete sequence
          Length = 167508

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 275   ctgtatttctttcttcttcttc 296
             ||||||||||||||||||||||
Sbjct: 72367 ctgtatttctttcttcttcttc 72388



to top

>gb|DQ099567.1| Taenia pisiformis isolate KAP701 5.8S ribosomal RNA gene and
           internal transcribed spacer 2, partial sequence
          Length = 404

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 252 tcactgacttgctggctggctggctg 277
           ||||||||| ||||||||||||||||
Sbjct: 89  tcactgactggctggctggctggctg 64



to top

>gb|AC007853.4|AC007853 Drosophila melanogaster, chromosome 3R, region 96B-96C, BAC clone
             BACR03L02, complete sequence
          Length = 162921

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                               
Query: 244   gaactgactcactgacttgctggctggctggctg 277
             ||||||||| |||| || ||||||||||||||||
Sbjct: 41258 gaactgactgactggctggctggctggctggctg 41291



to top

>gb|AC008206.10|AC008206 Drosophila melanogaster, chromosome 3R, region 96B-96B, BAC clone
              BACR03I15, complete sequence
          Length = 181132

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                
Query: 244    gaactgactcactgacttgctggctggctggctg 277
              ||||||||| |||| || ||||||||||||||||
Sbjct: 104590 gaactgactgactggctggctggctggctggctg 104623



to top

>gb|AE003750.2| Drosophila melanogaster chromosome 3R, section 88 of 118 of the
             complete sequence
          Length = 227219

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                               
Query: 244   gaactgactcactgacttgctggctggctggctg 277
             ||||||||| |||| || ||||||||||||||||
Sbjct: 63777 gaactgactgactggctggctggctggctggctg 63810



to top

>gb|AC171917.14| Mus musculus chromosome 8, clone RP23-390K13, complete sequence
          Length = 217234

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 263    ctggctggctggctgtatttct 284
              ||||||||||||||||||||||
Sbjct: 183118 ctggctggctggctgtatttct 183097



to top

>gb|AC171678.8| Mus musculus chromosome 8, clone RP24-104E12, complete sequence
          Length = 175681

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 263   ctggctggctggctgtatttct 284
             ||||||||||||||||||||||
Sbjct: 92049 ctggctggctggctgtatttct 92028



to top

>gb|AC159985.2| Gallus gallus BAC clone CH261-18F10 from chromosome unknown, complete
              sequence
          Length = 211288

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 271    ctggctgtatttctttcttcttcttc 296
              |||||| |||||||||||||||||||
Sbjct: 107749 ctggctttatttctttcttcttcttc 107724



to top

>gb|AF380987.1| Musca domestica microsatellite MdCA224 sequence
          Length = 284

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 257 gacttgctggctggctggctgtatt 281
           |||| ||||||||||||||||||||
Sbjct: 260 gactggctggctggctggctgtatt 284



to top

>gb|AC002565.1|HUAC002565 Human Chromosome 16 BAC clone CIT987SK-A-598D4, complete sequence
          Length = 103911

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 6   gataaataatgtgcagcttcc 26
           |||||||||||||||||||||
Sbjct: 487 gataaataatgtgcagcttcc 467



to top

>emb|Z81311.1|HSU244G10 Human DNA sequence from clone LL0XNC01-244G10 on chromosome Xq26-27.1
             Contains a melanoma antigen, family A, 11 (MAGEA11)
             pseudogene and a tau tubulin kinase pseudogene, complete
             sequence
          Length = 43927

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 276   tgtatttctttcttcttcttc 296
             |||||||||||||||||||||
Sbjct: 12128 tgtatttctttcttcttcttc 12148



to top

>emb|AL365364.19| Human DNA sequence from clone RP11-624L12 on chromosome 10 Contains a
              ribosomal protein L17 (RPL17) pseudogene and the 3'end of
              the FER1L3 gene for fer-1-like 3, myoferlin (C. elegans),
              complete sequence
          Length = 173864

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 276    tgtatttctttcttcttcttc 296
              |||||||||||||||||||||
Sbjct: 153643 tgtatttctttcttcttcttc 153663



to top

>gb|AC171138.2| Helobdella robusta clone CH306-1A9, complete sequence
          Length = 97729

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 249   gactcactgacttgctggctggctggctg 277
             |||| ||||||| ||||||||||||||||
Sbjct: 20061 gactgactgactggctggctggctggctg 20089



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 246   actgactcactgacttgctggctggctggctg 277
             ||||||| |||| || ||||||||||||||||
Sbjct: 20062 actgactgactggctggctggctggctggctg 20093



to top

>emb|BX004828.21| Zebrafish DNA sequence from clone DKEY-185M8, complete sequence
          Length = 161870

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 276    tgtatttctttcttcttcttc 296
              |||||||||||||||||||||
Sbjct: 117680 tgtatttctttcttcttcttc 117700



to top

>gb|AC008731.8| Homo sapiens chromosome 16 clone CTD-2515A14, complete sequence
          Length = 219013

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 6      gataaataatgtgcagcttcc 26
              |||||||||||||||||||||
Sbjct: 188859 gataaataatgtgcagcttcc 188839



to top

>gb|AC008331.7|AC008331 Drosophila melanogaster, chromosome 2L, region 29D-29E, BAC clone
              BACR02B16, complete sequence
          Length = 186938

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 245    aactgactcactgacttgctggctggctg 273
              |||||||| ||||||| ||||||||||||
Sbjct: 139925 aactgactgactgactggctggctggctg 139897



to top

>gb|AC007330.6|AC007330 Drosophila melanogaster, chromosome 2R, region 46C-46D, BAC clone
              BACR30G11, complete sequence
          Length = 166854

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                               
Query: 245    aactgactcactgacttgctggctggctggctg 277
              |||||||| | ||||| ||||||||||||||||
Sbjct: 139290 aactgactgattgactggctggctggctggctg 139258



to top

>gb|AC007413.5|AC007413 Drosophila melanogaster, chromosome 2R, region 46C-46D, BAC clone
             BACR01L01, complete sequence
          Length = 160301

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                              
Query: 245   aactgactcactgacttgctggctggctggctg 277
             |||||||| | ||||| ||||||||||||||||
Sbjct: 94372 aactgactgattgactggctggctggctggctg 94340



to top

>gb|AC008939.8| Homo sapiens chromosome 5 clone CTD-2316B1, complete sequence
          Length = 112755

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 306   ctgcacagaggtgaaggggtt 326
             |||||||||||||||||||||
Sbjct: 72266 ctgcacagaggtgaaggggtt 72286



to top

>emb|AL928824.13| Zebrafish DNA sequence from clone CH211-105D18 in linkage group 6,
             complete sequence
          Length = 189742

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 276   tgtatttctttcttcttcttc 296
             |||||||||||||||||||||
Sbjct: 18694 tgtatttctttcttcttcttc 18674



to top

>dbj|AK101178.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033029A22, full
            insert sequence
          Length = 2325

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 60/71 (84%), Gaps = 4/71 (5%)
 Strand = Plus / Minus

                                                                        
Query: 323  ggttgccgcagcctcccgtctgcccaaatattttgcatatatgaggcccagctacccacc 382
            ||||| ||||||||||||| ||| |||   | ||||| |||||||||  ||||||| |||
Sbjct: 2271 ggttgtcgcagcctcccgtttgctcaa---tattgcagatatgaggctgagctacc-acc 2216

                       
Query: 383  atggaacaaaa 393
            |||||||||||
Sbjct: 2215 atggaacaaaa 2205



to top

>gb|AE003622.4| Drosophila melanogaster chromosome 2L, section 31 of 83 of the complete
             sequence
          Length = 262557

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 245   aactgactcactgacttgctggctggctg 273
             |||||||| ||||||| ||||||||||||
Sbjct: 51603 aactgactgactgactggctggctggctg 51575



to top

>gb|AE003831.3| Drosophila melanogaster chromosome 2R, section 19 of 73 of the complete
             sequence
          Length = 275390

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                              
Query: 245   aactgactcactgacttgctggctggctggctg 277
             |||||||| | ||||| ||||||||||||||||
Sbjct: 80218 aactgactgattgactggctggctggctggctg 80186



to top

>emb|AJ418551.1|SAU418551 Sparus aurata satellite DNA, clone SAgenomic-IMBB09
          Length = 597

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 398 taacttaacacttgttgcatg 418
           |||||||||||||||||||||
Sbjct: 395 taacttaacacttgttgcatg 375



to top

>emb|AL607066.23| Mouse DNA sequence from clone RP23-406N5 on chromosome 4, complete
             sequence
          Length = 194837

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 269   ggctggctgtatttctttctt 289
             |||||||||||||||||||||
Sbjct: 87547 ggctggctgtatttctttctt 87567



to top

>gb|AC110195.14| Mus musculus chromosome 3, clone RP24-291L17, complete sequence
          Length = 171669

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 89    tttgtacatacataataata 108
             ||||||||||||||||||||
Sbjct: 66014 tttgtacatacataataata 66033



to top

>gb|AC152953.1| Mus musculus 10 BAC RP23-403E19 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 211343

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 273   ggctgtatttctttcttcttcttc 296
             |||| |||||||||||||||||||
Sbjct: 35518 ggctttatttctttcttcttcttc 35541



to top

>gb|AC167466.6| Mus musculus chromosome 7, clone RP24-220N8, complete sequence
          Length = 163721

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 265  ggctggctggctgtatttctttct 288
            |||||||||||||| |||||||||
Sbjct: 3005 ggctggctggctgtctttctttct 2982



to top

>gb|AC132347.4| Mus musculus BAC clone RP24-186F6 from chromosome 13, complete sequence
          Length = 155751

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 246   actgactcactgacttgctggctggctg 273
             ||||||| ||||||| ||||||||||||
Sbjct: 36591 actgactgactgactggctggctggctg 36564



to top

>gb|CP000068.1| Trypanosoma brucei chromosome 5, complete sequence
          Length = 1608198

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 279    atttctttcttcttcttcgt 298
              ||||||||||||||||||||
Sbjct: 275051 atttctttcttcttcttcgt 275070



to top

>gb|AC159441.1| Trypanosoma brucei chromosome 5 clone RPCI93-30F7, complete sequence
          Length = 101712

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 279   atttctttcttcttcttcgt 298
             ||||||||||||||||||||
Sbjct: 15092 atttctttcttcttcttcgt 15073



to top

>gb|AC159432.1| Trypanosoma brucei chromosome 5 clone RPCI93-28F8, complete sequence
          Length = 140539

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 279    atttctttcttcttcttcgt 298
              ||||||||||||||||||||
Sbjct: 118475 atttctttcttcttcttcgt 118456



to top

>gb|AC007818.8| Drosophila melanogaster clone BACR02M05, complete sequence
          Length = 188549

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 254   actgacttgctggctggctggctg 277
             ||||||| ||||||||||||||||
Sbjct: 87679 actgactggctggctggctggctg 87656



to top

>gb|AC008097.5| Drosophila melanogaster clone BACR20D06, complete sequence
          Length = 185670

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 246  actgactcactgacttgctggctg 269
            ||||||| ||||||||||||||||
Sbjct: 1216 actgactgactgacttgctggctg 1239



to top

>gb|AC133874.10| Mus musculus chromosome 19, clone RP23-81N16, complete sequence
          Length = 215113

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 265    ggctggctggctgtatttct 284
              ||||||||||||||||||||
Sbjct: 183391 ggctggctggctgtatttct 183372



to top

>gb|AC008346.6| Drosophila melanogaster clone BACR45K04, complete sequence
          Length = 181142

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 246   actgactcactgacttgctggctg 269
             ||||||| ||||||||||||||||
Sbjct: 94605 actgactgactgacttgctggctg 94582



to top

>gb|AY560661.1| Aspergillus fumigatus protein O-D-mannosyltransferase mRNA,
           complete cds
          Length = 2346

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 258 acttgctggctggctggctg 277
           ||||||||||||||||||||
Sbjct: 345 acttgctggctggctggctg 364



to top

>ref|NM_001006386.2| Gallus gallus lipin 2 (LPIN2), mRNA
          Length = 2812

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 276 tgtatttctttcttcttctt 295
           ||||||||||||||||||||
Sbjct: 599 tgtatttctttcttcttctt 580



to top

>ref|NM_017712.2| Homo sapiens pyroglutamyl-peptidase I (PGPEP1), mRNA
          Length = 7084

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 262  gctggctggctggctgtatttctttctt 289
            ||||||||||||||| | ||||||||||
Sbjct: 1202 gctggctggctggctttctttctttctt 1229



to top

>ref|NM_006836.1| Homo sapiens GCN1 general control of amino-acid synthesis 1-like 1
            (yeast) (GCN1L1), mRNA
          Length = 8699

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 317  tgaaggggttgccgcagcct 336
            ||||||||||||||||||||
Sbjct: 1474 tgaaggggttgccgcagcct 1493



to top

>gb|AC122753.11| Mus musculus chromosome 5, clone RP24-492O4, complete sequence
          Length = 183819

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 262   gctggctggctggctgtatttctttctt 289
             ||||||||||||||| | ||||||||||
Sbjct: 64570 gctggctggctggctttctttctttctt 64597



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 262   gctggctggctggctgtatttctttctt 289
             ||||||||||||||||  ||||||||||
Sbjct: 64566 gctggctggctggctggctttctttctt 64593



to top

>gb|AC011738.4| Homo sapiens BAC clone RP11-36H20 from 7, complete sequence
          Length = 141777

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 262    gctggctggctggctgtatttctttctt 289
              ||||||||||||||| | ||||||||||
Sbjct: 100730 gctggctggctggctttctttctttctt 100757



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 262    gctggctggctggctgtatttctttctt 289
              ||||||||||||||||  ||||||||||
Sbjct: 100726 gctggctggctggctggctttctttctt 100753



to top

>ref|XM_749868.1| Aspergillus fumigatus Af293 protein mannosyltransferase 1
           (Afu3g06450) partial mRNA
          Length = 2841

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 258 acttgctggctggctggctg 277
           ||||||||||||||||||||
Sbjct: 345 acttgctggctggctggctg 364



to top

>emb|CR318600.13| Zebrafish DNA sequence from clone DKEY-37F13 in linkage group 7,
           complete sequence
          Length = 257374

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 163 acatacatttttatcctctc 182
           ||||||||||||||||||||
Sbjct: 118 acatacatttttatcctctc 99



to top

>gb|AC131792.4| Mus musculus BAC clone RP24-468O15 from chromosome 19, complete
             sequence
          Length = 162238

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 279   atttctttcttcttcttcgt 298
             ||||||||||||||||||||
Sbjct: 84527 atttctttcttcttcttcgt 84508



to top

>emb|CR536619.20| Zebrafish DNA sequence from clone CH211-194H19 in linkage group 16,
             complete sequence
          Length = 179375

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 276   tgtatttctttcttcttctt 295
             ||||||||||||||||||||
Sbjct: 65060 tgtatttctttcttcttctt 65079



to top

>gb|AC102432.9| Mus musculus chromosome 19, clone RP24-114A21, complete sequence
          Length = 199240

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 265    ggctggctggctgtatttctttct 288
              |||||||||||||| |||||||||
Sbjct: 110624 ggctggctggctgtctttctttct 110647



to top

>gb|AC161413.5| Mus musculus chromosome 19, clone RP23-106D17, complete sequence
          Length = 215356

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 265   ggctggctggctgtatttctttct 288
             |||||||||||||| |||||||||
Sbjct: 20438 ggctggctggctgtctttctttct 20415



to top

>gb|AC142312.1| Pan troglodytes BAC clone RP43-47K13 from 7, complete sequence
          Length = 144713

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 262   gctggctggctggctgtatttctttctt 289
             ||||||||||||||| | ||||||||||
Sbjct: 46831 gctggctggctggctttctttctttctt 46858



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 262   gctggctggctggctgtatttctttctt 289
             ||||||||||||||||  ||||||||||
Sbjct: 46827 gctggctggctggctggctttctttctt 46854



to top

>gb|AC118728.12| Mus musculus chromosome 1, clone RP24-168F13, complete sequence
          Length = 176970

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 254    actgacttgctggctggctggctg 277
              ||||||| ||||||||||||||||
Sbjct: 155621 actgactggctggctggctggctg 155644



to top

>emb|BX548003.29| Zebrafish DNA sequence from clone DKEY-97I5 in linkage group 9,
             complete sequence
          Length = 145468

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 246   actgactcactgacttgctggctggctggctg 277
             ||||||| ||||||| |||| |||||||||||
Sbjct: 93124 actgactgactgactggctgactggctggctg 93093



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 246   actgactcactgacttgctggctggctggctg 277
             ||||||| ||||||| |||| |||||||||||
Sbjct: 92935 actgactgactgactggctgactggctggctg 92904



to top

>emb|AL445473.7| Human DNA sequence from clone RP11-214M7 on chromosome 1 Contains
            part of the RYR2 gene for ryanodine receptor 2 (cardiac),
            complete sequence
          Length = 183549

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 250  actcactgacttgctggctggctg 273
            ||||||| ||||||||||||||||
Sbjct: 1588 actcactcacttgctggctggctg 1611



to top

>emb|AL356773.12| Human DNA sequence from clone RP11-44E24 on chromosome 1 Contains part of
              the RYR2 gene for ryanodine receptor 2 (cardiac), complete
              sequence
          Length = 108625

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 250    actcactgacttgctggctggctg 273
              ||||||| ||||||||||||||||
Sbjct: 108213 actcactcacttgctggctggctg 108236



to top

>emb|AL356578.22| Human DNA sequence from clone RP11-14G9 on chromosome Xq22.3-24,
             complete sequence
          Length = 33432

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 246   actgactcactgacttgctggctggctggctg 277
             |||||||  ||| |||||||||||||||||||
Sbjct: 23299 actgactggctggcttgctggctggctggctg 23330



to top

>gb|AC161506.4| Mus musculus chromosome 3, clone RP24-210J6, complete sequence
          Length = 175241

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 89   tttgtacatacataataata 108
            ||||||||||||||||||||
Sbjct: 7500 tttgtacatacataataata 7481



to top

>emb|AL713958.11| Mouse DNA sequence from clone RP23-370F7 on chromosome 11 Contains the
             5' end of a novel gene, the 3' end of the Cyfip2 gene for
             cytoplasmic FMR1 interacting protein 2 and a CpG island,
             complete sequence
          Length = 105696

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 246   actgactcactgacttgctggctggctggctg 277
             ||||||| ||||||| |||| |||||||||||
Sbjct: 73464 actgactgactgactggctgactggctggctg 73495



to top

>emb|AL121806.2|DMBR42I17 Drosophila melanogaster BAC clone BACR42I17
          Length = 155168

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 246    actgactcactgacttgctggctggctg 273
              ||||||| ||||||| ||||||||||||
Sbjct: 142046 actgactgactgactggctggctggctg 142073



to top

>emb|AL672084.10| Mouse DNA sequence from clone RP23-223D13 on chromosome 11 Contains the
             3' end of the Spred2 gene for sprouty protein with EVH-1
             domain 2, related sequence and a CpG island, complete
             sequence
          Length = 122090

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 262   gctggctggctggctgtatttctttctt 289
             ||||||||||||||| | ||||||||||
Sbjct: 87945 gctggctggctggctttgtttctttctt 87918



to top

>gb|AC148098.3| Medicago truncatula clone mth2-15b16, complete sequence
          Length = 97953

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 401   cttaacacttgttgcatgtt 420
             ||||||||||||||||||||
Sbjct: 25650 cttaacacttgttgcatgtt 25631



to top

>gb|AC104410.3| Drosophila melanogaster X BAC RP98-10H22 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 179869

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 246    actgactcactgacttgctggctggctg 273
              ||||||| ||||||| ||||||||||||
Sbjct: 156885 actgactgactgactggctggctggctg 156912



to top

>gb|AC150207.2| Medicago truncatula chromosome 2 BAC clone mte1-29a5, complete sequence
          Length = 124676

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 401   cttaacacttgttgcatgtt 420
             ||||||||||||||||||||
Sbjct: 36943 cttaacacttgttgcatgtt 36924



to top

>gb|AE017340.1| Idiomarina loihiensis L2TR, complete genome
          Length = 2839318

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 85      cgagtttgtacatacataat 104
               ||||||||||||||||||||
Sbjct: 2174052 cgagtttgtacatacataat 2174071



to top

>emb|BX663518.10| Zebrafish DNA sequence from clone CH211-214O7 in linkage group 7,
              complete sequence
          Length = 200579

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 246    actgactcactgacttgctggctggctg 273
              ||||||| ||||||| ||||||||||||
Sbjct: 108477 actgactgactgactggctggctggctg 108504



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 246    actgactcactgacttgctggctggctggctg 277
              ||||||| |||||||  |||||||||||||||
Sbjct: 108473 actgactgactgactgactggctggctggctg 108504



to top

>gb|AY171066.1|AY171065S2 Dictyostelium discoideum extrachromosomal palindromic ribosomal RNA
             gene sequence, central segment
          Length = 79318

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 254   actgacttgctggctggctggctg 277
             ||||||| ||||||||||||||||
Sbjct: 61872 actgactggctggctggctggctg 61849



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 254   actgacttgctggctggctggctg 277
             ||||||| ||||||||||||||||
Sbjct: 17447 actgactggctggctggctggctg 17470



to top

>gb|AC159620.2| Mus musculus BAC clone RP24-354K18 from chromosome 12, complete
             sequence
          Length = 155161

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 254   actgacttgctggctggctggctg 277
             ||||||| ||||||||||||||||
Sbjct: 71063 actgactggctggctggctggctg 71086



to top

>emb|BX539341.8| Zebrafish DNA sequence from clone DKEY-3P4 in linkage group 22, complete
              sequence
          Length = 236484

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 276    tgtatttctttcttcttctt 295
              ||||||||||||||||||||
Sbjct: 188518 tgtatttctttcttcttctt 188537



to top

>gb|AC073528.26|AC073528 Homo sapiens 12 BAC RP11-8P16 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 167041

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 277    gtatttctttcttcttcttc 296
              ||||||||||||||||||||
Sbjct: 156224 gtatttctttcttcttcttc 156243



to top

>gb|AC009257.3|AC009257 Drosophila melanogaster, chromosome 2R, region 59D-59E, BAC clone
              BACR25I01, complete sequence
          Length = 218565

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 246    actgactcactgacttgctggctggctggctg 277
              ||||||| |||||||  |||||||||||||||
Sbjct: 216904 actgactgactgactgactggctggctggctg 216873



to top

>gb|AC008217.5|AC008217 Drosophila melanogaster, chromosome 3R, region 98B-98B, BAC clone
             BACR10J03, complete sequence
          Length = 193245

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 254   actgacttgctggctggctggctg 277
             ||||||| ||||||||||||||||
Sbjct: 30402 actgactggctggctggctggctg 30379



to top

>gb|AC005639.2|AC005639 Drosophila melanogaster, chromosome 2R, region 59E3-59F4, BAC clone
             BACR48M01, complete sequence
          Length = 188272

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 246   actgactcactgacttgctggctggctggctg 277
             ||||||| |||||||  |||||||||||||||
Sbjct: 72210 actgactgactgactgactggctggctggctg 72179



to top

>gb|AC105915.5| Homo sapiens BAC clone RP11-69D13 from 4, complete sequence
          Length = 178734

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 259   cttgctggctggctggctgt 278
             ||||||||||||||||||||
Sbjct: 38615 cttgctggctggctggctgt 38634



to top

>gb|AC110296.3| Homo sapiens BAC clone RP11-120A1 from 4, complete sequence
          Length = 132626

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 276   tgtatttctttcttcttctt 295
             ||||||||||||||||||||
Sbjct: 80203 tgtatttctttcttcttctt 80222



to top

>gb|AC008397.7|AC008397 Homo sapiens chromosome 19 clone CTC-251H24, complete sequence
          Length = 209519

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 262    gctggctggctggctgtatttctttctt 289
              ||||||||||||||| | ||||||||||
Sbjct: 133375 gctggctggctggctttctttctttctt 133402



to top

>gb|AC007009.2|AC007009 Homo sapiens BAC clone RP11-560C1 from 7p22-p21, complete sequence
          Length = 152523

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 258  acttgctggctggctggctg 277
            ||||||||||||||||||||
Sbjct: 1540 acttgctggctggctggctg 1521



to top

>gb|AC073907.25| Homo sapiens 12 BAC RP11-202G24 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 135245

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 277   gtatttctttcttcttcttc 296
             ||||||||||||||||||||
Sbjct: 78811 gtatttctttcttcttcttc 78792



to top

>dbj|AK000215.1| Homo sapiens cDNA FLJ20208 fis, clone COLF1623
          Length = 2239

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 262  gctggctggctggctgtatttctttctt 289
            ||||||||||||||| | ||||||||||
Sbjct: 1164 gctggctggctggctttctttctttctt 1191



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 262  gctggctggctggctgtatttctttctt 289
            ||||||||||||||||  ||||||||||
Sbjct: 1160 gctggctggctggctggctttctttctt 1187



to top

>emb|CR847530.19| Zebrafish DNA sequence from clone DKEY-14I17 in linkage group 20,
             complete sequence
          Length = 144640

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 275   ctgtatttctttcttcttcttcgt 298
             |||| |||||||||||||||||||
Sbjct: 50604 ctgtttttctttcttcttcttcgt 50581



to top

>gb|AC091266.8| Mus musculus chromosome 1, clone RP23-366C1, complete sequence
          Length = 177529

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 254   actgacttgctggctggctggctg 277
             ||||||| ||||||||||||||||
Sbjct: 66996 actgactggctggctggctggctg 67019



to top

>gb|AE003762.4| Drosophila melanogaster chromosome 3R, section 100 of 118 of the
             complete sequence
          Length = 231486

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 254   actgacttgctggctggctggctg 277
             ||||||| ||||||||||||||||
Sbjct: 60080 actgactggctggctggctggctg 60057



to top

>gb|AE003794.4| Drosophila melanogaster chromosome 2R, section 56 of 73 of the complete
              sequence
          Length = 281805

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 246    actgactcactgacttgctggctg 269
              ||||||| ||||||||||||||||
Sbjct: 225454 actgactgactgacttgctggctg 225477



to top

>gb|AE003461.3| Drosophila melanogaster chromosome 2R, section 69 of 73 of the complete
              sequence
          Length = 598988

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 246    actgactcactgacttgctggctggctggctg 277
              ||||||| |||||||  |||||||||||||||
Sbjct: 105750 actgactgactgactgactggctggctggctg 105719



to top

>gb|AE003420.2| Drosophila melanogaster chromosome X, section 4 of 74 of the complete
             sequence
          Length = 308311

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 246   actgactcactgacttgctggctggctg 273
             ||||||| ||||||| ||||||||||||
Sbjct: 98128 actgactgactgactggctggctggctg 98155



to top

>emb|BX465834.20| Zebrafish DNA sequence from clone CH211-202E12 in linkage group 5,
             complete sequence
          Length = 176520

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 261   tgctggctggctggctgtat 280
             ||||||||||||||||||||
Sbjct: 38839 tgctggctggctggctgtat 38858



to top

>gb|AC004812.1|AC004812 Homo sapiens PAC clone 267D11 from 12, complete sequence
          Length = 138532

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 317    tgaaggggttgccgcagcct 336
              ||||||||||||||||||||
Sbjct: 116279 tgaaggggttgccgcagcct 116260



to top

>emb|AL805972.11| Mouse DNA sequence from clone RP23-211P15 on chromosome 4, complete
              sequence
          Length = 223059

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 214    gctggctggctggacaatga 233
              ||||||||||||||||||||
Sbjct: 152991 gctggctggctggacaatga 152972



to top

>emb|AL928975.10| Zebrafish DNA sequence from clone CH211-133N4, complete sequence
          Length = 174480

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 254    actgacttgctggctggctggctg 277
              ||||||| ||||||||||||||||
Sbjct: 155279 actgactggctggctggctggctg 155302



to top

>emb|AL928573.14| Zebrafish DNA sequence from clone DKEY-11F5, complete sequence
          Length = 244471

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 276   tgtatttctttcttcttctt 295
             ||||||||||||||||||||
Sbjct: 69149 tgtatttctttcttcttctt 69130



to top

>emb|AL935285.6| Zebrafish DNA sequence from clone DKEY-37A1, complete sequence
          Length = 230323

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 246   actgactcactgacttgctggctggctggctg 277
             |||||||  |||||| ||||||||||||||||
Sbjct: 14834 actgactggctgactggctggctggctggctg 14865



to top

>emb|AL929275.8| Mouse DNA sequence from clone RP23-65P13 on chromosome 2, complete
              sequence
          Length = 197356

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 261    tgctggctggctggctgtatttct 284
              |||||||||||||| |||||||||
Sbjct: 174867 tgctggctggctgggtgtatttct 174844



to top

>gb|AC148014.3| Mus musculus BAC clone RP23-118N15 from 19, complete sequence
          Length = 222061

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 279    atttctttcttcttcttcgt 298
              ||||||||||||||||||||
Sbjct: 170898 atttctttcttcttcttcgt 170917



to top

>gb|U20162.1|YSCL9931 Saccharomyces cerevisiae chromosome XII cosmid 9931
          Length = 28149

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 190   atcaaggtcaacaaataaagaatt 213
             ||||||||||||||||| ||||||
Sbjct: 22442 atcaaggtcaacaaatatagaatt 22419



to top

>gb|L32025.1|MUSSYNI Mouse synapsin I gene, exon 1
          Length = 2120

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 254 actgacttgctggctggctggctg 277
           ||||||| ||||||||||||||||
Sbjct: 36  actgactggctggctggctggctg 59



to top

>emb|AL671853.7| Mouse DNA sequence from clone RP23-275N2 on chromosome X, complete
             sequence
          Length = 200224

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 254   actgacttgctggctggctggctg 277
             ||||||| ||||||||||||||||
Sbjct: 11014 actgactggctggctggctggctg 10991



to top

>emb|AL671190.10| Mouse DNA sequence from clone RP23-464L12 on chromosome 4, complete
              sequence
          Length = 180239

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 262    gctggctggctggctgtatttctttctt 289
              ||||||||||||||| | ||||||||||
Sbjct: 118933 gctggctggctggctttctttctttctt 118906


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,572,622
Number of Sequences: 3902068
Number of extensions: 6572622
Number of successful extensions: 159362
Number of sequences better than 10.0: 146
Number of HSP's better than 10.0 without gapping: 145
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 158475
Number of HSP's gapped (non-prelim): 831
length of query: 465
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 443
effective length of database: 17,147,199,772
effective search space: 7596209498996
effective search space used: 7596209498996
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top