>gb|AC090527.3|AC090527 Homo sapiens chromosome 15 clone RP11-96O20 map 15q21.1, complete
             sequence
          Length = 173585

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 285   catggtataatctcatcctcattcagatct 314
             |||||| ||||||||||||| |||||||||
Sbjct: 29343 catggtttaatctcatcctccttcagatct 29372

>emb|AL138787.11| Human DNA sequence from clone RP4-665N4 on chromosome 1p34.1-35.3
             Contains the 3' end of the EIF2C3 gene for eukaryotic
             translation initiation factor 2C, 3, a putative novel
             transcript, a implantation-associated protein
             (DKFZp564K142) processed pseudogene, the TEKT2 gene for
             tektin 2 (testicular), the COL8A2 gene for collagen, type
             VIII, alpha 2, complete sequence
          Length = 128133

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 47    tacaaaaaatgtcaaaattag 67
             |||||||||||||||||||||
Sbjct: 75058 tacaaaaaatgtcaaaattag 75078

>emb|AJ557546.1|MLI557546 Melittangium lichenicola melithiazol gene cluster
          Length = 51855

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 139  gccagcgcgtccccacgggca 159
            |||||||||||||||||||||
Sbjct: 7948 gccagcgcgtccccacgggca 7968

>emb|CT485797.2| Medicago truncatula chromosome 5 clone mth4-11a3, COMPLETE SEQUENCE
          Length = 211224

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 40     tgcaacatacaaaaaatgtcaaaat 64
              ||||||||| |||||||||||||||
Sbjct: 157807 tgcaacatataaaaaatgtcaaaat 157831

>gb|CP000153.1| Thiomicrospira denitrificans ATCC 33889, complete genome
          Length = 2201561

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 46    atacaaaaaatgtcaaaatt 65
             ||||||||||||||||||||
Sbjct: 88329 atacaaaaaatgtcaaaatt 88348

>gb|AC155711.14| Mus musculus 10 BAC RP24-189K8 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 183897

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 160   aaaggatgggcagagaggaa 179
             ||||||||||||||||||||
Sbjct: 10149 aaaggatgggcagagaggaa 10130

>emb|CR974468.5| Pig DNA sequence from clone PigE-178B21 on chromosome 7, complete
             sequence
          Length = 120695

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 274   acattttccaacatggtata 293
             ||||||||||||||||||||
Sbjct: 69335 acattttccaacatggtata 69354

>gb|AC153517.8| Mus musculus 10 BAC RP23-22E18 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 203981

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 160    aaaggatgggcagagaggaa 179
              ||||||||||||||||||||
Sbjct: 103870 aaaggatgggcagagaggaa 103889

>ref|XM_682242.1| PREDICTED: Danio rerio similar to establishment of cohesion 1 homolog
            1 (LOC558949), mRNA
          Length = 2067

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 340  gactgtttttgtcctctttc 359
            ||||||||||||||||||||
Sbjct: 1333 gactgtttttgtcctctttc 1314

>emb|BX088586.8| Zebrafish DNA sequence from clone CH211-200H21 in linkage group 15,
             complete sequence
          Length = 159471

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 44    acatacaaaaaatgtcaaaa 63
             ||||||||||||||||||||
Sbjct: 22619 acatacaaaaaatgtcaaaa 22638

>gb|AC099811.7| Homo sapiens chromosome 17, clone RP11-358B23, complete sequence
          Length = 174902

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 41    gcaacatacaaaaaatgtcaaaattaga 68
             |||||||||||||||| | |||||||||
Sbjct: 81277 gcaacatacaaaaaatttaaaaattaga 81304

>gb|AC150680.7| Monodelphis domestica, clone XX-28D5, complete sequence
          Length = 154058

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 166    tgggcagagaggaactggtg 185
              ||||||||||||||||||||
Sbjct: 131216 tgggcagagaggaactggtg 131197

>dbj|D49696.1|NILIZUMOD Nilaparvata lugens reovirus genome segment S4, complete sequence
            encoding 130KD protein (complete cds)
          Length = 3560

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 35   ttgtttgcaacatacaaaaa 54
            ||||||||||||||||||||
Sbjct: 2409 ttgtttgcaacatacaaaaa 2428

>gb|AC150274.2| Mus musculus BAC clone RP23-348G11 from 18, complete sequence
          Length = 194318

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 245   acttgtgtcttccaaatcta 264
             ||||||||||||||||||||
Sbjct: 62747 acttgtgtcttccaaatcta 62766


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,602,347
Number of Sequences: 3902068
Number of extensions: 3602347
Number of successful extensions: 65551
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 65516
Number of HSP's gapped (non-prelim): 35
length of query: 374
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 352
effective length of database: 17,147,199,772
effective search space: 6035814319744
effective search space used: 6035814319744
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)