ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl01g02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_463541.1| Oryza sativa (japonica cultivar-group), predic... 100 7e-18
2dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 100 7e-18
3dbj|AP003561.2| Oryza sativa (japonica cultivar-group) genomic D... 100 7e-18
4dbj|AK119636.1| Oryza sativa (japonica cultivar-group) cDNA clon... 100 7e-18
5dbj|AK100713.1| Oryza sativa (japonica cultivar-group) cDNA clon... 100 7e-18
6gb|AY596586.1| Saccharum officinarum clone SCCCRZ2002H08, comple... 96 1e-16
7gb|AY104480.1| Zea mays PCO099563 mRNA sequence 76 9e-11
8emb|CT009521.5| M.truncatula DNA sequence from clone MTH2-81E13 ... 62 1e-06
9emb|BX248137.9| Zebrafish DNA sequence from clone DKEY-19L19, co... 44 0.34
10gb|AC169379.4| Sorghum bicolor clone SB_BBc0088B22, complete seq... 44 0.34
11emb|CR940310.6| M.truncatula DNA sequence from clone MTH2-5D8 on... 42 1.3
12gb|AC003119.1|HUAC003119 Human Chromosome 16 BAC clone CIT987SK-... 42 1.3
13gb|AC162794.4| Mus musculus chromosome 3, clone RP24-120B22, com... 42 1.3
14gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 42 1.3
15ref|NM_212200.1| Eremothecium gossypii AFR517Cp (AFR517C), mRNA 42 1.3
16ref|NM_125799.2| Arabidopsis thaliana unknown protein AT5G64030 ... 40 5.2
17gb|AY347745.1| Physcomitrella patens Snf1 related kinase 1 (SNF1... 40 5.2
18emb|CR382370.13| Zebrafish DNA sequence from clone DKEY-22O12 in... 40 5.2
19emb|CR388412.9| Zebrafish DNA sequence from clone CH211-69G13 in... 40 5.2
20emb|AL590240.5| Human DNA sequence from clone RP11-266I3 on chro... 40 5.2
21emb|AL513082.10| Human DNA sequence from clone RP11-229N15 on ch... 40 5.2
22emb|BX908783.8| Zebrafish DNA sequence from clone DKEY-86M2 in l... 40 5.2
23emb|BX323796.14| Zebrafish DNA sequence from clone DKEY-106N21 i... 40 5.2
24emb|BX649627.10| Zebrafish DNA sequence from clone DKEY-78B7 in ... 40 5.2
25emb|BX511176.6| Zebrafish DNA sequence from clone CH211-8C17 in ... 40 5.2
26emb|CR556722.7| Zebrafish DNA sequence from clone CH211-195N12 i... 40 5.2
27gb|AY125524.1| Arabidopsis thaliana AT5g64030/MBM17_13 mRNA, com... 40 5.2
28emb|BX000435.21| Zebrafish DNA sequence from clone DKEY-12L8 in ... 40 5.2
29gb|AC020906.6| Homo sapiens chromosome 19 clone CTB-83J15, compl... 40 5.2
30gb|AC150559.31| Medicago truncatula clone mth2-67j8, complete se... 40 5.2
31emb|AL935031.12| Zebrafish DNA sequence from clone CH211-93I23, ... 40 5.2
32emb|BX640577.17| Zebrafish DNA sequence from clone DKEY-117O14 i... 40 5.2
33gb|AC090573.6| Homo sapiens chromosome 8, clone RP11-440B23, com... 40 5.2
34gb|AC023034.9| Homo sapiens, clone RP11-499F3, complete sequence 40 5.2
35emb|BX833001.1|CNS0A1QZ Arabidopsis thaliana Full-length cDNA Co... 40 5.2
36gb|BT003013.1| Arabidopsis thaliana At5g64030/MBM17_13 gene, com... 40 5.2
37gb|AC008394.3|AC008394 Homo sapiens chromosome 5 clone CTC_242N1... 40 5.2
38emb|BX000536.7| Zebrafish DNA sequence from clone CH211-10C6 in ... 40 5.2
39dbj|AB008266.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 5.2
40dbj|AB025638.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 5.2
41gb|AE001437.1| Clostridium acetobutylicum ATCC 824, complete genome 40 5.2
42emb|BX842613.7| Zebrafish DNA sequence from clone CH211-227J9 in... 40 5.2
43emb|BX004885.4| Zebrafish DNA sequence from clone CH211-103L6, c... 40 5.2
44gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ... 40 5.2
45emb|CR762424.33| Zebrafish DNA sequence from clone RP71-52E8 in ... 40 5.2

>ref|XM_463541.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2421

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 146/178 (82%)
 Strand = Plus / Minus

                                                                        
Query: 211  acatgcttgcttcgatctccttgggccgccacgtggtcttctggacgcaaagcagccctt 270
            |||||||||| ||||||||||||||||||||| ||| ||| ||||| || || || || |
Sbjct: 2419 acatgcttgcctcgatctccttgggccgccacatggacttttggacacatagaagaccct 2360

                                                                        
Query: 271  ccttgcccgtggcgtaggtcatgcgcacctcccactgcagggacttcgccatgccttcga 330
            | || ||| ||| |||||||||||| ||||||||||| || |||||  |||||||||  |
Sbjct: 2359 cgttacccttggtgtaggtcatgcgaacctcccactgaagcgactttaccatgccttgca 2300

                                                                      
Query: 331  gcgctcttattgtctccgcgtcgtcccgcacgatcagtttcccttctggcctcaatat 388
            |  |  |||||||||| || |  |||| ||| ||||| || |||||||||||||||||
Sbjct: 2299 gttcgtttattgtctctgcattatccctcacaatcagctttccttctggcctcaatat 2242



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 146/178 (82%)
 Strand = Plus / Plus

                                                                            
Query: 211      acatgcttgcttcgatctccttgggccgccacgtggtcttctggacgcaaagcagccctt 270
                |||||||||| ||||||||||||||||||||| ||| ||| ||||| || || || || |
Sbjct: 38379953 acatgcttgcctcgatctccttgggccgccacatggacttttggacacatagaagaccct 38380012

                                                                            
Query: 271      ccttgcccgtggcgtaggtcatgcgcacctcccactgcagggacttcgccatgccttcga 330
                | || ||| ||| |||||||||||| ||||||||||| || |||||  |||||||||  |
Sbjct: 38380013 cgttacccttggtgtaggtcatgcgaacctcccactgaagcgactttaccatgccttgca 38380072

                                                                          
Query: 331      gcgctcttattgtctccgcgtcgtcccgcacgatcagtttcccttctggcctcaatat 388
                |  |  |||||||||| || |  |||| ||| ||||| || |||||||||||||||||
Sbjct: 38380073 gttcgtttattgtctctgcattatccctcacaatcagctttccttctggcctcaatat 38380130



to top

>dbj|AP003561.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
              clone:B1065E10
          Length = 183580

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 146/178 (82%)
 Strand = Plus / Plus

                                                                          
Query: 211    acatgcttgcttcgatctccttgggccgccacgtggtcttctggacgcaaagcagccctt 270
              |||||||||| ||||||||||||||||||||| ||| ||| ||||| || || || || |
Sbjct: 140778 acatgcttgcctcgatctccttgggccgccacatggacttttggacacatagaagaccct 140837

                                                                          
Query: 271    ccttgcccgtggcgtaggtcatgcgcacctcccactgcagggacttcgccatgccttcga 330
              | || ||| ||| |||||||||||| ||||||||||| || |||||  |||||||||  |
Sbjct: 140838 cgttacccttggtgtaggtcatgcgaacctcccactgaagcgactttaccatgccttgca 140897

                                                                        
Query: 331    gcgctcttattgtctccgcgtcgtcccgcacgatcagtttcccttctggcctcaatat 388
              |  |  |||||||||| || |  |||| ||| ||||| || |||||||||||||||||
Sbjct: 140898 gttcgtttattgtctctgcattatccctcacaatcagctttccttctggcctcaatat 140955



to top

>dbj|AK119636.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-F03, full
            insert sequence
          Length = 2826

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 146/178 (82%)
 Strand = Plus / Minus

                                                                        
Query: 211  acatgcttgcttcgatctccttgggccgccacgtggtcttctggacgcaaagcagccctt 270
            |||||||||| ||||||||||||||||||||| ||| ||| ||||| || || || || |
Sbjct: 2557 acatgcttgcctcgatctccttgggccgccacatggacttttggacacatagaagaccct 2498

                                                                        
Query: 271  ccttgcccgtggcgtaggtcatgcgcacctcccactgcagggacttcgccatgccttcga 330
            | || ||| ||| |||||||||||| ||||||||||| || |||||  |||||||||  |
Sbjct: 2497 cgttacccttggtgtaggtcatgcgaacctcccactgaagcgactttaccatgccttgca 2438

                                                                      
Query: 331  gcgctcttattgtctccgcgtcgtcccgcacgatcagtttcccttctggcctcaatat 388
            |  |  |||||||||| || |  |||| ||| ||||| || |||||||||||||||||
Sbjct: 2437 gttcgtttattgtctctgcattatccctcacaatcagctttccttctggcctcaatat 2380



to top

>dbj|AK100713.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023115H24, full
            insert sequence
          Length = 2988

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 146/178 (82%)
 Strand = Plus / Minus

                                                                        
Query: 211  acatgcttgcttcgatctccttgggccgccacgtggtcttctggacgcaaagcagccctt 270
            |||||||||| ||||||||||||||||||||| ||| ||| ||||| || || || || |
Sbjct: 2723 acatgcttgcctcgatctccttgggccgccacatggacttttggacacatagaagaccct 2664

                                                                        
Query: 271  ccttgcccgtggcgtaggtcatgcgcacctcccactgcagggacttcgccatgccttcga 330
            | || ||| ||| |||||||||||| ||||||||||| || |||||  |||||||||  |
Sbjct: 2663 cgttacccttggtgtaggtcatgcgaacctcccactgaagcgactttaccatgccttgca 2604

                                                                      
Query: 331  gcgctcttattgtctccgcgtcgtcccgcacgatcagtttcccttctggcctcaatat 388
            |  |  |||||||||| || |  |||| ||| ||||| || |||||||||||||||||
Sbjct: 2603 gttcgtttattgtctctgcattatccctcacaatcagctttccttctggcctcaatat 2546



to top

>gb|AY596586.1| Saccharum officinarum clone SCCCRZ2002H08, complete sequence
          Length = 2841

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 132/160 (82%)
 Strand = Plus / Minus

                                                                        
Query: 228  tccttgggccgccacgtggtcttctggacgcaaagcagcccttccttgcccgtggcgtag 287
            ||||||||||||||| | | ||||| |||||| ||||  || || |||||| ||| ||||
Sbjct: 2581 tccttgggccgccacatcgacttctcgacgcagagcaagccctcgttgcccttggtgtag 2522

                                                                        
Query: 288  gtcatgcgcacctcccactgcagggacttcgccatgccttcgagcgctcttattgtctcc 347
            ||||| ||||||||||||||||||||||| ||||||| ||| ||  |  ||||||| || 
Sbjct: 2521 gtcattcgcacctcccactgcagggacttggccatgctttccagttcatttattgtgtct 2462

                                                    
Query: 348  gcgtcgtcccgcacgatcagtttcccttctggcctcaata 387
            ||   ||||| ||| |||||||| |||| |||||||||||
Sbjct: 2461 gcagtgtccctcacaatcagtttgccttgtggcctcaata 2422



to top

>gb|AY104480.1| Zea mays PCO099563 mRNA sequence
          Length = 2194

 Score = 75.8 bits (38), Expect = 9e-11
 Identities = 80/94 (85%)
 Strand = Plus / Minus

                                                                        
Query: 231  ttgggccgccacgtggtcttctggacgcaaagcagcccttccttgcccgtggcgtaggtc 290
            |||||||||||| | | ||||| |||||| ||||| || ||  ||||| ||| |||||||
Sbjct: 1883 ttgggccgccacatcgacttctcgacgcagagcaggccctcgctgcccttggtgtaggtc 1824

                                              
Query: 291  atgcgcacctcccactgcagggacttcgccatgc 324
            || |||||||||||||||| |||||| |||||||
Sbjct: 1823 atccgcacctcccactgcacggacttggccatgc 1790



to top

>emb|CT009521.5| M.truncatula DNA sequence from clone MTH2-81E13 on chromosome 3,
             complete sequence
          Length = 56728

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 76/91 (83%)
 Strand = Plus / Minus

                                                                         
Query: 226   tctccttgggccgccacgtggtcttctggacgcaaagcagcccttccttgcccgtggcgt 285
             ||||||| |||||||| |||| ||||||||| || | ||  || |||||  || ||| ||
Sbjct: 16453 tctccttaggccgccaggtggacttctggacacataacaaaccctccttatccttggagt 16394

                                            
Query: 286   aggtcatgcgcacctcccactgcagggactt 316
             |||||||||| ||||||||||||| ||||||
Sbjct: 16393 aggtcatgcgaacctcccactgcatggactt 16363



to top

>emb|BX248137.9| Zebrafish DNA sequence from clone DKEY-19L19, complete sequence
          Length = 209896

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 18     cattacattcattttacaacaaatgt 43
              |||| |||||||||||||||||||||
Sbjct: 176545 catttcattcattttacaacaaatgt 176520



to top

>gb|AC169379.4| Sorghum bicolor clone SB_BBc0088B22, complete sequence
          Length = 105215

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 222   tcgatctccttgggccgccacgtggtcttc 251
             ||||||||| ||||||||||||| ||||||
Sbjct: 95322 tcgatctccgtgggccgccacgtcgtcttc 95293



 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 350   gtcgtcccgcacgatcagtttccc 373
             |||||||||||||||||| |||||
Sbjct: 95194 gtcgtcccgcacgatcagcttccc 95171



to top

>emb|CR940310.6| M.truncatula DNA sequence from clone MTH2-5D8 on chromosome 3, complete
             sequence
          Length = 121689

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 73    gaaaaacacatacatgattctacag 97
             ||||||||||| |||||||||||||
Sbjct: 37638 gaaaaacacattcatgattctacag 37614



to top

>gb|AC003119.1|HUAC003119 Human Chromosome 16 BAC clone CIT987SK-27D10, complete sequence
          Length = 88036

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 46    tccaagcaaaagaaagaatga 66
             |||||||||||||||||||||
Sbjct: 23224 tccaagcaaaagaaagaatga 23204



to top

>gb|AC162794.4| Mus musculus chromosome 3, clone RP24-120B22, complete sequence
          Length = 139773

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    aagcaaaagaaagaatgaaag 69
             |||||||||||||||||||||
Sbjct: 81804 aagcaaaagaaagaatgaaag 81784



to top

>gb|AE016819.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VI,
               complete sequence
          Length = 1813164

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 49      aagcaaaagaaagaatgaaaggccgaaaa 77
               ||||||||||||||| |||||||| ||||
Sbjct: 1363005 aagcaaaagaaagaaagaaaggccaaaaa 1362977



to top

>ref|NM_212200.1| Eremothecium gossypii AFR517Cp (AFR517C), mRNA
          Length = 2616

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 49   aagcaaaagaaagaatgaaaggccgaaaa 77
            ||||||||||||||| |||||||| ||||
Sbjct: 1333 aagcaaaagaaagaaagaaaggccaaaaa 1361



to top

>ref|NM_125799.2| Arabidopsis thaliana unknown protein AT5G64030 mRNA, complete cds
          Length = 3031

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                            
Query: 338  tattgtctccgcgtcgtcccgcacgatcagtttcccttctggcctcaa 385
            |||||| ||||| ||||| || || |||||||||||||| || |||||
Sbjct: 2672 tattgtttccgcatcgtctcgaactatcagtttcccttccggtctcaa 2625



to top

>gb|AY347745.1| Physcomitrella patens Snf1 related kinase 1 (SNF1b) gene, complete
            cds
          Length = 5107

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 27   cattttacaacaaatgttgtccaa 50
            |||||||||| |||||||||||||
Sbjct: 2937 cattttacaagaaatgttgtccaa 2914



to top

>emb|CR382370.13| Zebrafish DNA sequence from clone DKEY-22O12 in linkage group 1, complete
              sequence
          Length = 257504

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 7      ttacagtacagcattacatt 26
              ||||||||||||||||||||
Sbjct: 229746 ttacagtacagcattacatt 229765



to top

>emb|CR388412.9| Zebrafish DNA sequence from clone CH211-69G13 in linkage group 5,
             complete sequence
          Length = 158289

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 7     ttacagtacagcattacatt 26
             ||||||||||||||||||||
Sbjct: 45457 ttacagtacagcattacatt 45438



to top

>emb|AL590240.5| Human DNA sequence from clone RP11-266I3 on chromosome X Contains a
            likely ortholog of mouse hepatoma-derived growth factor
            related protein 3 pseudogene (HDGFRP3), a novel protein
            similar to PAGE-5 protein (LOC203569), a novel protein
            similar to PAGE-5 protein (LOC139795), gene FLJ20434, a
            cytochrome c oxidase I (MTCO1) pseudogene, a G antigen,
            family D pseudogene and a CpG island, complete sequence
          Length = 130005

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 49   aagcaaaagaaagaatgaaa 68
            ||||||||||||||||||||
Sbjct: 6596 aagcaaaagaaagaatgaaa 6577



to top

>emb|AL513082.10| Human DNA sequence from clone RP11-229N15 on chromosome Xq24-25 Contains
              a ribosomal protein L3 (RPL3) pseudogene, complete sequence
          Length = 137154

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 47     ccaagcaaaagaaagaatga 66
              ||||||||||||||||||||
Sbjct: 103487 ccaagcaaaagaaagaatga 103468



to top

>emb|BX908783.8| Zebrafish DNA sequence from clone DKEY-86M2 in linkage group 25, complete
              sequence
          Length = 216800

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 7      ttacagtacagcattacatt 26
              ||||||||||||||||||||
Sbjct: 121961 ttacagtacagcattacatt 121980



to top

>emb|BX323796.14| Zebrafish DNA sequence from clone DKEY-106N21 in linkage group 25,
              complete sequence
          Length = 204383

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 7      ttacagtacagcattacatt 26
              ||||||||||||||||||||
Sbjct: 123959 ttacagtacagcattacatt 123940



to top

>emb|BX649627.10| Zebrafish DNA sequence from clone DKEY-78B7 in linkage group 3,
             complete sequence
          Length = 92147

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 7     ttacagtacagcattacatt 26
             ||||||||||||||||||||
Sbjct: 80765 ttacagtacagcattacatt 80746



to top

>emb|BX511176.6| Zebrafish DNA sequence from clone CH211-8C17 in linkage group 3, complete
              sequence
          Length = 116813

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 7      ttacagtacagcattacatt 26
              ||||||||||||||||||||
Sbjct: 103428 ttacagtacagcattacatt 103409



to top

>emb|CR556722.7| Zebrafish DNA sequence from clone CH211-195N12 in linkage group 13,
              complete sequence
          Length = 205873

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 103    caatgcatttgcctttttta 122
              ||||||||||||||||||||
Sbjct: 163844 caatgcatttgcctttttta 163863



to top

>gb|AY125524.1| Arabidopsis thaliana AT5g64030/MBM17_13 mRNA, complete cds
          Length = 2856

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                            
Query: 338  tattgtctccgcgtcgtcccgcacgatcagtttcccttctggcctcaa 385
            |||||| ||||| ||||| || || |||||||||||||| || |||||
Sbjct: 2510 tattgtttccgcatcgtctcgaactatcagtttcccttccggtctcaa 2463



to top

>emb|BX000435.21| Zebrafish DNA sequence from clone DKEY-12L8 in linkage group 1, complete
              sequence
          Length = 201673

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 7      ttacagtacagcattacatt 26
              ||||||||||||||||||||
Sbjct: 153044 ttacagtacagcattacatt 153025



to top

>gb|AC020906.6| Homo sapiens chromosome 19 clone CTB-83J15, complete sequence
          Length = 110184

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 295   gcacctcccactgcagggac 314
             ||||||||||||||||||||
Sbjct: 32046 gcacctcccactgcagggac 32027



to top

>gb|AC150559.31| Medicago truncatula clone mth2-67j8, complete sequence
          Length = 107641

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 114   ccttttttagcatcaacaagaatc 137
             ||||||| ||||||||||||||||
Sbjct: 97690 cctttttcagcatcaacaagaatc 97667



to top

>emb|AL935031.12| Zebrafish DNA sequence from clone CH211-93I23, complete sequence
          Length = 178457

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 103   caatgcatttgcctttttta 122
             ||||||||||||||||||||
Sbjct: 27275 caatgcatttgcctttttta 27294



to top

>emb|BX640577.17| Zebrafish DNA sequence from clone DKEY-117O14 in linkage group 14,
              complete sequence
          Length = 214178

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 7      ttacagtacagcattacatt 26
              ||||||||||||||||||||
Sbjct: 145384 ttacagtacagcattacatt 145403



to top

>gb|AC090573.6| Homo sapiens chromosome 8, clone RP11-440B23, complete sequence
          Length = 204032

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 45     gtccaagcaaaagaaagaat 64
              ||||||||||||||||||||
Sbjct: 107036 gtccaagcaaaagaaagaat 107055



to top

>gb|AC023034.9| Homo sapiens, clone RP11-499F3, complete sequence
          Length = 189732

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 50    agcaaaagaaagaatgaaag 69
             ||||||||||||||||||||
Sbjct: 68582 agcaaaagaaagaatgaaag 68601



to top

>emb|BX833001.1|CNS0A1QZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL29ZA09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 439

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 338 tattgtctccgcgtcgtcccgcacgatcagtttcccttctggcctcaa 385
           |||||| ||||| ||||| || || |||||||||||||| || |||||
Sbjct: 90  tattgtttccgcatcgtctcgaactatcagtttcccttccggtctcaa 43



to top

>gb|BT003013.1| Arabidopsis thaliana At5g64030/MBM17_13 gene, complete cds
          Length = 2490

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                            
Query: 338  tattgtctccgcgtcgtcccgcacgatcagtttcccttctggcctcaa 385
            |||||| ||||| ||||| || || |||||||||||||| || |||||
Sbjct: 2349 tattgtttccgcatcgtctcgaactatcagtttcccttccggtctcaa 2302



to top

>gb|AC008394.3|AC008394 Homo sapiens chromosome 5 clone CTC_242N15, complete sequence
          Length = 171545

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 90     ttctacagctgcacaatgcatttg 113
              |||||||||||||||||| |||||
Sbjct: 157682 ttctacagctgcacaatgtatttg 157659



to top

>emb|BX000536.7| Zebrafish DNA sequence from clone CH211-10C6 in linkage group 7,
             complete sequence
          Length = 199752

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 118   ttttagcatcaacaagaatcatgt 141
             |||| |||||||||||||||||||
Sbjct: 47092 ttttggcatcaacaagaatcatgt 47115



to top

>dbj|AB008266.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MHJ24
          Length = 48622

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                            
Query: 338  tattgtctccgcgtcgtcccgcacgatcagtttcccttctggcctcaa 385
            |||||| ||||| ||||| || || |||||||||||||| || |||||
Sbjct: 1522 tattgtttccgcatcgtctcgaactatcagtttcccttccggtctcaa 1475



to top

>dbj|AB025638.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MWF20
          Length = 91193

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 49    aagcaaaagaaagaatgaaa 68
             ||||||||||||||||||||
Sbjct: 64454 aagcaaaagaaagaatgaaa 64435



to top

>gb|AE001437.1| Clostridium acetobutylicum ATCC 824, complete genome
          Length = 3940880

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 19     attacattcattttacaacaaatg 42
              |||||||||||||||||| |||||
Sbjct: 381838 attacattcattttacaagaaatg 381861



to top

>emb|BX842613.7| Zebrafish DNA sequence from clone CH211-227J9 in linkage group 19,
             complete sequence
          Length = 166128

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 7     ttacagtacagcattacatt 26
             ||||||||||||||||||||
Sbjct: 90961 ttacagtacagcattacatt 90942



to top

>emb|BX004885.4| Zebrafish DNA sequence from clone CH211-103L6, complete sequence
          Length = 187201

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 7     ttacagtacagcattacatt 26
             ||||||||||||||||||||
Sbjct: 39594 ttacagtacagcattacatt 39613



to top

>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 286     aggtcatgcgcacctcccac 305
               ||||||||||||||||||||
Sbjct: 2645279 aggtcatgcgcacctcccac 2645298



to top

>emb|CR762424.33| Zebrafish DNA sequence from clone RP71-52E8 in linkage group 22,
             complete sequence
          Length = 178229

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 7     ttacagtacagcattacatt 26
             ||||||||||||||||||||
Sbjct: 16976 ttacagtacagcattacatt 16995


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,798,565
Number of Sequences: 3902068
Number of extensions: 3798565
Number of successful extensions: 80553
Number of sequences better than 10.0: 45
Number of HSP's better than 10.0 without gapping: 45
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 80421
Number of HSP's gapped (non-prelim): 127
length of query: 392
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 370
effective length of database: 17,147,199,772
effective search space: 6344463915640
effective search space used: 6344463915640
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top