ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl01f12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 220 3e-54
2dbj|AP004087.3| Oryza sativa (japonica cultivar-group) genomic D... 220 3e-54
3ref|NM_128071.2| Arabidopsis thaliana ATP binding / ATPase/ nucl... 70 6e-09
4gb|AY070722.1| Arabidopsis thaliana At2g25140/F13D4.100 mRNA, co... 70 6e-09
5gb|BT002223.1| Arabidopsis thaliana At2g25140/F13D4.100 mRNA, co... 70 6e-09
6gb|AE005674.1| Shigella flexneri 2a str. 301, complete genome 42 1.5
7gb|AE017344.1| Cryptococcus neoformans var. neoformans JEC21 chr... 42 1.5
8ref|XM_570285.1| Cryptococcus neoformans var. neoformans JEC21 c... 42 1.5
9gb|AY327614.1| Cryptococcus bacillisporus strain B4546 superoxid... 42 1.5
10gb|AY327613.1| Cryptococcus bacillisporus strain NIH312 superoxi... 42 1.5
11gb|U00096.2| Escherichia coli K-12 MG1655, complete genome 42 1.5
12dbj|AP009048.1| Escherichia coli W3110 DNA, complete genome 42 1.5
13gb|AC105091.3| Homo sapiens chromosome 8, clone RP11-479P21, com... 42 1.5
14gb|M63654.1|ECOORF123 Escherichia coli P177 (o177), bacterioferr... 42 1.5
15gb|AF248051.1|AF248051 Filobasidiella neoformans var. bacillispo... 42 1.5
16gb|AF248050.1|AF248050 Filobasidiella neoformans var. bacillispo... 42 1.5
17gb|AF248048.1|AF248048 Filobasidiella neoformans var. neoformans... 42 1.5
18gb|AF248047.1|AF248047 Filobasidiella neoformans var. neoformans... 42 1.5
19gb|AE014073.1| Shigella flexneri 2a str. 2457T, complete genome 42 1.5
20gb|AE005174.2| Escherichia coli O157:H7 EDL933, complete genome 42 1.5
21dbj|AB209690.1| Homo sapiens mRNA for ADAM 32 precursor (A disin... 42 1.5
22dbj|BA000007.2| Escherichia coli O157:H7 DNA, complete genome 42 1.5
23gb|CP000034.1| Shigella dysenteriae Sd197, complete genome 42 1.5
24gb|CP000036.1| Shigella boydii Sb227, complete genome 42 1.5
25gb|CP000038.1| Shigella sonnei Ss046, complete genome 42 1.5
26gb|AC130546.4| Mus musculus BAC clone RP24-303D11 from chromosom... 40 5.8
27gb|AC008267.6| Homo sapiens BAC clone GS1-124K5 from 7, complete... 40 5.8
28emb|AL732437.12| Human DNA sequence from clone RP11-116G8 on chr... 40 5.8
29emb|AJ320262.1|AFE320262 Acidithiobacillus ferrooxidans partial ... 40 5.8
30ref|XM_793553.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 5.8
31gb|AC092764.3| Pan troglodytes clone RP43-37J6, complete sequence 40 5.8
32emb|AJ251786.1|ATU251786 Agrobacterium tumefaciens strain C58 pa... 40 5.8
33emb|AJ251785.1|ATU251785 Agrobacterium tumefaciens strain D44 pa... 40 5.8

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score =  220 bits (111), Expect = 3e-54
 Identities = 225/263 (85%)
 Strand = Plus / Plus

                                                                           
Query: 132     tctaacctctgaaggaccagctgcttctttggagcaaagcctttggcaatcgacacagag 191
               ||||||||||| ||||| |||| ||||| |||||||| |||||| || |||| ||| |||
Sbjct: 4567873 tctaacctctggaggacaagcttcttctgtggagcaaggcctttcgcgatcgccacggag 4567932

                                                                           
Query: 192     cttacatccaccacaacggtatcatcctccttgaagtcacccttgaggacagcaagagct 251
               || || || || |  ||||| || || || |||||||| ||||| ||||||   || || 
Sbjct: 4567933 ctcacgtcgacgaggacggtgtcgtcttctttgaagtcgcccttcaggacactgagggcg 4567992

                                                                           
Query: 252     atctcgttctccaccatctgctggatcaccctcttgacaggcctagcaccgtagttaggg 311
               ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 4567993 atctcgttctctaccatctgctggatcaccctcttcacaggcctagcaccgtagttaggg 4568052

                                                                           
Query: 312     tcaaagccaagagcgccgagatgctccacagcttccggtgtgtactgaaggtgaatcttc 371
               |||||||| |||| ||| ||||||||||||||||| ||||||||||| || |||||||||
Sbjct: 4568053 tcaaagccgagagagccaagatgctccacagcttctggtgtgtactgcagatgaatcttc 4568112

                                      
Query: 372     tgttgcagcaaccggtttttgac 394
               ||||||  || |||||| |||||
Sbjct: 4568113 tgttgcctcagccggttcttgac 4568135



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 408     atctccacaatgcgatttatctct 431
               |||||||| |||||||||||||||
Sbjct: 4568284 atctccacgatgcgatttatctct 4568307



to top

>dbj|AP004087.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OJ1297_C09
          Length = 163378

 Score =  220 bits (111), Expect = 3e-54
 Identities = 225/263 (85%)
 Strand = Plus / Plus

                                                                          
Query: 132    tctaacctctgaaggaccagctgcttctttggagcaaagcctttggcaatcgacacagag 191
              ||||||||||| ||||| |||| ||||| |||||||| |||||| || |||| ||| |||
Sbjct: 103252 tctaacctctggaggacaagcttcttctgtggagcaaggcctttcgcgatcgccacggag 103311

                                                                          
Query: 192    cttacatccaccacaacggtatcatcctccttgaagtcacccttgaggacagcaagagct 251
              || || || || |  ||||| || || || |||||||| ||||| ||||||   || || 
Sbjct: 103312 ctcacgtcgacgaggacggtgtcgtcttctttgaagtcgcccttcaggacactgagggcg 103371

                                                                          
Query: 252    atctcgttctccaccatctgctggatcaccctcttgacaggcctagcaccgtagttaggg 311
              ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 103372 atctcgttctctaccatctgctggatcaccctcttcacaggcctagcaccgtagttaggg 103431

                                                                          
Query: 312    tcaaagccaagagcgccgagatgctccacagcttccggtgtgtactgaaggtgaatcttc 371
              |||||||| |||| ||| ||||||||||||||||| ||||||||||| || |||||||||
Sbjct: 103432 tcaaagccgagagagccaagatgctccacagcttctggtgtgtactgcagatgaatcttc 103491

                                     
Query: 372    tgttgcagcaaccggtttttgac 394
              ||||||  || |||||| |||||
Sbjct: 103492 tgttgcctcagccggttcttgac 103514



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 408    atctccacaatgcgatttatctct 431
              |||||||| |||||||||||||||
Sbjct: 103663 atctccacgatgcgatttatctct 103686



to top

>ref|NM_128071.2| Arabidopsis thaliana ATP binding / ATPase/ nucleoside-triphosphatase/
            nucleotide binding / protein binding AT2G25140 mRNA,
            complete cds
          Length = 3223

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                        
Query: 252  atctcgttctccaccatctgctggatcaccctcttgacaggcctagcaccgtagttaggg 311
            ||||| |||||||||||||| || ||||| | ||| || ||||| || ||||||||||||
Sbjct: 2913 atctcattctccaccatctgttgaatcactcgcttcaccggccttgccccgtagttaggg 2854

                       
Query: 312  tcaaagccaag 322
            |||||||||||
Sbjct: 2853 tcaaagccaag 2843



to top

>gb|AY070722.1| Arabidopsis thaliana At2g25140/F13D4.100 mRNA, complete cds
          Length = 3223

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                        
Query: 252  atctcgttctccaccatctgctggatcaccctcttgacaggcctagcaccgtagttaggg 311
            ||||| |||||||||||||| || ||||| | ||| || ||||| || ||||||||||||
Sbjct: 2913 atctcattctccaccatctgttgaatcactcgcttcaccggccttgccccgtagttaggg 2854

                       
Query: 312  tcaaagccaag 322
            |||||||||||
Sbjct: 2853 tcaaagccaag 2843



to top

>gb|BT002223.1| Arabidopsis thaliana At2g25140/F13D4.100 mRNA, complete cds
          Length = 2895

 Score = 69.9 bits (35), Expect = 6e-09
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                        
Query: 252  atctcgttctccaccatctgctggatcaccctcttgacaggcctagcaccgtagttaggg 311
            ||||| |||||||||||||| || ||||| | ||| || ||||| || ||||||||||||
Sbjct: 2759 atctcattctccaccatctgttgaatcactcgcttcaccggccttgccccgtagttaggg 2700

                       
Query: 312  tcaaagccaag 322
            |||||||||||
Sbjct: 2699 tcaaagccaag 2689



to top

>gb|AE005674.1| Shigella flexneri 2a str. 301, complete genome
          Length = 4607203

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 362     gtgaatcttctgttgcagcaa 382
               |||||||||||||||||||||
Sbjct: 2599307 gtgaatcttctgttgcagcaa 2599287



to top

>gb|AE017344.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 4, complete
              sequence
          Length = 1783081

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 226    agtcacccttgaggacagcaa 246
              |||||||||||||||||||||
Sbjct: 417427 agtcacccttgaggacagcaa 417447



to top

>ref|XM_570285.1| Cryptococcus neoformans var. neoformans JEC21 copper zinc
           superoxide dismutase (CND01490) partial mRNA
          Length = 664

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 226 agtcacccttgaggacagcaa 246
           |||||||||||||||||||||
Sbjct: 112 agtcacccttgaggacagcaa 92



to top

>gb|AY327614.1| Cryptococcus bacillisporus strain B4546 superoxide dismutase (SOD1)
           gene, partial cds
          Length = 830

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 226 agtcacccttgaggacagcaa 246
           |||||||||||||||||||||
Sbjct: 183 agtcacccttgaggacagcaa 163



to top

>gb|AY327613.1| Cryptococcus bacillisporus strain NIH312 superoxide dismutase
           (SOD1) gene, partial cds
          Length = 830

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 226 agtcacccttgaggacagcaa 246
           |||||||||||||||||||||
Sbjct: 183 agtcacccttgaggacagcaa 163



to top

>gb|U00096.2| Escherichia coli K-12 MG1655, complete genome
          Length = 4639675

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 362     gtgaatcttctgttgcagcaa 382
               |||||||||||||||||||||
Sbjct: 2609219 gtgaatcttctgttgcagcaa 2609199



to top

>dbj|AP009048.1| Escherichia coli W3110 DNA, complete genome
          Length = 4646332

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 362     gtgaatcttctgttgcagcaa 382
               |||||||||||||||||||||
Sbjct: 2609853 gtgaatcttctgttgcagcaa 2609833



to top

>gb|AC105091.3| Homo sapiens chromosome 8, clone RP11-479P21, complete sequence
          Length = 173888

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 160    ttggagcaaagcctttggcaa 180
              |||||||||||||||||||||
Sbjct: 106545 ttggagcaaagcctttggcaa 106565



to top

>gb|M63654.1|ECOORF123 Escherichia coli P177 (o177), bacterioferritin comigratory protein
             (bcp), putative hydrogenase-4 complex (hyfABCDEFGHIJR),
             and putative formate transporter (focB) gene, complete cds
             and putative permease P75 (perM) gene partial cds
          Length = 15115

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 362   gtgaatcttctgttgcagcaa 382
             |||||||||||||||||||||
Sbjct: 11264 gtgaatcttctgttgcagcaa 11244



to top

>gb|AF248051.1|AF248051 Filobasidiella neoformans var. bacillispora WM 780-C copper zinc
           superoxide dismutase (SOD1) gene, complete cds
          Length = 1138

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 226 agtcacccttgaggacagcaa 246
           |||||||||||||||||||||
Sbjct: 398 agtcacccttgaggacagcaa 378



to top

>gb|AF248050.1|AF248050 Filobasidiella neoformans var. bacillispora NYS 155B copper zinc
           superoxide dismutase (SOD1) gene, complete cds
          Length = 1824

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 226 agtcacccttgaggacagcaa 246
           |||||||||||||||||||||
Sbjct: 907 agtcacccttgaggacagcaa 887



to top

>gb|AF248048.1|AF248048 Filobasidiella neoformans var. neoformans B-3501 copper zinc
           superoxide dismutase (SOD1) gene, complete cds
          Length = 1915

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 226 agtcacccttgaggacagcaa 246
           |||||||||||||||||||||
Sbjct: 868 agtcacccttgaggacagcaa 848



to top

>gb|AF248047.1|AF248047 Filobasidiella neoformans var. neoformans B-3501 copper zinc
           superoxide dismutase (SOD1) mRNA, complete cds
          Length = 681

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 226 agtcacccttgaggacagcaa 246
           |||||||||||||||||||||
Sbjct: 121 agtcacccttgaggacagcaa 101



to top

>gb|AE014073.1| Shigella flexneri 2a str. 2457T, complete genome
          Length = 4599354

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 362     gtgaatcttctgttgcagcaa 382
               |||||||||||||||||||||
Sbjct: 2577440 gtgaatcttctgttgcagcaa 2577420



to top

>gb|AE005174.2| Escherichia coli O157:H7 EDL933, complete genome
          Length = 5528445

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 362     gtgaatcttctgttgcagcaa 382
               |||||||||||||||||||||
Sbjct: 3397174 gtgaatcttctgttgcagcaa 3397154



to top

>dbj|AB209690.1| Homo sapiens mRNA for ADAM 32 precursor (A disintegrin and
            metalloprotease domain 32) variant protein
          Length = 6873

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 160  ttggagcaaagcctttggcaa 180
            |||||||||||||||||||||
Sbjct: 5288 ttggagcaaagcctttggcaa 5308



to top

>dbj|BA000007.2| Escherichia coli O157:H7 DNA, complete genome
          Length = 5498450

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 362     gtgaatcttctgttgcagcaa 382
               |||||||||||||||||||||
Sbjct: 3327340 gtgaatcttctgttgcagcaa 3327320



to top

>gb|CP000034.1| Shigella dysenteriae Sd197, complete genome
          Length = 4369232

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 362     gtgaatcttctgttgcagcaa 382
               |||||||||||||||||||||
Sbjct: 2470834 gtgaatcttctgttgcagcaa 2470814



to top

>gb|CP000036.1| Shigella boydii Sb227, complete genome
          Length = 4519823

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 362     gtgaatcttctgttgcagcaa 382
               |||||||||||||||||||||
Sbjct: 2504853 gtgaatcttctgttgcagcaa 2504833



to top

>gb|CP000038.1| Shigella sonnei Ss046, complete genome
          Length = 4825265

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 362     gtgaatcttctgttgcagcaa 382
               |||||||||||||||||||||
Sbjct: 2713291 gtgaatcttctgttgcagcaa 2713271



to top

>gb|AC130546.4| Mus musculus BAC clone RP24-303D11 from chromosome 3, complete sequence
          Length = 171125

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 396   cgatccagctgtatctccacaatg 419
             |||| |||||||||||||||||||
Sbjct: 71292 cgatgcagctgtatctccacaatg 71315



to top

>gb|AC008267.6| Homo sapiens BAC clone GS1-124K5 from 7, complete sequence
          Length = 196954

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 260   ctccaccatctgctggatca 279
             ||||||||||||||||||||
Sbjct: 24679 ctccaccatctgctggatca 24660



to top

>emb|AL732437.12| Human DNA sequence from clone RP11-116G8 on chromosome 10 Contains the
             NET1 gene for neuroepithelial cell transforming gene 1,
             the gene for calmodulin-like skin protein (CLSP), the
             CALML3 gene for calmodulin-like 3 (CLP) and four CpG
             islands, complete sequence
          Length = 183441

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 10    caactcccattcatgcatttcctg 33
             |||||||||||| |||||||||||
Sbjct: 90008 caactcccattcctgcatttcctg 90031



to top

>emb|AJ320262.1|AFE320262 Acidithiobacillus ferrooxidans partial petC2 gene for putative
            cytochrome c1 and hip gene for putative high-redox
            potential iron-sulfur protein (HiPIP)
          Length = 1615

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 386  gtttttgacccgatccagct 405
            ||||||||||||||||||||
Sbjct: 1600 gtttttgacccgatccagct 1581



to top

>ref|XM_793553.1| PREDICTED: Strongylocentrotus purpuratus similar to protein
           tyrosine phosphatase, non-receptor type 4 (LOC594103),
           mRNA
          Length = 1803

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 318 ccaagagcgccgagatgctc 337
           ||||||||||||||||||||
Sbjct: 437 ccaagagcgccgagatgctc 456



to top

>gb|AC092764.3| Pan troglodytes clone RP43-37J6, complete sequence
          Length = 172761

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 260    ctccaccatctgctggatca 279
              ||||||||||||||||||||
Sbjct: 113136 ctccaccatctgctggatca 113155



to top

>emb|AJ251786.1|ATU251786 Agrobacterium tumefaciens strain C58 partial vppa gene for putative
           proton-translocating inorganic pyrophosphatase (isoform
           II)
          Length = 567

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 164 agcaaagcctttggcaatcg 183
           ||||||||||||||||||||
Sbjct: 108 agcaaagcctttggcaatcg 89



to top

>emb|AJ251785.1|ATU251785 Agrobacterium tumefaciens strain D44 partial vppa gene for putative
           proton-translocating inorganic pyrophosphatase (isoform
           II)
          Length = 567

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 164 agcaaagcctttggcaatcg 183
           ||||||||||||||||||||
Sbjct: 108 agcaaagcctttggcaatcg 89


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,178,283
Number of Sequences: 3902068
Number of extensions: 3178283
Number of successful extensions: 57369
Number of sequences better than 10.0: 33
Number of HSP's better than 10.0 without gapping: 33
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 57107
Number of HSP's gapped (non-prelim): 260
length of query: 431
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 409
effective length of database: 17,147,199,772
effective search space: 7013204706748
effective search space used: 7013204706748
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top