>dbj|AP003151.1| Mus musculus genomic DNA, chromosome 16q clone:RP21-340N5, complete
             sequences
          Length = 160143

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 15    ctgctttatttcactggggcat 36
             ||||||||||||||||||||||
Sbjct: 41129 ctgctttatttcactggggcat 41150

>gb|AC173208.2| Mus musculus BAC clone RP24-335A2 from chromosome 16, complete sequence
          Length = 234813

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 15     ctgctttatttcactggggcat 36
              ||||||||||||||||||||||
Sbjct: 186759 ctgctttatttcactggggcat 186780

>gb|AC131337.16| Mus musculus chromosome 15, clone RP23-480E1, complete sequence
          Length = 190303

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 32     ggcatatgctcacacaaacat 52
              |||||||||||||||||||||
Sbjct: 118081 ggcatatgctcacacaaacat 118101

>gb|AC161597.7| Mus musculus BAC clone RP23-387P23 from chromosome 6, complete sequence
          Length = 218586

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 34     catatgctcacacaaacata 53
              ||||||||||||||||||||
Sbjct: 216294 catatgctcacacaaacata 216275

>gb|AC169385.2| Mus musculus BAC clone RP23-247C1 from chromosome 16, complete sequence
          Length = 206814

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 42     cacacaaacatactagctca 61
              ||||||||||||||||||||
Sbjct: 168744 cacacaaacatactagctca 168725

>gb|AC134553.5| Mus musculus BAC clone RP24-280H19 from chromosome 12, complete sequence
          Length = 168895

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 35     atatgctcacacaaacatac 54
              ||||||||||||||||||||
Sbjct: 168150 atatgctcacacaaacatac 168131

>gb|AC007567.2| Homo sapiens BAC clone CTB-36G2 from 7, complete sequence
          Length = 187413

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 11    ctgcctgctttatttcactg 30
             ||||||||||||||||||||
Sbjct: 57705 ctgcctgctttatttcactg 57724

>emb|AL606500.8| Human DNA sequence from clone RP11-274N19 on chromosome 1 Contains the
             3' end of the KCNN3 gene for potassium intermediate/small
             conductance calcium-activated channel, subfamily N, member
             3, a novel gene and the 5' end of the ADAR gene for
             adenosine deaminase, RNA-specific, complete sequence
          Length = 173014

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 104   aatggttactctagattaca 123
             ||||||||||||||||||||
Sbjct: 52579 aatggttactctagattaca 52560

>gb|AC023745.3| Drosophila melanogaster X BAC RP98-26N1 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 179312

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 71    accaaaaaacactctactct 90
             ||||||||||||||||||||
Sbjct: 47680 accaaaaaacactctactct 47699

>gb|BC028978.1| Homo sapiens, clone IMAGE:3919084, mRNA
          Length = 2625

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 271 gccagaaaggaaatcagctg 290
           ||||||||||||||||||||
Sbjct: 842 gccagaaaggaaatcagctg 861

>gb|AC091430.3| Homo sapiens chromosome 5 clone CTD-2207A17, complete sequence
          Length = 84143

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 271   gccagaaaggaaatcagctg 290
             ||||||||||||||||||||
Sbjct: 66693 gccagaaaggaaatcagctg 66712

>gb|AF172277.1|AF172277 Homo sapiens 7q31 clones RP11-267O17 and RP11-256L2 including NRCAM and
             LAMB1R genes, complete sequence
          Length = 227054

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 11    ctgcctgctttatttcactg 30
             ||||||||||||||||||||
Sbjct: 25950 ctgcctgctttatttcactg 25931

>gb|AC154606.2| Mus musculus BAC clone RP23-252E10 from chromosome 16, complete
             sequence
          Length = 181697

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 42    cacacaaacatactagctca 61
             ||||||||||||||||||||
Sbjct: 69602 cacacaaacatactagctca 69583

>gb|AC121565.4| Mus musculus BAC clone RP23-223J11 from chromosome 6, complete sequence
          Length = 170000

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 34     catatgctcacacaaacata 53
              ||||||||||||||||||||
Sbjct: 106035 catatgctcacacaaacata 106054

>gb|AC140442.4| Mus musculus BAC clone RP24-106P1 from 12, complete sequence
          Length = 153574

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 35     atatgctcacacaaacatac 54
              ||||||||||||||||||||
Sbjct: 105867 atatgctcacacaaacatac 105886

>gb|AE003484.3| Drosophila melanogaster chromosome X, section 36 of 74 of the complete
              sequence
          Length = 314111

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 71     accaaaaaacactctactct 90
              ||||||||||||||||||||
Sbjct: 102731 accaaaaaacactctactct 102750

>dbj|AP005433.3| Homo sapiens genomic DNA, chromosome 18 clone:RP11-945C19, complete
             sequence
          Length = 146000

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 3     tgtacaaactgcctgcttta 22
             ||||||||||||||||||||
Sbjct: 30500 tgtacaaactgcctgcttta 30481


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,951,261
Number of Sequences: 3902068
Number of extensions: 3951261
Number of successful extensions: 72692
Number of sequences better than 10.0: 17
Number of HSP's better than 10.0 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 72659
Number of HSP's gapped (non-prelim): 33
length of query: 436
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 414
effective length of database: 17,147,199,772
effective search space: 7098940705608
effective search space used: 7098940705608
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)