ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbastl01f01 |
|---|---|
| Clone Library Name | barley_pub |
>emb|AL050402.16|HSBA46E17 Human DNA sequence from clone RP11-46E17 on chromosome 22, complete sequence Length = 109710 Score = 50.1 bits (25), Expect = 0.005 Identities = 28/29 (96%) Strand = Plus / Plus Query: 15 atcaactcgtccatccattcattcattca 43 |||||||| |||||||||||||||||||| Sbjct: 61927 atcaactcatccatccattcattcattca 61955
>emb|BX255943.6| Zebrafish DNA sequence from clone CH211-246M13 in linkage group 2, complete sequence Length = 155032 Score = 50.1 bits (25), Expect = 0.005 Identities = 25/25 (100%) Strand = Plus / Plus Query: 21 tcgtccatccattcattcattcatc 45 ||||||||||||||||||||||||| Sbjct: 80261 tcgtccatccattcattcattcatc 80285
>emb|BX950226.13| Zebrafish DNA sequence from clone CH211-105P23 in linkage group 7, complete sequence Length = 174681 Score = 48.1 bits (24), Expect = 0.021 Identities = 24/24 (100%) Strand = Plus / Plus Query: 22 cgtccatccattcattcattcatc 45 |||||||||||||||||||||||| Sbjct: 76493 cgtccatccattcattcattcatc 76516 Score = 40.1 bits (20), Expect = 5.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 22 cgtccatccattcattcattcatc 45 ||||||||||||| |||||||||| Sbjct: 76088 cgtccatccattcgttcattcatc 76111
>emb|BX957325.16| Zebrafish DNA sequence from clone CH211-117O2 in linkage group 7, complete sequence Length = 166088 Score = 48.1 bits (24), Expect = 0.021 Identities = 24/24 (100%) Strand = Plus / Minus Query: 22 cgtccatccattcattcattcatc 45 |||||||||||||||||||||||| Sbjct: 21730 cgtccatccattcattcattcatc 21707 Score = 40.1 bits (20), Expect = 5.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 22 cgtccatccattcattcattcatc 45 ||||||||||||| |||||||||| Sbjct: 22135 cgtccatccattcgttcattcatc 22112
>emb|BX120001.10| Zebrafish DNA sequence from clone CH211-217J8 in linkage group 16, complete sequence Length = 211279 Score = 48.1 bits (24), Expect = 0.021 Identities = 24/24 (100%) Strand = Plus / Minus Query: 22 cgtccatccattcattcattcatc 45 |||||||||||||||||||||||| Sbjct: 47452 cgtccatccattcattcattcatc 47429 Score = 40.1 bits (20), Expect = 5.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatcat 47 ||||||||||||| |||||||||| Sbjct: 158596 tccatccattcatccattcatcat 158573
>emb|CR626891.17| Zebrafish DNA sequence from clone DKEY-33P20 in linkage group 14, complete sequence Length = 187607 Score = 48.1 bits (24), Expect = 0.021 Identities = 24/24 (100%) Strand = Plus / Minus Query: 21 tcgtccatccattcattcattcat 44 |||||||||||||||||||||||| Sbjct: 14863 tcgtccatccattcattcattcat 14840
>gb|AC140307.3| Mus musculus BAC clone RP23-389D15 from chromosome 19, complete sequence Length = 187731 Score = 46.1 bits (23), Expect = 0.081 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 gtccatccattcattcattcatc 45 ||||||||||||||||||||||| Sbjct: 29867 gtccatccattcattcattcatc 29889
>gb|AC004382.1|HUAC004382 Homo sapiens Chromosome 16 BAC clone CIT987SK-A-152E5, complete sequence Length = 217873 Score = 46.1 bits (23), Expect = 0.081 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 gtccatccattcattcattcatc 45 ||||||||||||||||||||||| Sbjct: 57588 gtccatccattcattcattcatc 57610
>gb|AC109619.11| Mus musculus chromosome 19, clone RP23-427F6, complete sequence Length = 170072 Score = 46.1 bits (23), Expect = 0.081 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 gtccatccattcattcattcatc 45 ||||||||||||||||||||||| Sbjct: 161451 gtccatccattcattcattcatc 161473
>emb|AL133343.23| Human DNA sequence from clone RP11-410N8 on chromosome 20 Contains the 5' end of two variants of the C20orf112 gene for a novel protein similar to nucleolar protein 4 (NOL4), three novel genes and a CpG island, complete sequence Length = 63609 Score = 46.1 bits (23), Expect = 0.081 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 gtccatccattcattcattcatc 45 ||||||||||||||||||||||| Sbjct: 59477 gtccatccattcattcattcatc 59455
>dbj|AK126533.1| Homo sapiens cDNA FLJ44569 fis, clone UTERU3009979, highly similar to Homo sapiens growth arrest-specific 6 (GAS6) Length = 3807 Score = 46.1 bits (23), Expect = 0.081 Identities = 26/27 (96%) Strand = Plus / Plus Query: 19 actcgtccatccattcattcattcatc 45 |||| |||||||||||||||||||||| Sbjct: 297 actcatccatccattcattcattcatc 323
>gb|AC008133.7| Homo sapiens chromosome 17, clone RP11-40A13, complete sequence Length = 179744 Score = 46.1 bits (23), Expect = 0.081 Identities = 23/23 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcatca 46 ||||||||||||||||||||||| Sbjct: 107016 tccatccattcattcattcatca 107038
>gb|AC025898.10| Homo sapiens chromosome 17, clone RP11-421O15, complete sequence Length = 184875 Score = 46.1 bits (23), Expect = 0.081 Identities = 23/23 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcatca 46 ||||||||||||||||||||||| Sbjct: 8235 tccatccattcattcattcatca 8257
>emb|BX323854.9| Zebrafish DNA sequence from clone CH211-286C5 in linkage group 24, complete sequence Length = 161864 Score = 46.1 bits (23), Expect = 0.081 Identities = 23/23 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcatca 46 ||||||||||||||||||||||| Sbjct: 157625 tccatccattcattcattcatca 157647 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 156293 tccatccattcattcattcat 156313
>gb|AC010269.6| Homo sapiens chromosome 5 clone CTC-485I21, complete sequence Length = 187084 Score = 46.1 bits (23), Expect = 0.081 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 atccattcattcattcatcatca 49 ||||||||||||||||||||||| Sbjct: 152433 atccattcattcattcatcatca 152455
>tpg|BK001240.1| TPA: TPA_exp: Homo sapiens growth arrest-specific 6 (GAS6) gene, complete cds Length = 45840 Score = 46.1 bits (23), Expect = 0.081 Identities = 26/27 (96%) Strand = Plus / Plus Query: 19 actcgtccatccattcattcattcatc 45 |||| |||||||||||||||||||||| Sbjct: 13924 actcatccatccattcattcattcatc 13950
>gb|AC009052.8| Homo sapiens chromosome 16 clone RP11-250E14, complete sequence Length = 200557 Score = 46.1 bits (23), Expect = 0.081 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 gtccatccattcattcattcatc 45 ||||||||||||||||||||||| Sbjct: 105535 gtccatccattcattcattcatc 105557
>gb|AC091978.3| Homo sapiens chromosome 5 clone RP11-531A21, complete sequence Length = 192708 Score = 46.1 bits (23), Expect = 0.081 Identities = 23/23 (100%) Strand = Plus / Plus Query: 27 atccattcattcattcatcatca 49 ||||||||||||||||||||||| Sbjct: 22319 atccattcattcattcatcatca 22341
>emb|AL163032.3|CNS01RI9 Human chromosome 14 DNA sequence BAC C-2303B20 of library CalTech-D from chromosome 14 of Homo sapiens (Human), complete sequence Length = 130313 Score = 46.1 bits (23), Expect = 0.081 Identities = 23/23 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatca 46 ||||||||||||||||||||||| Sbjct: 52633 tccatccattcattcattcatca 52611
>emb|CR555297.6| Zebrafish DNA sequence from clone DKEY-193O6 in linkage group 11, complete sequence Length = 62428 Score = 46.1 bits (23), Expect = 0.081 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 gtccatccattcattcattcatc 45 ||||||||||||||||||||||| Sbjct: 39874 gtccatccattcattcattcatc 39852 Score = 46.1 bits (23), Expect = 0.081 Identities = 23/23 (100%) Strand = Plus / Minus Query: 23 gtccatccattcattcattcatc 45 ||||||||||||||||||||||| Sbjct: 39459 gtccatccattcattcattcatc 39437
>emb|AL772399.9| Mouse DNA sequence from clone RP23-220L1 on chromosome 4, complete sequence Length = 103488 Score = 46.1 bits (23), Expect = 0.081 Identities = 23/23 (100%) Strand = Plus / Plus Query: 23 gtccatccattcattcattcatc 45 ||||||||||||||||||||||| Sbjct: 3407 gtccatccattcattcattcatc 3429
>emb|BX072579.14| Human DNA sequence from clone RP11-199F6 on chromosome 13 Contains the GAS6 gene for growth arrest-specific 6, six novel genes and ten CpG islands, complete sequence Length = 170020 Score = 46.1 bits (23), Expect = 0.081 Identities = 26/27 (96%) Strand = Plus / Minus Query: 19 actcgtccatccattcattcattcatc 45 |||| |||||||||||||||||||||| Sbjct: 83944 actcatccatccattcattcattcatc 83918
>gb|AC110520.12| Mus musculus chromosome 7, clone RP23-24N16, complete sequence Length = 248540 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 114125 tccatccattcattcattcatc 114146
>gb|AF238380.3| Homo sapiens chromosome X multiple clones map p11.23, complete sequence Length = 158698 Score = 44.1 bits (22), Expect = 0.32 Identities = 25/26 (96%) Strand = Plus / Minus Query: 18 aactcgtccatccattcattcattca 43 ||||| |||||||||||||||||||| Sbjct: 106701 aactcatccatccattcattcattca 106676
>gb|AC145205.2| Homo sapiens chromosome 17, clone RP11-1224M18, complete sequence Length = 81310 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 2298 tccatccattcattcattcatc 2277
>gb|AC121264.8| Mus musculus chromosome 9, clone RP24-233F22, complete sequence Length = 194261 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 130485 tccatccattcattcattcatc 130464
>emb|CR382386.8| Zebrafish DNA sequence from clone DKEY-111O10 in linkage group 14, complete sequence Length = 162528 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 23 gtccatccattcattcattcat 44 |||||||||||||||||||||| Sbjct: 15581 gtccatccattcattcattcat 15560
>gb|AC147341.2| Pan troglodytes BAC clone CH251-31E16 from Y, complete sequence Length = 193163 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 144260 tccatccattcattcattcatc 144239
>gb|AC146234.3| Pan troglodytes BAC clone CH251-199F20 from Y, complete sequence Length = 155191 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 6179 tccatccattcattcattcatc 6158
>gb|AC007598.7| Homo sapiens chromosome 16 clone RP11-165M1, complete sequence Length = 186120 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 129813 tccatccattcattcattcatc 129792
>gb|AC122244.5| Mus musculus BAC clone RP23-149I9 from chromosome 10, complete sequence Length = 187474 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 162706 tccatccattcattcattcatc 162685
>emb|BX511141.27| Zebrafish DNA sequence from clone DKEYP-10C6 in linkage group 23, complete sequence Length = 165253 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 151384 tccatccattcattcattcatc 151405
>emb|CR354562.12| Zebrafish DNA sequence from clone DKEY-25B23 in linkage group 23, complete sequence Length = 201764 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 93704 tccatccattcattcattcatc 93683
>gb|AC123848.4| Mus musculus BAC clone RP23-459I1 from chromosome 5, complete sequence Length = 184292 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 152673 tccatccattcattcattcatc 152652
>gb|AC123795.4| Mus musculus BAC clone RP24-317K11 from chromosome 5, complete sequence Length = 188616 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 22000 tccatccattcattcattcatc 21979
>gb|AC006337.5| Homo sapiens BAC clone RP11-535N23 from 7, complete sequence Length = 172291 Score = 44.1 bits (22), Expect = 0.32 Identities = 25/26 (96%) Strand = Plus / Plus Query: 23 gtccatccattcattcattcatcatc 48 |||||||||||||| ||||||||||| Sbjct: 142749 gtccatccattcatccattcatcatc 142774
>gb|AC111069.9| Mus musculus chromosome 18, clone RP24-164O22, complete sequence Length = 183457 Score = 44.1 bits (22), Expect = 0.32 Identities = 25/26 (96%) Strand = Plus / Minus Query: 192 agaattatgtatatggaaaccctagt 217 |||||| ||||||||||||||||||| Sbjct: 143092 agaattctgtatatggaaaccctagt 143067
>emb|BX004827.18| Human DNA sequence from clone RP13-391G2 on chromosome X Contains the SHOX gene for short stature homeobox and seven CpG islands, complete sequence Length = 119555 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 68550 tccatccattcattcattcatc 68529 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 catccattcattcattcatc 45 |||||||||||||||||||| Sbjct: 68576 catccattcattcattcatc 68557 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 25 ccatccattcattcattcat 44 |||||||||||||||||||| Sbjct: 68505 ccatccattcattcattcat 68486
>emb|AL589685.17| Human DNA sequence from clone RP11-443G18 on chromosome 1 Contains the 5' end of the gene for Est1p-like protein B (EST1B), novel gene (MGC13102), novel gene (MGC31963), a von Hippel-Lindau syndrome (VHL) pseudogene, the CCT3 gene for chaperonin containing TCP1 subunit 3 (gamma), the gene for SSTK-interacting protein (SSTK-IP) and the 5' end of the RHBG gene for Rhesus blood group B glycoprotein, complete sequence Length = 107819 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 91219 tccatccattcattcattcatc 91198
>emb|AL356579.24| Human DNA sequence from clone RP11-593A16 on chromosome 6 Contains the 5' end of the gene for KIAA1798 protein and a CpG island, complete sequence Length = 172816 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 70316 tccatccattcattcattcatc 70337
>emb|AL158151.16| Human DNA sequence from clone RP11-247A12 on chromosome 9 Contains the CRAT gene for carnitine acetyltransferase (CAT1), the PPP2R4 gene for protein phosphatase 2A, regulatory subunit B' (PR 53) (PTPA), the IER5L gene for immediate early response 5-like, a novel gene and three CpG islands, complete sequence Length = 162445 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 140510 tccatccattcattcattcatc 140531 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 ccatccattcattcattcatc 45 ||||||||||||||||||||| Sbjct: 140311 ccatccattcattcattcatc 140331
>gb|AC069113.9| Homo sapiens chromosome 8, clone RP11-597M17, complete sequence Length = 197616 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 165730 tccatccattcattcattcatc 165751
>gb|AF276759.4| Homo sapiens chromosome 8 clone RP11-420F14 map p21-p11, complete sequence Length = 213611 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 115045 tccatccattcattcattcatc 115066
>emb|AL035685.21|HS791K14 Human DNA sequence from clone RP4-791K14 on chromosome 20q13.11-13.13 Contains the KCNB1 gene for Shab-related potassium voltage-gated channel 1 and a CpG island, complete sequence Length = 155318 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 127601 tccatccattcattcattcatc 127622
>emb|AL035669.43|HS885L7 Human DNA sequence from clone RP5-885L7 on chromosome 20q13.2-13.33 Contains the 3' end of the NTSR1 gene for high affinity neurotensin receptor 1, the C20orf20 gene, the OGFR gene for opioid growth factor receptor, the COL9A3 gene for collagen IX alpha 3, the C20orf143 gene, the TCFL5 gene for basic helix-loop-helix transcription factor-like 5, the ARF4P2 gene for ADP-ribosylation factor 4 pseudogene 2, the 3' end of the DATF1 gene for death associated transcription factor 1, two novel genes and seven CpG islands, complete sequence Length = 160241 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 17466 tccatccattcattcattcatc 17487
>gb|AC098022.5| Rattus norvegicus 7 BAC CH230-53D11 (Children's Hospital Oakland Research Institute) complete sequence Length = 233080 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 23083 tccatccattcattcattcatc 23062
>emb|BX005379.9| Zebrafish DNA sequence from clone DKEY-184P9 in linkage group 21, complete sequence Length = 185814 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 82961 tccatccattcattcattcatc 82940
>gb|AC113391.2| Homo sapiens chromosome 5 clone RP11-375B1, complete sequence Length = 83726 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 25 ccatccattcattcattcatca 46 |||||||||||||||||||||| Sbjct: 62993 ccatccattcattcattcatca 63014
>emb|BX294100.11| Zebrafish DNA sequence from clone DKEYP-2G11 in linkage group 12, complete sequence Length = 173405 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 46134 tccatccattcattcattcatc 46155
>gb|AC119424.2| Homo sapiens chromosome 3 clone RP11-475O23, complete sequence Length = 208015 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 23 gtccatccattcattcattcat 44 |||||||||||||||||||||| Sbjct: 105915 gtccatccattcattcattcat 105936
>emb|BX842687.13| Zebrafish DNA sequence from clone DKEY-97L11 in linkage group 7, complete sequence Length = 218252 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 23 gtccatccattcattcattcat 44 |||||||||||||||||||||| Sbjct: 196011 gtccatccattcattcattcat 195990
>dbj|BS000534.1| Pan troglodytes chromosome Y clone:PTB-092H12, complete sequences Length = 224014 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 67488 tccatccattcattcattcatc 67467
>dbj|BS000532.1| Pan troglodytes chromosome Y clone:PTB-056N15, complete sequences Length = 144899 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 130465 tccatccattcattcattcatc 130444
>emb|BX294188.11| Zebrafish DNA sequence from clone DKEY-255G14, complete sequence Length = 261943 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 128343 tccatccattcattcattcatc 128322
>emb|BX510351.9| Zebrafish DNA sequence from clone DKEYP-89A3 in linkage group 10, complete sequence Length = 102138 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 99056 tccatccattcattcattcatc 99035
>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence Length = 23952694 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 22901363 tccatccattcattcattcatc 22901384 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 16279646 tccatccattcattcattcat 16279666
>gb|AC105751.2| Homo sapiens chromosome 3 clone RP11-908O9, complete sequence Length = 168835 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 23 gtccatccattcattcattcat 44 |||||||||||||||||||||| Sbjct: 81714 gtccatccattcattcattcat 81693
>gb|AC021063.16| Mus Musculus Chromosome 18 RP23-179K16, complete sequence Length = 202807 Score = 44.1 bits (22), Expect = 0.32 Identities = 25/26 (96%) Strand = Plus / Plus Query: 192 agaattatgtatatggaaaccctagt 217 |||||| ||||||||||||||||||| Sbjct: 156182 agaattctgtatatggaaaccctagt 156207
>gb|AC092377.3| Homo sapiens chromosome 16 clone RP11-680G10, complete sequence Length = 207283 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 30 cattcattcattcatcatcatg 51 |||||||||||||||||||||| Sbjct: 71673 cattcattcattcatcatcatg 71694
>gb|AC112657.2| Homo sapiens X BAC RP11-647I17 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 116810 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 42478 tccatccattcattcattcatc 42499
>gb|AC074045.23| Homo sapiens Xp BAC RP11-60N3 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 162381 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 19230 tccatccattcattcattcatc 19251
>emb|BX296521.18| Zebrafish DNA sequence from clone CH211-194E11 in linkage group 7, complete sequence Length = 185817 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 116598 tccatccattcattcattcatc 116619
>emb|BX255912.10| Zebrafish DNA sequence from clone CH211-267H23, complete sequence Length = 178425 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 70288 tccatccattcattcattcatc 70267
>emb|BX072533.17| Zebrafish DNA sequence from clone CH211-158C3 in linkage group 15, complete sequence Length = 183704 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 23 gtccatccattcattcattcat 44 |||||||||||||||||||||| Sbjct: 2665 gtccatccattcattcattcat 2644
>emb|BX322623.7| Zebrafish DNA sequence from clone CH211-256I14 in linkage group 15, complete sequence Length = 104062 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 23 gtccatccattcattcattcat 44 |||||||||||||||||||||| Sbjct: 87894 gtccatccattcattcattcat 87873
>emb|AL954641.12| Zebrafish DNA sequence from clone CH211-278J9 in linkage group 2, complete sequence Length = 167140 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 161042 tccatccattcattcattcatc 161063 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 27 atccattcattcattcatca 46 |||||||||||||||||||| Sbjct: 160198 atccattcattcattcatca 160217
>emb|BX276087.14| Zebrafish DNA sequence from clone CH211-270M20 in linkage group 10, complete sequence Length = 167208 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 121293 tccatccattcattcattcatc 121314
>emb|AL117126.1|CNS01DPQ Botrytis cinerea strain T4 cDNA library Length = 423 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 421 tccatccattcattcattcatc 400
>gb|AC157497.3| Pan troglodytes BAC clone CH251-490K17 from chromosome unknown, complete sequence Length = 207664 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 86987 tccatccattcattcattcatc 87008 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 86819 tccatccattcattcattcatc 86840
>gb|AC154659.2| Mus musculus BAC clone RP24-269K6 from chromosome 17, complete sequence Length = 177071 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 154592 tccatccattcattcattcatc 154571
>gb|AC140675.5| Mus musculus BAC clone RP23-44J10 from chromosome 5, complete sequence Length = 229269 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 224181 tccatccattcattcattcatc 224202 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 25834 tccatccattcattcattcat 25854
>gb|AC133645.5| Mus musculus BAC clone RP23-73O10 from chromosome 5, complete sequence Length = 207846 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 40175 tccatccattcattcattcatc 40196 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 181613 tccatccattcattcattcat 181593
>gb|AC124476.5| Mus musculus BAC clone RP24-93F9 from chromosome 10, complete sequence Length = 169031 Score = 44.1 bits (22), Expect = 0.32 Identities = 25/26 (96%) Strand = Plus / Minus Query: 19 actcgtccatccattcattcattcat 44 |||||||||||||| ||||||||||| Sbjct: 65576 actcgtccatccatccattcattcat 65551
>gb|AC091902.2| Homo sapiens chromosome 5 clone RP11-16L24, complete sequence Length = 188877 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 25 ccatccattcattcattcatca 46 |||||||||||||||||||||| Sbjct: 15800 ccatccattcattcattcatca 15779
>emb|BX537347.12| Zebrafish DNA sequence from clone RP71-78P1 in linkage group 4, complete sequence Length = 197064 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 58983 tccatccattcattcattcatc 58962
>gb|AC011741.9| Homo sapiens BAC clone RP11-113E4 from 2, complete sequence Length = 141418 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 64588 tccatccattcattcattcatc 64609
>gb|AC055858.18| Homo sapiens chromosome 17, clone RP11-682M7, complete sequence Length = 167395 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 57077 tccatccattcattcattcatc 57098
>emb|BX548167.10| Zebrafish DNA sequence from clone DKEY-46L15 in linkage group 20, complete sequence Length = 135292 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 55913 tccatccattcattcattcatc 55934 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 56092 tccatccattcattcattcat 56112
>gb|AC137591.1| Homo sapiens chromosome X clone XX-B6cos map Xp22-PAR, complete sequence Length = 32799 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 21753 tccatccattcattcattcatc 21732 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 catccattcattcattcatc 45 |||||||||||||||||||| Sbjct: 21779 catccattcattcattcatc 21760 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 25 ccatccattcattcattcat 44 |||||||||||||||||||| Sbjct: 21708 ccatccattcattcattcat 21689
>emb|BX248498.5| Zebrafish DNA sequence from clone CH211-241P24, complete sequence Length = 171348 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 81277 tccatccattcattcattcatc 81298
>emb|AL928976.4| Zebrafish DNA sequence from clone CH211-134B16, complete sequence Length = 173937 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 23 gtccatccattcattcattcat 44 |||||||||||||||||||||| Sbjct: 30914 gtccatccattcattcattcat 30935
>emb|BX950189.14| Zebrafish DNA sequence from clone CH211-155P8 in linkage group 19, complete sequence Length = 92418 Score = 44.1 bits (22), Expect = 0.32 Identities = 25/26 (96%) Strand = Plus / Plus Query: 19 actcgtccatccattcattcattcat 44 |||| ||||||||||||||||||||| Sbjct: 87798 actcatccatccattcattcattcat 87823
>emb|BX537249.8| Zebrafish DNA sequence from clone DKEY-77B17 in linkage group 20, complete sequence Length = 92426 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 54636 tccatccattcattcattcatc 54615
>emb|BX649312.6| Zebrafish DNA sequence from clone DKEY-170M15 in linkage group 20, complete sequence Length = 162661 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 48111 tccatccattcattcattcatc 48090
>emb|BX649543.6| Zebrafish DNA sequence from clone DKEY-238K23 in linkage group 20, complete sequence Length = 42367 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 6227 tccatccattcattcattcatc 6206 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 5277 tccatccattcattcattcat 5257
>emb|AL645755.20| Zebrafish DNA sequence from clone RP71-1N18 in linkage group 22, complete sequence Length = 141779 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 78835 tccatccattcattcattcatc 78814 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 75665 tccatccattcattcattcat 75685
>gb|AC132114.4| Mus musculus BAC clone RP24-112A6 from chromosome 9, complete sequence Length = 192639 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 178786 tccatccattcattcattcatc 178807
>emb|CR407543.6| Zebrafish DNA sequence from clone CH211-63M22 in linkage group 10, complete sequence Length = 105526 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 71490 tccatccattcattcattcatc 71469
>emb|CT025666.5| Zebrafish DNA sequence from clone DKEY-218J1 in linkage group 5, complete sequence Length = 131912 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 19150 tccatccattcattcattcatc 19171
>emb|AL953893.17| Zebrafish DNA sequence from clone DKEY-60B12, complete sequence Length = 216749 Score = 44.1 bits (22), Expect = 0.32 Identities = 25/26 (96%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatcatca 49 ||||||||||||||||| |||||||| Sbjct: 136668 tccatccattcattcatccatcatca 136643
>emb|CR847961.12| Zebrafish DNA sequence from clone DKEY-154B7 in linkage group 5, complete sequence Length = 237051 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 218601 tccatccattcattcattcatc 218580
>emb|AL929342.7| Zebrafish DNA sequence from clone DKEY-225K7, complete sequence Length = 117082 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 70629 tccatccattcattcattcatc 70608
>gb|AC141646.4| Mus musculus BAC clone RP23-84E4 from chromosome 9, complete sequence Length = 193235 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 100201 tccatccattcattcattcatc 100222
>emb|AL591805.14| Mouse DNA sequence from clone RP23-90N15 on chromosome 2, complete sequence Length = 93682 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatc 45 |||||||||||||||||||||| Sbjct: 45479 tccatccattcattcattcatc 45458 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattca 43 |||||||||||||||||||| Sbjct: 6564 tccatccattcattcattca 6583
>gb|AC161435.7| Mus musculus chromosome 8, clone RP23-78L21, complete sequence Length = 219937 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 378 tccatccattcattcattcat 358
>gb|AC138367.14| Mus musculus chromosome 8, clone RP23-296G24, complete sequence Length = 177856 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 66484 tccatccattcattcattcat 66504
>gb|AC117757.23| Mus musculus chromosome 1, clone RP24-420I4, complete sequence Length = 183087 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 26 catccattcattcattcatca 46 ||||||||||||||||||||| Sbjct: 52412 catccattcattcattcatca 52432
>gb|AC165224.9| Mus musculus chromosome 5, clone RP24-389L10, complete sequence Length = 155046 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 67299 tccatccattcattcattcat 67319
>gb|AC123720.32| Mus musculus chromosome 10, clone RP23-413G8, complete sequence Length = 192037 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 64831 tccatccattcattcattcat 64851
>gb|AC167247.2| Mus musculus BAC clone RP23-418C19 from chromosome 17, complete sequence Length = 185234 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 48759 tccatccattcattcattcat 48779
>gb|AC165317.8| Mus musculus chromosome 5, clone RP23-265O20, complete sequence Length = 190857 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 180947 tccatccattcattcattcat 180967
>gb|AC102611.10| Mus musculus chromosome 1, clone RP23-416O18, complete sequence Length = 210808 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 151596 tccatccattcattcattcat 151576
>gb|AC120144.11| Mus musculus chromosome 8, clone RP24-427K8, complete sequence Length = 210003 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 98707 tccatccattcattcattcat 98687
>gb|AY263771.1| Seepiophila jonesi clone E2-10B microsatellite sequence Length = 816 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 715 tccatccattcattcattcat 735
>gb|AC005736.1| Homo sapiens chromosome 16, BAC clone 462G18 (LANL), complete sequence Length = 215441 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 115765 tccatccattcattcattcat 115785
>gb|AC156576.3| Mus musculus BAC clone RP23-7C22 from chromosome 13, complete sequence Length = 205345 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 108959 tccatccattcattcattcat 108939
>gb|AC149224.7| Mus musculus BAC clone RP23-81D11 from chromosome 19, complete sequence Length = 217821 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 55040 tccatccattcattcattcat 55060
>gb|AC165961.2| Mus musculus BAC clone RP23-378M19 from chromosome 16, complete sequence Length = 211284 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 150010 tccatccattcattcattcat 149990
>gb|AC102440.12| Mus musculus chromosome 1, clone RP24-146C18, complete sequence Length = 144770 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 106782 tccatccattcattcattcat 106762
>gb|AC093351.8| Mus musculus chromosome 7, clone RP23-16L19, complete sequence Length = 239688 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 50715 tccatccattcattcattcat 50695
>gb|AC146030.3| Pan troglodytes BAC clone RP43-124E21 from chromosome 7, complete sequence Length = 169275 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 34005 tccatccattcattcattcat 34025
>gb|AC175380.2| Mus musculus BAC clone RP24-333L5 from chromosome 13, complete sequence Length = 164055 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 119100 tccatccattcattcattcat 119120
>gb|AC145748.4| Mus musculus BAC clone RP23-31L10 from chromosome 5, complete sequence Length = 220208 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 42372 tccatccattcattcattcat 42352 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 19 actcgtccatccattcattca 39 ||||||||||||||||||||| Sbjct: 42341 actcgtccatccattcattca 42321 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 catccattcattcattcatc 45 |||||||||||||||||||| Sbjct: 42422 catccattcattcattcatc 42403
>gb|AC113987.11| Mus musculus chromosome 9, clone RP24-106M14, complete sequence Length = 170828 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 20237 tccatccattcattcattcat 20257
>ref|XM_587451.2| PREDICTED: Bos taurus similar to U4/U6 small nuclear ribonucleoprotein Prp3 (Pre-mRNA splicing factor 3) (U4/U6 snRNP 90 kDa protein) (hPrp3) (LOC510322), mRNA Length = 2995 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 2649 tccatccattcattcattcat 2629
>gb|AC138737.10| Mus musculus chromosome 5, clone RP23-307F20, complete sequence Length = 216064 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 181006 tccatccattcattcattcat 180986
>gb|AC168220.1| Mus musculus BAC clone RP23-77O10 from chromosome 16, complete sequence Length = 215265 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 46505 tccatccattcattcattcat 46485
>gb|AC163608.2| Mus musculus chromosome 1, clone RP24-185M14, complete sequence Length = 161555 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 104853 tccatccattcattcattcat 104873
>gb|AC113475.12| Mus musculus chromosome 12, clone RP23-304B1, complete sequence Length = 177032 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 103027 tccatccattcattcattcat 103007
>gb|AC133910.6| Mus musculus chromosome 14, clone RP24-484F23, complete sequence Length = 235453 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 123274 tccatccattcattcattcat 123294
>gb|AC123614.6| Mus musculus chromosome 9, clone RP23-446P16, complete sequence Length = 210060 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 77601 tccatccattcattcattcat 77581
>gb|AC113098.12| Mus musculus chromosome 8, clone RP23-314K9, complete sequence Length = 190888 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 28991 tccatccattcattcattcat 29011
>gb|AC102350.14| Mus musculus chromosome 9, clone RP23-323P3, complete sequence Length = 211216 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 23341 tccatccattcattcattcat 23321
>gb|AC110253.10| Mus musculus chromosome 5, clone RP23-270N2, complete sequence Length = 224182 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 147898 tccatccattcattcattcat 147918
>gb|AC113304.15| Mus musculus chromosome 9, clone RP23-431B6, complete sequence Length = 202182 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 25 ccatccattcattcattcatc 45 ||||||||||||||||||||| Sbjct: 143637 ccatccattcattcattcatc 143617
>gb|AC122907.4| Mus musculus BAC clone RP23-49I4 from chromosome 15, complete sequence Length = 233904 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 63026 tccatccattcattcattcat 63006
>gb|AC113031.11| Mus musculus chromosome 14, clone RP23-220B20, complete sequence Length = 250215 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 200833 tccatccattcattcattcat 200813
>emb|BX088693.15| Zebrafish DNA sequence from clone CH211-212E22 in linkage group 2, complete sequence Length = 150021 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 103411 tccatccattcattcattcat 103391 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 27 atccattcattcattcatca 46 |||||||||||||||||||| Sbjct: 104488 atccattcattcattcatca 104469
>emb|CT025546.10| Zebrafish DNA sequence from clone DKEY-105J11 in linkage group 18, complete sequence Length = 210488 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 169008 tccatccattcattcattcat 169028
>emb|CT010488.9| Mouse DNA sequence from clone RP23-133A3 on chromosome 9, complete sequence Length = 219139 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 25 ccatccattcattcattcatc 45 ||||||||||||||||||||| Sbjct: 55537 ccatccattcattcattcatc 55517
>emb|CR753837.14| Zebrafish DNA sequence from clone DKEY-234K7 in linkage group 5, complete sequence Length = 135495 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 107797 tccatccattcattcattcat 107777
>emb|Y18000.1|HSAY18000 Homo sapiens NF2 gene Length = 126138 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 19 actcgtccatccattcattcattca 43 |||| |||||||||||||||||||| Sbjct: 66557 actcatccatccattcattcattca 66581
>emb|CT010577.7| Mouse DNA sequence from clone RP23-318D14 on chromosome 14, complete sequence Length = 195351 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 36273 tccatccattcattcattcat 36253
>emb|BX914197.15| Zebrafish DNA sequence from clone DKEYP-81F11 in linkage group 11, complete sequence Length = 198600 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 81199 tccatccattcattcattcat 81219
>emb|CR925784.13| Zebrafish DNA sequence from clone DKEYP-104A3 in linkage group 11, complete sequence Length = 174101 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 158750 tccatccattcattcattcat 158730 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 158706 tccatccattcattcattcat 158686
>emb|CR769785.19| Zebrafish DNA sequence from clone DKEY-1N3 in linkage group 13, complete sequence Length = 232168 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 211397 tccatccattcattcattcat 211417
>gb|AC146452.3| Pan troglodytes BAC clone CH251-483N3 from Y, complete sequence Length = 215209 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 129664 tccatccattcattcattcat 129684
>emb|CR457456.7| Zebrafish DNA sequence from clone CH211-235F6 in linkage group 23, complete sequence Length = 146468 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 34873 tccatccattcattcattcat 34893
>gb|AC113470.14| Mus musculus chromosome 9, clone RP23-262N17, complete sequence Length = 202838 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 17377 tccatccattcattcattcat 17397
>gb|AC132081.3| Mus musculus BAC clone RP24-510O7 from chromosome 7, complete sequence Length = 152620 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 61379 tccatccattcattcattcat 61399
>gb|AC122414.4| Mus musculus BAC clone RP24-150D8 from chromosome 5, complete sequence Length = 186986 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 165271 tccatccattcattcattcat 165291
>gb|AC127353.3| Mus musculus BAC clone RP23-81P21 from chromosome 18, complete sequence Length = 225658 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 50058 tccatccattcattcattcat 50038
>gb|AC132450.3| Mus musculus BAC clone RP23-187N8 from chromosome 18, complete sequence Length = 201282 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 30 cattcattcattcatcatcat 50 ||||||||||||||||||||| Sbjct: 188532 cattcattcattcatcatcat 188552
>emb|CR407592.10| Zebrafish DNA sequence from clone DKEY-166N5, complete sequence Length = 147299 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 140443 tccatccattcattcattcat 140423
>gb|AC132392.3| Mus musculus BAC clone RP23-386F15 from chromosome 7, complete sequence Length = 208499 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 198164 tccatccattcattcattcat 198184
>gb|AC124760.4| Mus musculus BAC clone RP23-133I8 from chromosome 1, complete sequence Length = 230067 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 203545 tccatccattcattcattcat 203525
>gb|AC132455.3| Mus musculus BAC clone RP23-129K10 from chromosome 17, complete sequence Length = 210538 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 60975 tccatccattcattcattcat 60955
>gb|AC073530.18| Homo sapiens 12 BAC RP11-123O10 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 156390 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 22 cgtccatccattcattcattc 42 ||||||||||||||||||||| Sbjct: 142862 cgtccatccattcattcattc 142842
>gb|AC130204.4| Mus musculus BAC clone RP24-427M16 from chromosome 18, complete sequence Length = 167394 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 8459 tccatccattcattcattcat 8479
>gb|AC122057.3| Mus musculus BAC clone RP24-468F14 from chromosome 9, complete sequence Length = 169815 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 11169 tccatccattcattcattcat 11189
>gb|AC122043.4| Mus musculus BAC clone RP24-448C16 from chromosome 5, complete sequence Length = 187106 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 90156 tccatccattcattcattcat 90136
>gb|AC122378.4| Mus musculus BAC clone RP23-474C9 from chromosome 15, complete sequence Length = 203662 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 122718 tccatccattcattcattcat 122738
>gb|AC126547.4| Mus musculus BAC clone RP24-180F1 from chromosome 13, complete sequence Length = 181823 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 29454 tccatccattcattcattcat 29434
>gb|AC126683.4| Mus musculus BAC clone RP23-62G15 from 6, complete sequence Length = 167297 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 19600 tccatccattcattcattcat 19580
>emb|CR925759.7| Wallaby DNA sequence from clone MEKBa-346C2, complete sequence Length = 146757 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 20364 tccatccattcattcattcat 20384
>emb|BX950178.23| Zebrafish DNA sequence from clone CH211-100L13 in linkage group 5, complete sequence Length = 175858 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 162884 tccatccattcattcattcat 162864
>gb|AC122295.4| Mus musculus BAC clone RP23-263E3 from 13, complete sequence Length = 200289 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 186590 tccatccattcattcattcat 186610
>emb|CR555294.10| Zebrafish DNA sequence from clone CH211-169P4 in linkage group 19, complete sequence Length = 142042 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 76441 tccatccattcattcattcat 76461
>emb|CR376783.22| Zebrafish DNA sequence from clone DKEY-41N20 in linkage group 13, complete sequence Length = 205064 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 11931 tccatccattcattcattcat 11911
>gb|AC122912.2| Mus musculus BAC clone RP23-61E5 from 7, complete sequence Length = 255062 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 151487 tccatccattcattcattcat 151467
>gb|AC121874.2| Mus musculus BAC clone RP24-124K16 from 18, complete sequence Length = 164190 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 111125 tccatccattcattcattcat 111105
>gb|AC098739.3| Mus musculus BAC clone RP23-122G2 from 6, complete sequence Length = 221146 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 185875 tccatccattcattcattcat 185895
>gb|AC073094.11| Homo sapiens BAC clone RP11-369D24 from 7, complete sequence Length = 189126 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 65831 tccatccattcattcattcat 65811
>gb|AC100153.10| Mus musculus chromosome 7, clone RP23-43N3, complete sequence Length = 132518 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 94873 tccatccattcattcattcat 94853
>gb|AC110169.7| Mus musculus chromosome 9, clone RP23-233D3, complete sequence Length = 193041 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 19650 tccatccattcattcattcat 19670
>gb|AC101994.3| Mus musculus chromosome 1, clone RP24-406F14, complete sequence Length = 164170 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 141868 tccatccattcattcattcat 141888
>gb|AC116129.13| Mus musculus chromosome 1, clone RP23-98F11, complete sequence Length = 216320 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 88986 tccatccattcattcattcat 89006
>gb|AC159224.6| Mus musculus chromosome 8, clone RP24-180O7, complete sequence Length = 171002 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 118400 tccatccattcattcattcat 118380
>gb|AY788876.1| Salvelinus confluentus microsatellite Sco207 sequence Length = 639 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 228 tccatccattcattcattcat 248
>emb|BX908755.10| Zebrafish DNA sequence from clone DKEY-67F11 in linkage group 3, complete sequence Length = 160005 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 10688 tccatccattcattcattcat 10668
>emb|CR478286.10| Zebrafish DNA sequence from clone CH211-196B13 in linkage group 15, complete sequence Length = 188644 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 178106 tccatccattcattcattcat 178126 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 177947 tccatccattcattcattcat 177967 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 177428 tccatccattcattcattcat 177448 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 177312 tccatccattcattcattcat 177332
>emb|BX511036.18| Zebrafish DNA sequence from clone DKEY-279D7 in linkage group 6, complete sequence Length = 164653 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 117812 tccatccattcattcattcat 117792 Score = 40.1 bits (20), Expect = 5.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 22 cgtccatccattcattcattcatc 45 ||||||||||| |||||||||||| Sbjct: 117319 cgtccatccatccattcattcatc 117296
>emb|BX323862.18| Zebrafish DNA sequence from clone DKEYP-97A5 in linkage group 6, complete sequence Length = 184810 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 184298 tccatccattcattcattcat 184318
>emb|AL590708.18| Human DNA sequence from clone RP11-395P17 on chromosome 9 Contains the PCSCL gene for likely ortholog of rat peroxisomal Ca-dependent solute carrier-like protein (KIAA1896), the PTGES2 gene for prostaglandin E synthase 2 (GBF1, GBF-1, C9orf15, FLJ14038), the LCN2 gene for lipocalin 2 (oncogene 24p3) (NGAL), the C9orf16 gene for chromosome 9 open reading frame 16 (MGC4639, EST00098, FLJ12823), the CIZ1 gene for Cip1-interacting zinc finger protein (LSFR1), the DNM1 gene for dynamin 1 (DNM), the GOLGA2 gene for golgi autoantigen, golgin subfamily a, 2 (GM130, MGC20672), the gene for a novel protein and seven CpG islands, complete sequence Length = 194056 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 27 atccattcattcattcatcat 47 ||||||||||||||||||||| Sbjct: 98534 atccattcattcattcatcat 98514
>emb|AL590009.10| Human DNA sequence from clone RP11-181P4 on chromosome 6 Contains the WASF1 gene for WAS protein family member 1 and part of the FLJ31482 gene, complete sequence Length = 153046 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 ccatccattcattcattcatc 45 ||||||||||||||||||||| Sbjct: 149765 ccatccattcattcattcatc 149785
>emb|AL451122.7| Human DNA sequence from clone RP11-8B23 on chromosome 9, complete sequence Length = 38278 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 14156 tccatccattcattcattcat 14176
>emb|AL445588.12| Human DNA sequence from clone RP11-522H16 on chromosome 13, complete sequence Length = 174591 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 146063 tccatccattcattcattcat 146083
>emb|AL359388.32| Human DNA sequence from clone RP11-445I23 on chromosome 10 Contains the 5' end of the MMS19L gene for MMS19-like (MET18 homolog, S. cerevisiae), the gene for a novel protein (FLJ11807), the 5' end of the ANKRD2 gene for ankyrin repeat domain 2 (stretch responsive muscle) and two CpG islands, complete sequence Length = 86299 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 43306 tccatccattcattcattcat 43286
>gb|AY130457.1|AY130456S2 Homo sapiens fibulin 2 (FBLN2) gene, exons 3 through 9 Length = 14972 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 25 ccatccattcattcattcatc 45 ||||||||||||||||||||| Sbjct: 7335 ccatccattcattcattcatc 7355 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattca 43 |||||||||||||||||||| Sbjct: 7025 tccatccattcattcattca 7044
>emb|AL359091.10| Human DNA sequence from clone RP11-339B21 on chromosome 9 Contains a novel gene (FLJ21673), novel gene (CLONE24922), the COQ4 gene for coenzyme Q4 homolog (yeast), a novel gene similar to thymosin, beta 4, X chromosome (TMSB4X0), the SLC27A4 gene for solute carrier family 27 (fatty acid transporter), member 4 (FATP4), a novel gene (2GC2668), the gene for cerebral cell adhesion molecule (CerCAM), a pseudogene similar to part of a novel gene (FLJ36874), the 5' end of the ODF2 gene for outer dense fiber of sperm tails 2 (ODF84, ODF2/1, ODF2/2, MGC9034) and six CpG islands, complete sequence Length = 184444 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 52881 tccatccattcattcattcat 52901
>emb|AL357558.6| Human DNA sequence from clone RP11-347D21 on chromosome 20 Contains four putative novel genes, ESTs, STSs, GSSs and a CpG island, complete sequence Length = 63227 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 416 tccatccattcattcattcat 436
>emb|AL356109.8| Human DNA sequence from clone RP11-373A10 on chromosome 6 Contains the TCF21 gene for transcription factor 21 and two predicted CpG islands, complete sequence Length = 25186 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 6203 tccatccattcattcattcat 6223
>emb|AL353607.20| Human DNA sequence from clone RP11-652B19 on chromosome 9 Contains part of the PCSK5 gene for proprotein convertase subtilisin/kexin type 5, complete sequence Length = 141170 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatcatc 48 ||||||||||||| ||||||||||| Sbjct: 91197 tccatccattcatccattcatcatc 91173
>emb|AL158072.9| Human DNA sequence from clone RP11-30O14 on chromosome 9p21.1-21.3, complete sequence Length = 200840 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 137917 tccatccattcattcattcat 137937
>emb|AL139283.13| Human DNA sequence from clone RP4-540O3 on chromosome 1p34.3-36.11, complete sequence Length = 74237 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 30 cattcattcattcatcatcat 50 ||||||||||||||||||||| Sbjct: 11314 cattcattcattcatcatcat 11294
>emb|AL138822.13| Human DNA sequence from clone RP11-57H24 on chromosome 13 Contains a Eukaryotic initiation factor 4A (eIF4a) pseudogene, complete sequence Length = 126502 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 521 tccatccattcattcattcat 501
>emb|AL136319.8| Human DNA sequence from clone RP1-287O21 on chromosome 10, complete sequence Length = 118429 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 2161 tccatccattcattcattcat 2181
>emb|AL121991.50|HSDJ675E8 Human DNA sequence from clone RP4-675E8 on chromosome 1p34.1-35.3 Contains the 3' end of EIF3S2 gene for eukaryotic translation initiation factor 3, subunit 2 beta, the LCK gene for lymphocyte-specific protein tyrosine kinase, a novel gene, a novel gene (MGC10820) and two CpG islands, complete sequence Length = 61515 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 23 gtccatccattcattcattca 43 ||||||||||||||||||||| Sbjct: 51464 gtccatccattcattcattca 51484
>emb|AL117380.28|HSJ749H19 Human DNA sequence from clone RP4-749H19 on chromosome 20q13.11-13.33 Contains ESTs, STSs, GSSs and a CpG island, complete sequence Length = 178473 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 8030 tccatccattcattcattcat 8010
>emb|AL049536.5|HS205F14P Human DNA sequence from clone RP1-205F14P on chromosome 22q11.22-12.3, complete sequence Length = 35569 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 13674 tccatccattcattcattcat 13654
>emb|AL035419.12|HS1100H13 Human DNA sequence from clone RP5-1100H13 on chromosome 20q11.2 Contains the 3' end of the gene for a novel protein (KIAA1219), a novel gene, a HSPC037 pseudogene, the C20orf95 gene for a novel RhoGAP domain-containing protein and two CpG islands, complete sequence Length = 116792 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 88638 tccatccattcattcattcat 88618
>gb|AC158961.3| Mus musculus chromosome 1, clone RP23-316E20, complete sequence Length = 202205 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 162759 tccatccattcattcattcat 162779
>emb|CR759918.11| Zebrafish DNA sequence from clone CH211-278M11 in linkage group 15, complete sequence Length = 160374 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 116405 tccatccattcattcattcat 116385
>emb|CR354401.17| Zebrafish DNA sequence from clone CH211-101C7 in linkage group 12, complete sequence Length = 168372 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 141923 tccatccattcattcattcat 141903 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 141809 tccatccattcattcattcat 141789
>gb|AC175816.4| Mus musculus chromosome 5, clone wi1-2209C9, complete sequence Length = 38620 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 21560 tccatccattcattcattcat 21580
>gb|AC166262.3| Mus musculus BAC RP23-256D10 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 175073 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 169336 tccatccattcattcattcat 169356
>emb|AL844847.6| Zebrafish DNA sequence from clone DKEY-13A21 in linkage group 11 Contains three novel genes, the opn1lw1 gene for opsin 1 (cone pigments), long-wave-sensitive, 1, a gene for novel protein similar to human and rodent member RAS oncogene family RAB7 (RAB7), a gene for novel protein remotely similar to human host cell factor 1 (VP16-accessory protein) (HCFC1), the opn1sw2 gene for opsin 1 (cone pigments), short-wave-sensitive 1, a gene for novel protein similar to human and mouse CpG binding protein (CGBP), a gene for novel protein similar to vertebrate microphthalmia-associated transcription factor (MITF) and zebrafish transcription factor binding to IGHM enhancer 3a (tfe3a), a gene for novel protein similar to human and rodent catechol-O-methyltransferase (COMT), the flj10613l gene for hypothetical protein FLJ10613-like (H. sapiens), a gene for novel protein similar to human and mouse methyl-CpG binding domain protein 1 (MBD1), a gene for novel protein similar to zebrafish red-sensitive opsin (rdops), a gene for novel protein similar to mouse and human host cell factor C1 (VP16-accessory protein) (HCFC1), a gene for novel protein similar to human and rodent metabotropic glutamate receptors (GRM) and two CpG islands, complete sequence Length = 235174 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 165145 tccatccattcattcattcat 165125
>emb|AL954693.5| Zebrafish DNA sequence from clone BUSM1-146N9 in linkage group 14 Contains part of a novel gene similar to human GCN1 (general control of amino-acid synthesis 1-like 1 (yeast)), part of anovel gene similar to human RAB35 (member of RAS oncogene family) and four CpG islands, complete sequence Length = 107343 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 37215 tccatccattcattcattcat 37195
>emb|AL596127.12| Mouse DNA sequence from clone RP23-297J14 on chromosome 11 Contains the 3' end of the Facl6 gene for fatty acid Coenzyme A ligase long chain 6, four novel genes, a ribosomal protein L35 (Rpl35) pseudogene, the 5' end of the gene for a novel protein similar to human PDZ domain containing guanine nucleotide exchange factor (GEF) 2 PDZGEF2 and three CpG islands, complete sequence Length = 198614 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 27350 tccatccattcattcattcat 27330
>emb|AL596207.10| Mouse DNA sequence from clone RP23-336J1 on chromosome 11 Contains the 5' end of the Sparc gene for secreted acidic cysteine rich glycoprotein, the Atox1 gene for ATX1 (antioxidant protein 1) homolog 1 (yeast), an upregulated during skeletal muscle growth 5 (Usmg5) pseudogene, the gene for Ras-GTPase-activating protein SH3-domain binding protein (G3bp-pending) (C87777), a novel gene, the Glra1 gene for glycine receptor, alpha 1 subunit, a novel gene, a ubiquitously expressed transcript (Uxt) pseudogene and one CpG island, complete sequence Length = 204037 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 24 tccatccattcattcattcatcatc 48 ||||| ||||||||||||||||||| Sbjct: 134891 tccattcattcattcattcatcatc 134915
>gb|AC144770.1| Homo sapiens chromosome 19 clone XXfos-87852H4, complete sequence Length = 45852 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 26 catccattcattcattcatca 46 ||||||||||||||||||||| Sbjct: 6396 catccattcattcattcatca 6376
>gb|AC117602.9| Mus musculus chromosome 5, clone RP23-462C22, complete sequence Length = 205604 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 39293 tccatccattcattcattcat 39313
>emb|AJ271002.1|MMU271002 Mus musculus TFF1/pS2 gene for Trefoil Factor1/pS2, exons 1-3 Length = 7048 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 1014 tccatccattcattcattcat 1034
>emb|BX510946.18| Zebrafish DNA sequence from clone CH211-9F9 in linkage group 13, complete sequence Length = 103700 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 97061 tccatccattcattcattcat 97041
>emb|CR376765.12| Zebrafish DNA sequence from clone DKEY-208L2 in linkage group 13, complete sequence Length = 134448 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 99657 tccatccattcattcattcat 99637 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 99326 tccatccattcattcattcat 99306
>emb|CR293506.10| Zebrafish DNA sequence from clone CH211-144M15 in linkage group 1, complete sequence Length = 70042 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 69977 tccatccattcattcattcat 69957
>emb|CR927553.8| Zebrafish DNA sequence from clone DKEY-206P8 in linkage group 17, complete sequence Length = 162064 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 9651 tccatccattcattcattcat 9671
>emb|BX546489.13| Zebrafish DNA sequence from clone CH211-258F14 in linkage group 3, complete sequence Length = 148304 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 68313 tccatccattcattcattcat 68293
>emb|BX901942.6| Zebrafish DNA sequence from clone DKEY-121B10 in linkage group 1, complete sequence Length = 166521 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 60506 tccatccattcattcattcat 60486
>emb|BX957230.5| Zebrafish DNA sequence from clone DKEY-106I11 in linkage group 6, complete sequence Length = 68670 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 35056 tccatccattcattcattcat 35036
>emb|CR751236.6| Zebrafish DNA sequence from clone DKEY-27M6 in linkage group 23, complete sequence Length = 108342 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 47297 tccatccattcattcattcat 47317
>emb|BX901976.22| Zebrafish DNA sequence from clone DKEY-101P20 in linkage group 22, complete sequence Length = 201928 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 26 catccattcattcattcatca 46 ||||||||||||||||||||| Sbjct: 135745 catccattcattcattcatca 135765
>emb|CR388063.9| Zebrafish DNA sequence from clone CH211-248P16 in linkage group 18, complete sequence Length = 142119 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 71309 tccatccattcattcattcat 71329
>emb|BX548038.9| Zebrafish DNA sequence from clone DKEY-219C10 in linkage group 9, complete sequence Length = 173526 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 53891 tccatccattcattcattcat 53911
>emb|BX255878.13| Mouse DNA sequence from clone RP23-444O21 on chromosome 11, complete sequence Length = 117480 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 92210 tccatccattcattcattcat 92190
>emb|AL645902.6| Mouse DNA sequence from clone RP23-19I2 on chromosome 11 Contains the gene for the likely ortholog of H. sapiens phosphoribosylformylglycinamidine synthase (FGAR amidotransferase) (PFAS), the gene for a novel protein (1500010J02Rik), the Aurkb gene for aurora kinase B, two genes for novel proteins (2310047M10Rik and 1110004B13Rik), a guanine nucleotide binding protein (G protein) gamma 5 subunit (Gng5) pseudogene and three CpG islands, complete sequence Length = 100678 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 23380 tccatccattcattcattcat 23360
>emb|CR385021.12| Zebrafish DNA sequence from clone CH211-200N15 in linkage group 16, complete sequence Length = 148046 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 79864 tccatccattcattcattcat 79844
>emb|CR847548.8| Zebrafish DNA sequence from clone DKEY-185L9 in linkage group 8, complete sequence Length = 249728 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 18161 tccatccattcattcattcat 18181
>emb|CR392021.10| Zebrafish DNA sequence from clone CH211-126H20 in linkage group 5, complete sequence Length = 182008 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 54351 tccatccattcattcattcat 54331
>emb|CR293518.13| Zebrafish DNA sequence from clone CH211-129L10 in linkage group 12, complete sequence Length = 196374 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 176091 tccatccattcattcattcat 176071 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 175794 tccatccattcattcattcat 175774
>emb|CR450833.5| Zebrafish DNA sequence from clone DKEY-31J12 in linkage group 8, complete sequence Length = 213777 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 45895 tccatccattcattcattcat 45915
>emb|CR762498.10| Zebrafish DNA sequence from clone DKEY-4J1 in linkage group 13, complete sequence Length = 169361 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 88355 tccatccattcattcattcat 88335
>emb|BX324130.5| Zebrafish DNA sequence from clone DKEY-30J16 in linkage group 11, complete sequence Length = 209188 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 131449 tccatccattcattcattcat 131429
>emb|BX469922.12| Zebrafish DNA sequence from clone DKEY-30N5 in linkage group 24, complete sequence Length = 200409 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 196715 tccatccattcattcattcat 196735
>emb|BX323578.20| Zebrafish DNA sequence from clone DKEYP-81D2 in linkage group 14, complete sequence Length = 214676 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 24 tccatccattcattcattcatcatc 48 ||||||||| ||||||||||||||| Sbjct: 36017 tccatccatccattcattcatcatc 35993
>emb|BX548161.12| Zebrafish DNA sequence from clone DKEY-248F6 in linkage group 16, complete sequence Length = 188754 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 85137 tccatccattcattcattcat 85117
>gb|AC161503.4| Mus musculus chromosome 8, clone RP23-81C3, complete sequence Length = 180580 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 65443 tccatccattcattcattcat 65463
>emb|BX000470.24| Zebrafish DNA sequence from clone DKEY-16N16 in linkage group 1, complete sequence Length = 237809 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 54227 tccatccattcattcattcat 54247
>gb|AC116419.32| Mus musculus chromosome 1, clone RP24-89C10, complete sequence Length = 229522 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 24 tccatccattcattcattcatcatc 48 ||||||||||||||||| ||||||| Sbjct: 198801 tccatccattcattcatccatcatc 198825
>emb|CR589876.7| Zebrafish DNA sequence from clone DKEY-53I3 in linkage group 23, complete sequence Length = 176042 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 167934 tccatccattcattcattcat 167914
>emb|CR318584.8| Zebrafish DNA sequence from clone CH211-123F21 in linkage group 13, complete sequence Length = 138029 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 8457 tccatccattcattcattcat 8437 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 8149 tccatccattcattcattcat 8129 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 7893 tccatccattcattcattcat 7873 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 7693 tccatccattcattcattcat 7673
>gb|AC175490.2| Mus musculus chromosome 5, clone wi1-959E1, complete sequence Length = 41880 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 20545 tccatccattcattcattcat 20525
>emb|BX005109.23| Zebrafish DNA sequence from clone CH211-284K5 in linkage group 25, complete sequence Length = 186632 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 23 gtccatccattcattcattcatcat 47 |||||||||| |||||||||||||| Sbjct: 164584 gtccatccatccattcattcatcat 164560
>emb|BX640581.8| Zebrafish DNA sequence from clone CH211-287M22, complete sequence Length = 141374 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 118270 tccatccattcattcattcat 118250
>emb|BX470184.9| Zebrafish DNA sequence from clone CH211-214H13 in linkage group 23, complete sequence Length = 205568 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 190492 tccatccattcattcattcat 190472 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 190420 tccatccattcattcattcat 190400 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 190388 tccatccattcattcattcat 190368 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 190280 tccatccattcattcattcat 190260
>emb|BX530018.8| Zebrafish DNA sequence from clone DKEY-228B21 in linkage group 1, complete sequence Length = 221617 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 194860 tccatccattcattcattcat 194880 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 catccattcattcattcatc 45 |||||||||||||||||||| Sbjct: 194822 catccattcattcattcatc 194841
>emb|BX547933.13| Zebrafish DNA sequence from clone DKEY-87L9 in linkage group 2, complete sequence Length = 177199 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 90307 tccatccattcattcattcat 90287
>gb|AF364592.1|F364580S13 Mus musculus C1-tetrahydrofolate synthase (Dcs) gene, exon 28 Length = 1231 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 863 tccatccattcattcattcat 883
>gb|AC112717.5| Homo sapiens BAC clone RP11-481H16 from 4, complete sequence Length = 189406 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 154242 tccatccattcattcattcat 154262 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 catccattcattcattcatc 45 |||||||||||||||||||| Sbjct: 135209 catccattcattcattcatc 135228
>gb|AC126119.2| Homo sapiens chromosome 3 clone RP11-326J12, complete sequence Length = 54166 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 47830 tccatccattcattcattcat 47810
>gb|AC022144.8| Homo sapiens chromosome 19 clone CTD-2540F13, complete sequence Length = 149271 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 21 tcgtccatccattcattcattcatc 45 ||||||||||||||||| ||||||| Sbjct: 4402 tcgtccatccattcatttattcatc 4426
>gb|AC008761.8| Homo sapiens chromosome 19 clone CTD-3149D2, complete sequence Length = 226170 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 119865 tccatccattcattcattcat 119845
>emb|CR382334.8| Zebrafish DNA sequence from clone CH211-264A6 in linkage group 19, complete sequence Length = 136267 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 58947 tccatccattcattcattcat 58927
>dbj|BS000639.1| Pan troglodytes chromosome Y clone:PTB-193I20, complete sequences Length = 86000 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 19732 tccatccattcattcattcat 19712
>gb|AC107979.7| Homo sapiens chromosome 15, clone CTD-3049M7, complete sequence Length = 148290 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 26122 tccatccattcattcattcat 26142
>gb|AC092566.2| Homo sapiens chromosome 19 clone LLNLR-239F4, complete sequence Length = 38046 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 26 catccattcattcattcatca 46 ||||||||||||||||||||| Sbjct: 28017 catccattcattcattcatca 28037
>emb|BX537141.17| Zebrafish DNA sequence from clone DKEY-9E8 in linkage group 2, complete sequence Length = 264534 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 9602 tccatccattcattcattcat 9622
>emb|BX901964.13| Zebrafish DNA sequence from clone DKEYP-20A7 in linkage group 24, complete sequence Length = 82377 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 56458 tccatccattcattcattcat 56438 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 56406 tccatccattcattcattcat 56386
>emb|CR394572.8| Zebrafish DNA sequence from clone CH211-157C3 in linkage group 3, complete sequence Length = 147156 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 59006 tccatccattcattcattcat 59026
>emb|BX005378.13| Zebrafish DNA sequence from clone DKEY-40H20 in linkage group 5, complete sequence Length = 168015 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 24 tccatccattcattcattcat 44 ||||||||||||||||||||| Sbjct: 105478 tccatccattcattcattcat 105458 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,755,759 Number of Sequences: 3902068 Number of extensions: 2755759 Number of successful extensions: 226707 Number of sequences better than 10.0: 668 Number of HSP's better than 10.0 without gapping: 672 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 215537 Number of HSP's gapped (non-prelim): 11076 length of query: 377 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 355 effective length of database: 17,147,199,772 effective search space: 6087255919060 effective search space used: 6087255919060 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
