Clone Name	rbastl01e01
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|BT016462.1| Zea mays clone Contig295 mRNA sequence	198	1e-47
2	gb|AY914601.1| Zea mays heat shock protein 70 mRNA, partial cds	198	1e-47
3	gb|AY109330.1| Zea mays CL45_1 mRNA sequence	198	1e-47
4	gb|BT016812.1| Zea mays clone Contig645 mRNA sequence	192	7e-46
5	emb|X78415.1|ZMHSP705 Z.mays (cv DH5xDH7) hsp70-5 mRNA for heat ...	182	7e-43
6	gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome...	172	7e-40
7	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	172	7e-40
8	ref|XM_475365.1| Oryza sativa (japonica cultivar-group), predic...	168	1e-38
9	gb|AC134045.2| Oryza sativa (japonica cultivar-group) chromosome...	167	4e-38
10	emb|X67711.2|OSHSC70A O.sativa hsp70 gene for heat shock protein 70	167	4e-38
11	dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D...	167	4e-38
12	dbj|AK119710.1| Oryza sativa (japonica cultivar-group) cDNA clon...	167	4e-38
13	dbj|AK119255.1| Oryza sativa (japonica cultivar-group) cDNA clon...	167	4e-38
14	dbj|AK065431.1| Oryza sativa (japonica cultivar-group) cDNA clon...	167	4e-38
15	gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome...	167	4e-38
16	ref|XM_470141.1| Oryza sativa (japonica cultivar-group), mRNA	165	2e-37
17	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	165	2e-37
18	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	165	2e-37
19	gb|AC104433.8| Oryza sativa chromosome 3 BAC OJ1754_E06 genomic ...	165	2e-37
20	dbj|AK102784.1| Oryza sativa (japonica cultivar-group) cDNA clon...	165	2e-37
21	dbj|AK069740.1| Oryza sativa (japonica cultivar-group) cDNA clon...	165	2e-37
22	emb|X78414.1|ZMHSP704 Z.mays (cv DH5xDH7) hsp70-4 mRNA for heat ...	151	2e-33
23	gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare str...	145	1e-31
24	gb|AC137698.1| Genomic sequence for Oryza sativa, Nipponbare str...	145	1e-31
25	dbj|AK109474.1| Oryza sativa (japonica cultivar-group) cDNA clon...	145	1e-31
26	dbj|AK099275.1| Oryza sativa (japonica cultivar-group) cDNA clon...	145	1e-31
27	dbj|AK072830.1| Oryza sativa (japonica cultivar-group) cDNA clon...	145	1e-31
28	ref|NM_190528.1| Oryza sativa (japonica cultivar-group), predic...	143	6e-31
29	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	143	6e-31
30	dbj|AP003241.3| Oryza sativa (japonica cultivar-group) genomic D...	143	6e-31
31	dbj|AP003231.3| Oryza sativa (japonica cultivar-group) genomic D...	143	6e-31
32	gb|U41653.1|SBU41653 Sorghum bicolor heat shock protein 70 (hsp7...	137	4e-29
33	emb|X61491.1|SOSCE70 S.oleracea sce70 mRNA for 70 kDa heat shock...	133	6e-28
34	gb|AF034618.1|AF034618 Spinacia oleracea cytosolic heat shock 70...	133	6e-28
35	gb|L26243.1|SPIC70A Spinacia oleracea heat shock C70 protein mRN...	133	6e-28
36	gb|AF005993.1|AF005993 Triticum aestivum 70 kDa heat shock prote...	123	5e-25
37	emb|AJ249331.1|CSA249331 Cucumis sativus mRNA for heat shock pro...	119	9e-24
38	gb|AF479058.1| Sandersonia aurantiaca 70 kDa heat shock protein ...	119	9e-24
39	gb|BT018649.1| Zea mays clone EL01N0505F04.d mRNA sequence	117	3e-23
40	gb|AF527796.1| Cucurbita maxima cell-autonomous heat shock cogna...	107	3e-20
41	gb|BT016692.1| Zea mays clone Contig525 mRNA sequence	105	1e-19
42	gb|AF161180.1|AF161180 Malus domestica high molecular weight hea...	105	1e-19
43	gb|AY104350.1| Zea mays PCO083553 mRNA sequence	100	8e-18
44	dbj|AB012716.1| Salix gilgiana Hsc70 mRNA for heat shock protein...	100	8e-18
45	gb|AF033852.1|AF033852 Spinacia oleracea cytosolic heat shock 70...	98	3e-17
46	gb|AF034617.1|AF034617 Spinacia oleracea cytosolic heat shock 70...	98	3e-17
47	gb|AF034616.1|AF034616 Spinacia oleracea cytosolic heat shock 70...	98	3e-17
48	emb|X03697.1|ZMHSP702 Maize gene for heat shock protein 70 exon ...	96	1e-16
49	gb|AF527795.1| Cucurbita maxima non-cell-autonomous heat shock c...	94	5e-16
50	dbj|AB112816.1| Nicotiana benthamiana Hsp70 mRNA for heat shock ...	92	2e-15
51	gb|AY106152.1| Zea mays PCO094428 mRNA sequence	92	2e-15
52	gb|AF509339.1| Saussurea medusa heat shock protein 70 (HSP70) mR...	90	8e-15
53	gb|AC150776.2| Medicago truncatula chromosome 7 BAC clone mte1-4...	90	8e-15
54	gb|AF527794.1| Cucurbita maxima non-cell-autonomous heat shock c...	90	8e-15
55	dbj|AB112814.1| Nicotiana benthamiana Hsp70 mRNA for heat shock ...	90	8e-15
56	gb|AF002667.1|SCAF002667 Solanum commersonii heat shock cognate ...	90	8e-15
57	gb|AY694190.1| Camellia sinensis HSP70 (hsp70) mRNA, partial cds	88	3e-14
58	gb|AY257488.1| Lycopersicon esculentum HSC2-like mRNA, partial s...	88	3e-14
59	dbj|AB105430.2| Nicotiana benthamiana Hsp70 mRNA for heat shock ...	86	1e-13
60	gb|AY836799.1| Saussurea medusa heat shock protein hsp70 gene, c...	82	2e-12
61	gb|AY372071.1| Nicotiana tabacum heat shock protein 70-3 (HSP70-...	82	2e-12
62	gb|AY253326.1| Nicotiana tabacum heat shock protein 70 (Hsp70) m...	82	2e-12
63	gb|AF509336.1| Saussurea medusa heat shock protein 70 (HSP70) mR...	82	2e-12
64	gb|AY485986.1| Vigna radiata 70 kDa heat shock cognate protein 1...	76	1e-10
65	gb|AY261674.1| Citrus x paradisi HSP70 mRNA, partial cds	76	1e-10
66	gb|BT013586.1| Lycopersicon esculentum clone 132340F, mRNA sequence	74	5e-10
67	emb|X54029.1|LEHSC170 Lycopersicon esculentum hsc-1 mRNA for hea...	74	5e-10
68	gb|DQ124007.1| Coffea arabica x Coffea canephora clone HT-SSH4-F...	74	5e-10
69	emb|X99197.1|MS70KDHSP M.sativa mRNA for 70 kD heat shock protein	72	2e-09
70	gb|AY830127.1| Medicago sativa heat shock protein 70 (HSP70-1) m...	70	7e-09
71	gb|AC146757.19| Medicago truncatula clone mth2-16n21, complete s...	70	7e-09
72	gb|AC147536.12| Medicago truncatula clone mth2-9l3, complete seq...	70	7e-09
73	gb|S85730.1| hsc71=major heat-shock-protein-like gene [rainbow t...	68	3e-08
74	dbj|AB196460.1| Oncorhynchus mykiss HSC70A mRNA for heat shock 7...	68	3e-08
75	ref|NM_120328.2| Arabidopsis thaliana HSC70-1; ATP binding AT5G0...	66	1e-07
76	emb|X77199.1|ATHSC701 A.thaliana hsc70-1 gene	66	1e-07
77	emb|X74604.1|ATHSC70 A.thaliana hsc70 mRNA for heat shock cognat...	66	1e-07
78	gb|AY035123.1| Arabidopsis thaliana putative dnaK-type molecular...	66	1e-07
79	emb|AL162971.1|ATT22P11 Arabidopsis thaliana DNA chromosome 5, B...	66	1e-07
80	gb|AY120747.1| Arabidopsis thaliana DnaK-type molecular chaperon...	66	1e-07
81	gb|AY057481.1| Arabidopsis thaliana AT5g02500/T22P11_90 mRNA, co...	66	1e-07
82	emb|BX832460.1|CNS0A1Q8 Arabidopsis thaliana Full-length cDNA Co...	66	1e-07
83	gb|BT002754.1| Arabidopsis thaliana clone C104920 putative dnaK-...	66	1e-07
84	gb|AY929184.1| Latimeria chalumnae heat shock protein 70 (Hsp70)...	66	1e-07
85	gb|BC077998.1| Xenopus laevis cDNA clone MGC:82390 IMAGE:4406669...	64	4e-07
86	emb|X54030.1|LEHSC270 Lycopersicon esculentum hsc-2 mRNA for hea...	64	4e-07
87	gb|L41253.1|TOMHSC70A Lycopersicon esculentum Hsc70 gene, comple...	64	4e-07
88	gb|DQ324856.1| Haliotis discus hannai heat shock protein 70 mRNA...	64	4e-07
89	gb|DQ059998.1| Volvox carteri f. nagariensis heat-shock inducibl...	62	2e-06
90	gb|DQ059999.1| Volvox carteri f. nagariensis heat-shock inducibl...	62	2e-06
91	gb|AF035414.1|AF035414 Brassica napus heat shock cognate protein...	62	2e-06
92	gb|AY485987.1| Vigna radiata 70 kDa heat shock cognate protein 2...	58	3e-05
93	emb|CR735051.2|CNS0GTY2 Tetraodon nigroviridis full-length cDNA	58	3e-05
94	emb|CR734665.2|CNS0GTNC Tetraodon nigroviridis full-length cDNA	58	3e-05
95	emb|CR732389.2|CNS0GS22 Tetraodon nigroviridis full-length cDNA	58	3e-05
96	emb|CR731254.2|CNS0GR6J Tetraodon nigroviridis full-length cDNA	58	3e-05
97	emb|CR730967.2|CNS0GQYK Tetraodon nigroviridis full-length cDNA	58	3e-05
98	emb|CR730283.2|CNS0GQFK Tetraodon nigroviridis full-length cDNA	58	3e-05
99	emb|CR729311.2|CNS0GPOL Tetraodon nigroviridis full-length cDNA	58	3e-05
100	emb|CR725754.2|CNS0GMXS Tetraodon nigroviridis full-length cDNA	58	3e-05
101	emb|CR724374.2|CNS0GLVG Tetraodon nigroviridis full-length cDNA	58	3e-05
102	emb|CR722706.2|CNS0GKL4 Tetraodon nigroviridis full-length cDNA	58	3e-05
103	emb|CR719367.2|CNS0GI0D Tetraodon nigroviridis full-length cDNA	58	3e-05
104	emb|CR716753.2|CNS0GFZU Tetraodon nigroviridis full-length cDNA	58	3e-05
105	emb|CR711358.2|CNS0GBU2 Tetraodon nigroviridis full-length cDNA	58	3e-05
106	emb|CR703631.2|CNS0G5VF Tetraodon nigroviridis full-length cDNA	58	3e-05
107	emb|CR699773.2|CNS0G2W9 Tetraodon nigroviridis full-length cDNA	58	3e-05
108	emb|CR700210.2|CNS0G38E Tetraodon nigroviridis full-length cDNA	58	3e-05
109	emb|CR699628.2|CNS0G2S8 Tetraodon nigroviridis full-length cDNA	58	3e-05
110	emb|CR699327.2|CNS0G2JV Tetraodon nigroviridis full-length cDNA	58	3e-05
111	emb|CR698441.2|CNS0G1V9 Tetraodon nigroviridis full-length cDNA	58	3e-05
112	emb|CR696974.2|CNS0G0QI Tetraodon nigroviridis full-length cDNA	58	3e-05
113	emb|CR696115.2|CNS0G02N Tetraodon nigroviridis full-length cDNA	58	3e-05
114	emb|CR694651.2|CNS0FYXZ Tetraodon nigroviridis full-length cDNA	58	3e-05
115	emb|CR693639.2|CNS0FY5V Tetraodon nigroviridis full-length cDNA	58	3e-05
116	emb|CR691059.2|CNS0FW67 Tetraodon nigroviridis full-length cDNA	58	3e-05
117	emb|CR688768.2|CNS0FUEK Tetraodon nigroviridis full-length cDNA	58	3e-05
118	emb|CR688743.2|CNS0FUDV Tetraodon nigroviridis full-length cDNA	58	3e-05
119	emb|CR688098.2|CNS0FTVY Tetraodon nigroviridis full-length cDNA	58	3e-05
120	emb|CR685229.2|CNS0FRO9 Tetraodon nigroviridis full-length cDNA	58	3e-05
121	emb|CR684600.2|CNS0FR6S Tetraodon nigroviridis full-length cDNA	58	3e-05
122	emb|CR682045.2|CNS0FP7T Tetraodon nigroviridis full-length cDNA	58	3e-05
123	emb|CR682007.2|CNS0FP6R Tetraodon nigroviridis full-length cDNA	58	3e-05
124	emb|CR681947.2|CNS0FP53 Tetraodon nigroviridis full-length cDNA	58	3e-05
125	emb|CR681557.2|CNS0FOU9 Tetraodon nigroviridis full-length cDNA	58	3e-05
126	emb|CR680840.2|CNS0FOAC Tetraodon nigroviridis full-length cDNA	58	3e-05
127	emb|CR680599.1|CNS0FO3N Tetraodon nigroviridis full-length cDNA	58	3e-05
128	emb|CR674390.2|CNS0FJBW Tetraodon nigroviridis full-length cDNA	58	3e-05
129	emb|CR673444.2|CNS0FILM Tetraodon nigroviridis full-length cDNA	58	3e-05
130	emb|CR668849.2|CNS0FF1Z Tetraodon nigroviridis full-length cDNA	58	3e-05
131	emb|CR668292.2|CNS0FEMI Tetraodon nigroviridis full-length cDNA	58	3e-05
132	emb|CR666588.2|CNS0FDB6 Tetraodon nigroviridis full-length cDNA	58	3e-05
133	emb|CR664947.2|CNS0FC1L Tetraodon nigroviridis full-length cDNA	58	3e-05
134	emb|CR664739.2|CNS0FBVT Tetraodon nigroviridis full-length cDNA	58	3e-05
135	emb|CR664071.2|CNS0FBD9 Tetraodon nigroviridis full-length cDNA	58	3e-05
136	emb|CR663097.2|CNS0FAM7 Tetraodon nigroviridis full-length cDNA	58	3e-05
137	emb|CR662148.2|CNS0F9VU Tetraodon nigroviridis full-length cDNA	58	3e-05
138	emb|CR657309.2|CNS0F65F Tetraodon nigroviridis full-length cDNA	58	3e-05
139	emb|CR656869.2|CNS0F5T7 Tetraodon nigroviridis full-length cDNA	58	3e-05
140	emb|CR655448.1|CNS0F4PQ Tetraodon nigroviridis full-length cDNA	58	3e-05
141	emb|CR656433.1|CNS0F5H3 Tetraodon nigroviridis full-length cDNA	58	3e-05
142	emb|CR656379.1|CNS0F5FL Tetraodon nigroviridis full-length cDNA	58	3e-05
143	emb|CR656173.1|CNS0F59V Tetraodon nigroviridis full-length cDNA	58	3e-05
144	emb|CR655567.2|CNS0F4T1 Tetraodon nigroviridis full-length cDNA	58	3e-05
145	emb|CR654938.1|CNS0F4BK Tetraodon nigroviridis full-length cDNA	58	3e-05
146	emb|CR654405.2|CNS0F3WR Tetraodon nigroviridis full-length cDNA	58	3e-05
147	emb|CR654109.2|CNS0F3OJ Tetraodon nigroviridis full-length cDNA	58	3e-05
148	emb|CR654231.1|CNS0F3RX Tetraodon nigroviridis full-length cDNA	58	3e-05
149	emb|CR651953.2|CNS0F20N Tetraodon nigroviridis full-length cDNA	58	3e-05
150	emb|CR651660.2|CNS0F1SI Tetraodon nigroviridis full-length cDNA	58	3e-05
151	emb|CR651251.2|CNS0F1H5 Tetraodon nigroviridis full-length cDNA	58	3e-05
152	emb|CR650378.1|CNS0F0SW Tetraodon nigroviridis full-length cDNA	58	3e-05
153	emb|CR649698.2|CNS0F0A0 Tetraodon nigroviridis full-length cDNA	58	3e-05
154	emb|CR648821.2|CNS0EZLN Tetraodon nigroviridis full-length cDNA	58	3e-05
155	emb|CR643803.1|CNS0EVQ9 Tetraodon nigroviridis full-length cDNA	58	3e-05
156	emb|CR641941.2|CNS0EUAJ Tetraodon nigroviridis full-length cDNA	58	3e-05
157	emb|CR638956.2|CNS0ERZM Tetraodon nigroviridis full-length cDNA	58	3e-05
158	emb|CR633864.2|CNS0EO26 Tetraodon nigroviridis full-length cDNA	58	3e-05
159	emb|X62799.1|GMHSP70 Glycine max hsp 70 gene	58	3e-05
160	ref|NM_120327.3| Arabidopsis thaliana ATP binding AT5G02490 mRNA...	56	1e-04
161	emb|CR734111.2|CNS0GT7Y Tetraodon nigroviridis full-length cDNA	56	1e-04
162	emb|CR728102.2|CNS0GOR0 Tetraodon nigroviridis full-length cDNA	56	1e-04
163	emb|CR703946.1|CNS0G646 Tetraodon nigroviridis full-length cDNA	56	1e-04
164	emb|CR683400.2|CNS0FQ9G Tetraodon nigroviridis full-length cDNA	56	1e-04
165	emb|CR656537.1|CNS0F5JZ Tetraodon nigroviridis full-length cDNA	56	1e-04
166	gb|BT008411.1| Arabidopsis thaliana At5g02490 gene, complete cds	56	1e-04
167	gb|AY093152.1| Arabidopsis thaliana DnaK-type molecular chaperon...	56	1e-04
168	emb|Y08892.1|ATHSC70G8 A.thaliana mRNA for Hsc70-G8 protein, par...	56	1e-04
169	gb|U23504.1|TNU23504 Trichoplusia ni HSC70 mRNA, complete cds	56	1e-04
170	emb|CR626889.13| Zebrafish DNA sequence from clone DKEY-4P15 in ...	54	4e-04
171	gb|AY762969.1| Acanthopagrus schlegelii HSC70 (HSC70) mRNA, comp...	54	4e-04
172	gb|M76725.2| Chlamydomonas reinhardtii 70 kDa heat shock protein...	54	4e-04
173	gb|AY029210.1| Ambystoma mexicanum heat shock protein 70 (HSP70)...	54	4e-04
174	ref|XM_686300.1| PREDICTED: Danio rerio similar to heat shock co...	54	4e-04
175	gb|AY436786.1| Rhabdosargus sarba heat shock cognate 70 (hsc70) ...	54	4e-04
176	dbj|AB112815.1| Nicotiana benthamiana Hsp70 mRNA for heat shock ...	54	4e-04
177	gb|BC091445.1| Danio rerio cDNA clone IMAGE:7286763, containing ...	54	4e-04
178	ref|NM_104519.1| Arabidopsis thaliana HSP70T-1; ATP binding AT1G...	52	0.002
179	gb|AY456093.1| Phytophthora nicotianae heat shock protein 70 (Hs...	52	0.002
180	gb|DQ446367.1| Arabidopsis thaliana clone pENTR221-At1g56410 hea...	52	0.002
181	gb|AY219845.1| Cyprinus carpio constitutive heat shock protein H...	52	0.002
182	emb|Z32537.1|PSHSC71R P.sativum (little marvel) HSC71.0 mRNA	52	0.002
183	emb|X51765.1|LPHSP70 L.polyphyllus mRNA for heat schock protein 70	52	0.002
184	dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c...	52	0.002
185	gb|AC058785.8|AC058785 Arabidopsis thaliana chromosome 1 BAC F13...	52	0.002
186	dbj|AB196461.1| Oncorhynchus mykiss HSC70B mRNA for heat shock 7...	52	0.002
187	dbj|AB092840.1| Carassius auratus HSC70 mRNA for heat shock cogn...	52	0.002
188	gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete...	52	0.002
189	gb|AY423868.1| Leishmania tarentolae 70 kDa heat shock protein (...	50	0.007
190	gb|AY078499.4| Dunaliella salina heat shock protein 70a (HSP70) ...	50	0.007
191	emb|X52314.1|LDHSP70 Leishmania hsp70 gene for heat shock protei...	50	0.007
192	emb|X13301.1|PHHSP70R Petunia mRNA for heat shock protein hsp70	50	0.007
193	emb|X06932.1|PHHSP70G Petunia hsp70 gene	50	0.007
194	dbj|AK222068.1| Arabidopsis thaliana mRNA for dnaK-type molecula...	50	0.007
195	emb|Z30176.1|TRMHSP70 T.repens (Huia) mRNA for heat shock protei...	50	0.007
196	gb|U26448.1|EGU26448 Echinococcus granulosus heat shock 70 kDa p...	50	0.007
197	gb|BT023894.1| Drosophila melanogaster LP19893 full insert cDNA	48	0.026
198	ref|XM_882866.1| PREDICTED: Bos taurus similar to Rab GTPase bin...	48	0.026
199	ref|XM_882853.1| PREDICTED: Bos taurus similar to Rab GTPase bin...	48	0.026
200	ref|XM_882846.1| PREDICTED: Bos taurus similar to Rab GTPase bin...	48	0.026
201	ref|XM_869715.1| PREDICTED: Bos taurus similar to Rab GTPase bin...	48	0.026
202	emb|AJ249330.1|CSA249330 Cucumis sativus mRNA for heat shock pro...	48	0.026
203	gb|AY913842.2| Leishmania donovani strain DD8 heat shock protein...	48	0.026
204	emb|CR723474.2|CNS0GL6G Tetraodon nigroviridis full-length cDNA	48	0.026
205	ref|XM_797036.1| PREDICTED: Strongylocentrotus purpuratus simila...	48	0.026
206	ref|XM_797035.1| PREDICTED: Strongylocentrotus purpuratus simila...	48	0.026
207	ref|XM_797034.1| PREDICTED: Strongylocentrotus purpuratus simila...	48	0.026
208	ref|XM_776060.1| PREDICTED: Strongylocentrotus purpuratus simila...	48	0.026
209	ref|XM_797027.1| PREDICTED: Strongylocentrotus purpuratus simila...	48	0.026
210	ref|XM_797023.1| PREDICTED: Strongylocentrotus purpuratus simila...	48	0.026
211	emb|Y08020.1|LIHSP706 L.infantum hsp70 gene, clone B2g6	48	0.026
212	emb|AJ004940.1|GGAJ4940 Gallus gallus mRNA for heat shock cognat...	48	0.026
213	emb|Y08019.1|LIHSP701 L.infantum hsp70 gene, clone B2g1	48	0.026
214	ref|NM_176503.1| Drosophila melanogaster Heat shock protein cogn...	48	0.026
215	ref|NM_176502.1| Drosophila melanogaster Heat shock protein cogn...	48	0.026
216	ref|NM_169627.1| Drosophila melanogaster Heat shock protein cogn...	48	0.026
217	ref|NM_169626.1| Drosophila melanogaster Heat shock protein cogn...	48	0.026
218	ref|NM_169625.1| Drosophila melanogaster Heat shock protein cogn...	48	0.026
219	dbj|AB167744.1| Numida meleagris hspa8 mRNA for heat shock prote...	48	0.026
220	ref|NM_079632.4| Drosophila melanogaster Heat shock protein cogn...	48	0.026
221	gb|AY084193.1| Drosophila melanogaster RH04426 full insert cDNA	48	0.026
222	ref|XM_694544.1| PREDICTED: Danio rerio similar to Splicing fact...	48	0.026
223	ref|XM_691025.1| PREDICTED: Danio rerio similar to Splicing fact...	48	0.026
224	gb|L19533.1|CRUU14HS Cricetulus griseus heat resistant protein gene	48	0.026
225	gb|AC009904.7| Drosophila melanogaster, chromosome 3R, region 88...	48	0.026
226	emb|CR386963.1| Gallus gallus finished cDNA, clone ChEST104m7	48	0.026
227	gb|AC007648.6|AC007648 Drosophila melanogaster, chromosome 3R, r...	48	0.026
228	ref|NM_205003.1| Gallus gallus heat shock cognate 70 (HSC70), mRNA	48	0.026
229	gb|AE003708.3| Drosophila melanogaster chromosome 3R, section 46...	48	0.026
230	gb|U64207.1|PCU64207 Penicillium citrinum heat shock protein 70 ...	48	0.026
231	gb|M34561.1|CRUHSP70A Chinese hamster heat shock protein (cognat...	48	0.026
232	gb|M36114.1|DROHSC4A2 D.melanogaster heat shock cognate 4 (hsc4)...	48	0.026
233	gb|AY651253.1| Rhynchobodo ATCC50359 heat shock protein 70 cytos...	46	0.10
234	gb|DQ025691.1| Oncorhynchus nerka clone One.hsc71.19.34 genomic ...	46	0.10
235	gb|DQ025620.1| Oncorhynchus keta clone Oke.hsc71.19.23 genomic s...	46	0.10
236	gb|DQ025546.1| Oncorhynchus tshawytscha clone Ots.hsc71.19.32 ge...	46	0.10
237	ref|XM_508938.1| PREDICTED: Pan troglodytes similar to heat shoc...	46	0.10
238	ref|XM_508830.1| PREDICTED: Pan troglodytes heat shock 70kDa pro...	46	0.10
239	gb|BC016660.1| Homo sapiens heat shock 70kDa protein 8, transcri...	46	0.10
240	gb|BC016179.1| Homo sapiens heat shock 70kDa protein 8, transcri...	46	0.10
241	gb|BC019816.2| Homo sapiens heat shock 70kDa protein 8, transcri...	46	0.10
242	gb|BC007276.1| Homo sapiens heat shock 70kDa protein 8, mRNA (cD...	46	0.10
243	ref|NM_006597.3| Homo sapiens heat shock 70kDa protein 8 (HSPA8)...	46	0.10
244	gb|DQ440299.1| Aedes aegypti clone AET-381 heat shock cognate 70...	46	0.10
245	gb|BC008907.2| Homo sapiens heat shock 70kDa protein 8, mRNA (cD...	46	0.10
246	gb|BC002423.1| Homo sapiens ribosomal protein L8, mRNA (cDNA clo...	46	0.10
247	ref|XM_812644.1| Trypanosoma cruzi strain CL Brener heat shock p...	46	0.10
248	ref|XM_812645.1| Trypanosoma cruzi strain CL Brener heat shock p...	46	0.10
249	gb|BC112920.1| Homo sapiens cDNA clone IMAGE:7484542, **** WARNI...	46	0.10
250	emb|Y00371.1|HSHSC70 Human hsc70 gene for 71 kd heat shock cogna...	46	0.10
251	emb|X67716.1|TCHSPR70 T.cruzi mRNA for HSP70	46	0.10
252	emb|X58715.1|TCHSP70PA T.cruzi hsp70 mRNA for 70 kDa heat shock ...	46	0.10
253	emb|CR925990.1| Pongo pygmaeus mRNA; cDNA DKFZp459M2220 (from cl...	46	0.10
254	emb|CR937348.1| Single read from an extremity of a cDNA clone ma...	46	0.10
255	emb|CR937294.1| Single read from an extremity of a cDNA clone ma...	46	0.10
256	emb|CR861166.1| Pongo pygmaeus mRNA; cDNA DKFZp459P2416 (from cl...	46	0.10
257	emb|CR860584.1| Pongo pygmaeus mRNA; cDNA DKFZp459L1519 (from cl...	46	0.10
258	emb|CR859135.1| Pongo pygmaeus mRNA; cDNA DKFZp459D1928 (from cl...	46	0.10
259	dbj|D87511.1| Trypanosoma cruzi mRNA for heat shock protein 70, ...	46	0.10
260	emb|CR623327.1| full-length cDNA clone CL0BB012ZA08 of Neuroblas...	46	0.10
261	emb|CR618855.1| full-length cDNA clone CS0DA004YH14 of Neuroblas...	46	0.10
262	dbj|AK096100.1| Homo sapiens cDNA FLJ38781 fis, clone LIVER20002...	46	0.10
263	emb|CR619085.1| full-length cDNA clone CS0DF008YL15 of Fetal bra...	46	0.10
264	emb|CR618452.1| full-length cDNA clone CS0DA004YF21 of Neuroblas...	46	0.10
265	emb|CR617847.1| full-length cDNA clone CS0DN003YP05 of Adult bra...	46	0.10
266	emb|CR614382.1| full-length cDNA clone CS0CAP006YL11 of Thymus o...	46	0.10
267	emb|CR609237.1| full-length cDNA clone CL0BA012ZA08 of Placenta ...	46	0.10
268	emb|CR605894.1| full-length cDNA clone CS0DA003YN07 of Neuroblas...	46	0.10
269	emb|CR599778.1| full-length cDNA clone CS0DE006YC12 of Placenta ...	46	0.10
270	emb|CR598455.1| full-length cDNA clone CS0DA003YC01 of Neuroblas...	46	0.10
271	emb|CR598352.1| full-length cDNA clone CS0DF006YL22 of Fetal bra...	46	0.10
272	emb|CR597390.1| full-length cDNA clone CS0DF009YO17 of Fetal bra...	46	0.10
273	gb|AE012421.1| Xanthomonas campestris pv. campestris str. ATCC 3...	46	0.10
274	dbj|AB073886.1| Homo sapiens primary neuroblastoma cDNA, clone:N...	46	0.10
275	gb|BC015699.1|BC015699 Homo sapiens, clone IMAGE:3906958, mRNA, ...	46	0.10
276	gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ...	46	0.10
277	gb|AF217511.1|AF217511 Homo sapiens uncharacterized bone marrow ...	46	0.10
278	gb|AF352832.1|AF352832 Homo sapiens constitutive heat shock prot...	46	0.10
279	emb|BX833094.1|CNS0A0GB Arabidopsis thaliana Full-length cDNA Co...	46	0.10
280	dbj|AK222785.1| Homo sapiens mRNA for heat shock 70kDa protein 8...	46	0.10
281	dbj|AB072749.1| Macaca fascicularis testis cDNA clone:QtsA-16150...	46	0.10
282	gb|AC007207.22| Homo sapiens 12 BAC RP11-320N7 (Roswell Park Can...	46	0.10
283	gb|AF291716.1|AF291716 Leishmania braziliensis heat shock protei...	46	0.10
284	gb|AF194819.1|AF194819 Manduca sexta heat shock cognate 70 prote...	46	0.10
285	gb|AY161271.1| Spodoptera frugiperda heat shock cognate 70 prote...	46	0.10
286	gb|AF142571.1|AF142571 Saguinus oedipus intracellular vitamin D ...	46	0.10
287	dbj|AK000571.1| Homo sapiens cDNA FLJ20564 fis, clone KAT12033	46	0.10
288	dbj|AK129885.1| Homo sapiens cDNA FLJ26375 fis, clone HRT06292, ...	46	0.10
289	dbj|AK110255.1| Oryza sativa (japonica cultivar-group) cDNA clon...	46	0.10
290	gb|AY423555.2| Dicentrarchus labrax HSP70 (HSP70) mRNA, complete...	46	0.10
291	dbj|AP000926.6| Homo sapiens genomic DNA, chromosome 11 clone:RP...	46	0.10
292	gb|L14604.1|LEIHSP70C Leishmania amazonensis heat shock protein ...	46	0.10
293	emb|X73685.1|CAHSP C.aethiops hsp70 mRNA	46	0.10
294	gb|M26595.1|TRBHSP70AB T.cruzi heat shock protein (HSP70) gene, ...	46	0.10
295	gb|AY485988.1| Vigna radiata 70 kDa heat shock cognate protein 3...	44	0.41
296	gb|AY422994.1| Danio rerio heat shock 70kDa protein 8 (HSPA8) mR...	44	0.41
297	gb|AY538777.1| Pimephales promelas heat shock cognate 70 kDa pro...	44	0.41
298	gb|AY524794.1| Thellungiella halophila heat shock cognate protei...	44	0.41
299	emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ...	44	0.41
300	gb|AY288515.1| Trypanoplasma borreli heat shock protein 70 gene,...	44	0.41
301	emb|CR635883.2|CNS0EPM9 Tetraodon nigroviridis full-length cDNA	44	0.41
302	ref|XM_797014.1| PREDICTED: Strongylocentrotus purpuratus simila...	44	0.41
303	ref|XM_775743.1| PREDICTED: Strongylocentrotus purpuratus simila...	44	0.41
304	ref|XM_797002.1| PREDICTED: Strongylocentrotus purpuratus simila...	44	0.41
305	ref|XM_796989.1| PREDICTED: Strongylocentrotus purpuratus simila...	44	0.41
306	ref|XM_796976.1| PREDICTED: Strongylocentrotus purpuratus simila...	44	0.41
307	ref|XM_796964.1| PREDICTED: Strongylocentrotus purpuratus simila...	44	0.41
308	ref|XM_796945.1| PREDICTED: Strongylocentrotus purpuratus simila...	44	0.41
309	emb|Y11413.1|DRHSC70 D.rerio hsc70 mRNA	44	0.41
310	emb|X62485.1|LB70HSP L.brasiliensis mRNA for 70 Kd heat shock pr...	44	0.41
311	gb|M87878.1| Leishmania braziliensis heat shock protein 70 (HSP7...	44	0.41
312	gb|L01500.1|DROHSC4A Drosophila melanogaster heat shock protein ...	44	0.41
313	gb|AY072815.1| Chlorella zofingiensis heat shock protein 70 mRNA...	44	0.41
314	ref|XM_687844.1| PREDICTED: Danio rerio similar to Heat shock pr...	44	0.41
315	gb|AF227986.1|AF227986 Rivulus marmoratus HSC71 gene, complete cds	44	0.41
316	gb|AY233001.1| Kryptolebias marmoratus heat shock cognate 71 (Hs...	44	0.41
317	emb|BX276087.14| Zebrafish DNA sequence from clone CH211-270M20 ...	44	0.41
318	gb|BC063228.1| Danio rerio heat shock protein 8, mRNA (cDNA clon...	44	0.41
319	gb|BC045841.1| Danio rerio heat shock protein 8, mRNA (cDNA clon...	44	0.41
320	ref|NM_131401.1| Danio rerio heat shock protein 8 (hspa8), mRNA	44	0.41
321	dbj|AB006814.1| Paralichthys olivaceus mRNA for hsc71, complete cds	44	0.41
322	gb|L77146.1|ZEFHSC7R Danio rerio heat shock cognate (hsc70) mRNA...	44	0.41
323	emb|BX120005.6| Zebrafish DNA sequence from clone RP71-56I13 in ...	44	0.41
324	gb|AF053059.1|AF053059 Paralichthys olivaceus heat shock protein...	44	0.41
325	gb|U58209.1|ZMU58209 Zea mays lumenal binding protein cBiPe3 mRN...	44	0.41
326	gb|U58208.1|ZMU58208 Zea mays lumenal binding protein cBiPe2 mRN...	44	0.41
327	gb|BC066491.1| Danio rerio heat shock protein 8, mRNA (cDNA clon...	44	0.41
328	gb|M59449.1|MZEB70A Zea mays polypeptide chain-binding protein m...	44	0.41
329	gb|AY651255.1| Cryptobia helicis heat shock protein 70 cytosolic...	42	1.6
330	gb|AC150414.2| Branchiostoma floridae clone CH302-62C22, complet...	42	1.6
331	ref|XM_463631.1| Oryza sativa (japonica cultivar-group), predic...	42	1.6
332	gb|AY617976.1| Sterkiella histriomuscorum clone UGC1O0006_M14_R ...	42	1.6
333	gb|AY618164.1| Sterkiella histriomuscorum clone UGC1O0006_M22_R ...	42	1.6
334	gb|AY748350.1| Fenneropenaeus chinensis heat shock protein 70 co...	42	1.6
335	ref|XM_872816.1| PREDICTED: Bos taurus similar to Septin-11, tra...	42	1.6
336	ref|XM_864283.1| PREDICTED: Bos taurus similar to Septin-11, tra...	42	1.6
337	ref|XM_615857.2| PREDICTED: Bos taurus similar to Septin-11, tra...	42	1.6
338	emb|AJ249329.1|CSA249329 Cucumis sativus mRNA for heat shock pro...	42	1.6
339	gb|DQ173923.1| Homarus americanus heat shock protein 70 mRNA, co...	42	1.6
340	gb|AF474375.1| Penaeus monodon heat shock protein 70 mRNA, compl...	42	1.6
341	emb|X85798.1|LIHSP70 L.infantum hsp70 gene	42	1.6
342	gb|AE011965.1| Xanthomonas axonopodis pv. citri str. 306, secti...	42	1.6
343	dbj|AP007169.1| Aspergillus oryzae RIB40 genomic DNA, SC038	42	1.6
344	dbj|AB240143.1| Chlorella pyrenoidosa hsp70 mRNA for heat shock ...	42	1.6
345	gb|AF421541.1| Crypthecodinium cohnii Hsp90 mRNA, complete cds	42	1.6
346	emb|AL116551.1|CNS01D9R Botrytis cinerea strain T4 cDNA library	42	1.6
347	emb|AL116529.1|CNS01D95 Botrytis cinerea strain T4 cDNA library	42	1.6
348	emb|AL116524.1|CNS01D90 Botrytis cinerea strain T4 cDNA library	42	1.6
349	emb|AL116406.1|CNS01D5Q Botrytis cinerea strain T4 cDNA library	42	1.6
350	emb|AL115343.1|CNS01CC7 Botrytis cinerea strain T4 cDNA library	42	1.6
351	emb|AL115335.1|CNS01CBZ Botrytis cinerea strain T4 cDNA library	42	1.6
352	emb|AL115184.1|CNS01C7S Botrytis cinerea strain T4 cDNA library	42	1.6
353	emb|AL113611.1|CNS01B03 Botrytis cinerea strain T4 cDNA library	42	1.6
354	emb|AL112912.1|CNS01AGO Botrytis cinerea strain T4 cDNA library	42	1.6
355	emb|AL112762.1|CNS01ACI Botrytis cinerea strain T4 cDNA library	42	1.6
356	emb|AL112751.1|CNS01AC7 Botrytis cinerea strain T4 cDNA library	42	1.6
357	emb|AL112598.1|CNS01A7Y Botrytis cinerea strain T4 cDNA library	42	1.6
358	emb|AL112279.1|CNS019Z3 Botrytis cinerea strain T4 cDNA library	42	1.6
359	emb|AL110798.1|CNS018TZ Botrytis cinerea strain T4 cDNA library	42	1.6
360	dbj|AP003437.3| Oryza sativa (japonica cultivar-group) genomic D...	42	1.6
361	dbj|AP006843.2| Oryza sativa (japonica cultivar-group) genomic D...	42	1.6
362	gb|AY729863.1| Guillardia theta heat shock protein 90 gene, part...	42	1.6
363	gb|L14605.1|LEIHSP70G Leishmania amazonensis heat shock protein ...	42	1.6
364	gb|U08820.1|PSU08820 Pisum sativum HSP70b mRNA, partial cds	42	1.6
365	gb|CP000148.1| Geobacter metallireducens GS-15, complete genome	40	6.3
366	gb|AC009388.5| Drosophila melanogaster clone BACR11P22, complete...	40	6.3
367	gb|AC108761.2| Oryza sativa (japonica cultivar-group) chromosome...	40	6.3
368	gb|AC152826.2| Mus musculus BAC clone RP23-111C21 from chromosom...	40	6.3
369	ref|XM_870731.1| PREDICTED: Bos taurus similar to Heat shock cog...	40	6.3
370	ref|XM_590005.2| PREDICTED: Bos taurus similar to MEGF11 protein...	40	6.3
371	gb|AY645906.1| Litopenaeus vannamei heat shock protein 70 gene, ...	40	6.3
372	ref|NM_020804.2| Homo sapiens protein kinase C and casein kinase...	40	6.3
373	ref|NM_019400.1| Mus musculus rabaptin, RAB GTPase binding effec...	40	6.3
374	gb|AY702003.1| Leishmania donovani strain MHOM/IN/1983/AG83 heat...	40	6.3
375	gb|AC116569.6| Mus musculus BAC clone RP23-59O19 from chromosome...	40	6.3
376	gb|AC138173.2| Mus musculus strain C57BL/6J clone rp23-364j24 ma...	40	6.3
377	ref|XM_751924.1| Ustilago maydis 521 hypothetical protein (UM008...	40	6.3
378	ref|XM_389647.1| Gibberella zeae PH-1 chromosome 4 GR78_NEUCR 78...	40	6.3
379	gb|AC125075.4| Mus musculus BAC clone RP23-468P13 from chromosom...	40	6.3
380	ref|XM_531893.2| PREDICTED: Canis familiaris similar to MEGF10 p...	40	6.3
381	gb|BC009814.1| Mus musculus rabaptin, RAB GTPase binding effecto...	40	6.3
382	emb|Z80223.1|CEF26D10 Caenorhabditis elegans Cosmid F26D10, comp...	40	6.3
383	gb|AY236713.1| Goniomonas sp. ATCC 50108 heat shock protein 90 (...	40	6.3
384	gb|AC122207.2| Mus musculus BAC clone RP23-88I22 from 16, comple...	40	6.3
385	gb|BC060166.1| Mus musculus rabaptin, RAB GTPase binding effecto...	40	6.3
386	emb|CR730635.1|CNS0GQPC Tetraodon nigroviridis full-length cDNA	40	6.3
387	emb|CR728398.2|CNS0GOZ8 Tetraodon nigroviridis full-length cDNA	40	6.3
388	emb|CR727568.2|CNS0GOC6 Tetraodon nigroviridis full-length cDNA	40	6.3
389	emb|CR724923.2|CNS0GMAP Tetraodon nigroviridis full-length cDNA	40	6.3
390	emb|CR697314.2|CNS0G0ZY Tetraodon nigroviridis full-length cDNA	40	6.3
391	emb|CR688052.2|CNS0FTUO Tetraodon nigroviridis full-length cDNA	40	6.3
392	emb|CR680851.1|CNS0FOAN Tetraodon nigroviridis full-length cDNA	40	6.3
393	emb|CR679231.2|CNS0FN1N Tetraodon nigroviridis full-length cDNA	40	6.3
394	emb|CR678387.2|CNS0FMEC Tetraodon nigroviridis full-length cDNA	40	6.3
395	emb|CR678206.2|CNS0FM9E Tetraodon nigroviridis full-length cDNA	40	6.3
396	emb|CR677879.2|CNS0FM0F Tetraodon nigroviridis full-length cDNA	40	6.3
397	emb|CR676221.1|CNS0FKQH Tetraodon nigroviridis full-length cDNA	40	6.3
398	gb|BC040228.1| Homo sapiens protein kinase C and casein kinase s...	40	6.3
399	emb|CR675491.2|CNS0FK6H Tetraodon nigroviridis full-length cDNA	40	6.3
400	emb|CR673489.2|CNS0FIMV Tetraodon nigroviridis full-length cDNA	40	6.3
401	emb|CR672845.2|CNS0FI4Z Tetraodon nigroviridis full-length cDNA	40	6.3
402	emb|CR672362.2|CNS0FHRK Tetraodon nigroviridis full-length cDNA	40	6.3
403	emb|CR671835.1|CNS0FHCX Tetraodon nigroviridis full-length cDNA	40	6.3
404	emb|CR671553.1|CNS0FH53 Tetraodon nigroviridis full-length cDNA	40	6.3
405	emb|CR668547.2|CNS0FETL Tetraodon nigroviridis full-length cDNA	40	6.3
406	emb|CR667337.2|CNS0FDVZ Tetraodon nigroviridis full-length cDNA	40	6.3
407	emb|CR664940.1|CNS0FC1E Tetraodon nigroviridis full-length cDNA	40	6.3
408	emb|CR666378.2|CNS0FD5C Tetraodon nigroviridis full-length cDNA	40	6.3
409	emb|CR664943.2|CNS0FC1H Tetraodon nigroviridis full-length cDNA	40	6.3
410	emb|CR662944.2|CNS0FAHY Tetraodon nigroviridis full-length cDNA	40	6.3
411	emb|CR662235.2|CNS0F9Y9 Tetraodon nigroviridis full-length cDNA	40	6.3
412	emb|CR661932.2|CNS0F9PU Tetraodon nigroviridis full-length cDNA	40	6.3
413	emb|CR659745.1|CNS0F813 Tetraodon nigroviridis full-length cDNA	40	6.3
414	gb|AC119816.5| Mus musculus chromosome 5, clone RP23-59B8, compl...	40	6.3
415	ref|NM_019124.1| Rattus norvegicus rabaptin, RAB GTPase binding ...	40	6.3
416	emb|CR936845.11| Mouse DNA sequence from clone DN-279H6 on chrom...	40	6.3
417	gb|AC163665.4| Mus musculus BAC clone RP23-325J23 from chromosom...	40	6.3
418	gb|AC160532.4| Mus musculus chromosome 5, clone RP24-158N23, com...	40	6.3
419	gb|AC068858.10| Homo sapiens chromosome 11, clone RP11-255G5, co...	40	6.3
420	emb|Y11528.1|ANSSPB Aspergillus niger partial sspB gene for heat...	40	6.3
421	emb|X60088.1|DCHSP70 Carrot hsp70 gene for heat shock protein 70	40	6.3
422	emb|CR861449.1| Pongo pygmaeus mRNA; cDNA DKFZp459D242 (from clo...	40	6.3
423	emb|CR859322.1| Pongo pygmaeus mRNA; cDNA DKFZp459F0227 (from cl...	40	6.3
424	emb|AL834211.1|HSM805614 Homo sapiens mRNA; cDNA DKFZp761O232 (f...	40	6.3
425	emb|AL596136.5| Mouse DNA sequence from clone RP23-83I13 on chro...	40	6.3
426	emb|AJ318883.1|OED318883 Ostrea edulis partial hsp70 gene for he...	40	6.3
427	emb|AJ318882.1|CGI318882 Crassostrea gigas partial hsp70 gene fo...	40	6.3
428	emb|AJ305316.1|OED305316 Ostrea edulis hsc70 gene, exons 1-6	40	6.3
429	emb|AJ305315.1|CGI305315 Crassostrea gigas hsc70 gene, exons 1-6	40	6.3
430	dbj|AK061896.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	6.3
431	dbj|AP003281.3| Oryza sativa (japonica cultivar-group) genomic D...	40	6.3
432	dbj|AB205151.1| Brevundimonas diminuta orf1-orf7 genes for hypot...	40	6.3
433	dbj|AB252419.1| Uncultured bacterium hmbp gene for heavy metal-b...	40	6.3
434	gb|AC010114.6| Drosophila melanogaster 3L BAC RP98-10P9 (Roswell...	40	6.3
435	gb|AC091218.2| Drosophila melanogaster 3L BAC RP98-3E24 (Roswell...	40	6.3
436	gb|AY113617.1| Drosophila melanogaster RH65663 full insert cDNA	40	6.3
437	ref|NM_168310.1| Drosophila melanogaster smaug CG5263-RC, transc...	40	6.3
438	ref|NM_168309.1| Drosophila melanogaster smaug CG5263-RB, transc...	40	6.3
439	dbj|AB214973.1| Plutella xylostella hsc70 mRNA for heat shock co...	40	6.3
440	ref|NM_143338.2| Drosophila melanogaster CG12259-RA (CG12259), mRNA	40	6.3
441	ref|NM_079263.2| Drosophila melanogaster smaug CG5263-RA, transc...	40	6.3
442	dbj|AK137236.1| Mus musculus adult male urinary bladder cDNA, RI...	40	6.3
443	dbj|AK134587.1| Mus musculus adult male medulla oblongata cDNA, ...	40	6.3
444	dbj|AK151901.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	40	6.3
445	gb|AC161601.4| Mus musculus BAC clone RP23-333L19 from chromosom...	40	6.3
446	gb|AY058607.1| Drosophila melanogaster LD30037 full length cDNA	40	6.3
447	gb|AC159265.2| Mus musculus BAC clone RP23-462H20 from chromosom...	40	6.3
448	gb|AC011806.1|AC011806 Genomic Sequence For Oryza sativa Clone 1...	40	6.3
449	gb|AC018763.6| Homo sapiens chromosome 5 clone CTD-2305C23, comp...	40	6.3
450	dbj|AK019413.1| Mus musculus 13 days embryo head cDNA, RIKEN ful...	40	6.3
451	ref|NM_070667.2| Caenorhabditis elegans Heat Shock Protein famil...	40	6.3
452	gb|AY847068.1| Toxoplasma gondii dual-family immunophilin 57 kDa...	40	6.3
453	dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D...	40	6.3
454	gb|AF242529.1|AF242529 Homo sapiens protein kinase C and casein ...	40	6.3
455	gb|AY150182.1| Balanus amphitrite 70kDa heat shock protein mRNA,...	40	6.3
456	gb|AY691667.1| Oxyuranus scutellatus scutellatus HSP70 mRNA, com...	40	6.3
457	emb|BX324208.5| Zebrafish DNA sequence from clone RP71-38B8 in l...	40	6.3
458	gb|AF248490.1|AF248490 Mus musculus rabaptin-5gamma mRNA, comple...	40	6.3
459	gb|AF144646.1|AF144646 Crassostrea gigas heat shock protein 70 (...	40	6.3
460	dbj|D21284.1|RICAD167 Oryza sativa AD167 mRNA for heat shock pro...	40	6.3
461	dbj|D29709.1|RICYK21 Oryza sativa mRNA, partial homologous to he...	40	6.3
462	dbj|AP003105.2| Oryza sativa (japonica cultivar-group) genomic D...	40	6.3
463	dbj|AP005392.3| Oryza sativa (japonica cultivar-group) genomic D...	40	6.3
464	dbj|AP003236.3| Oryza sativa (japonica cultivar-group) genomic D...	40	6.3
465	gb|AF132213.1|AF132213 Drosophila melanogaster smaug protein mRN...	40	6.3
466	dbj|AP005728.2| Oryza sativa (japonica cultivar-group) genomic D...	40	6.3
467	dbj|AB122064.1| Crassostrea gigas HSC71 mRNA for 71kDa heat shoc...	40	6.3
468	dbj|AK121906.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	6.3
469	dbj|AK119663.1| Oryza sativa (japonica cultivar-group) cDNA clon...	40	6.3
470	emb|Y08903.1|ATHSC70G7 A.thaliana mRNA for HSC70-G7 protein, par...	40	6.3
471	ref|XM_309751.2| Anopheles gambiae str. PEST ENSANGP00000012762 ...	40	6.3
472	gb|AC148295.3| Mus musculus BAC clone RP24-346N5 from 3, complet...	40	6.3
473	gb|AF159852.1|AF159852 Drosophila melanogaster RNA-binding prote...	40	6.3
474	gb|AE003763.3| Drosophila melanogaster chromosome 3R, section 10...	40	6.3
475	gb|AF104402.1|AF104402 Rattus norvegicus syndapin I mRNA, comple...	40	6.3
476	gb|AE003553.3| Drosophila melanogaster chromosome 3L, section 32...	40	6.3
477	gb|AC124990.16| Mus musculus chromosome 3, clone RP24-283J17, co...	40	6.3
478	ref|NM_017294.1| Rattus norvegicus protein kinase C and casein k...	40	6.3
479	emb|BX001057.4| Zebrafish DNA sequence from clone CH211-89G13 in...	40	6.3
480	gb|BC080274.1| Mus musculus cDNA clone IMAGE:6852593, containing...	40	6.3
481	gb|U81165.1|PAU81165 Podospora anserina suppressor of vegetative...	40	6.3
482	emb|Z82285.1|CET28F3 Caenorhabditis elegans Cosmid T28F3, comple...	40	6.3
483	gb|U70777.1|RNU70777 Rattus norvegicus rabaptin mRNA, complete cds	40	6.3
484	emb|AL512346.41| Mouse DNA sequence from clone RP23-322E15 on ch...	40	6.3
485	gb|M18540.1|CELHSP70 C.elegans heat shock protein 70A gene, comp...	40	6.3
486	dbj|D85844.1| Rattus norvegicus mRNA for rat rabaptin-5, complet...	40	6.3
487	dbj|D86066.1| Mus musculus mRNA for mouse rabaptin-5, complete cds	40	6.3
488	dbj|AB001750.1| Mus musculus mRNA for neurocrescin, complete cds	40	6.3
489	dbj|AB037800.2| Homo sapiens mRNA for KIAA1379 protein, partial cds	40	6.3

---

>gb|BT016462.1| Zea mays clone Contig295 mRNA sequence
          Length = 1014

 Score =  198 bits (100), Expect = 1e-47
 Identities = 207/243 (85%), Gaps = 6/243 (2%)
 Strand = Plus / Minus

                                                                       
Query: 229 ttagtcgacctcctcgatcttggggccagggccgccggatgcagcaggggtgtcatcgtc 288
           |||||| |||||||||||||||||||||||||| |||  | |||| || | ||| |||||
Sbjct: 848 ttagtccacctcctcgatcttggggccagggccaccgcttccagccggagcgtcctcgtc 789

                                                                       
Query: 289 catgccaccctc------catgtcggcaccagcaccctggtacatcttggcgatgatggg 342
           |||||| ||  |      |||||||||||| || ||||||||||||||||||||||||||
Sbjct: 788 catgccgccggcgccacccatgtcggcacccgcgccctggtacatcttggcgatgatggg 729

                                                                       
Query: 343 gttgcacagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagcaagctg 402
           |||||| |||  ||||||||||||||||||||| || | |||||||||||| || |||||
Sbjct: 728 gttgcaaaggctctccagctccttcatcttgtcatcgaactcgtccgcctcggcgagctg 669

                                                                       
Query: 403 gttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtc 462
           ||| | |||||||||   |||||| || |||||||| |||||||||||||||||||||||
Sbjct: 668 gttggcgtccagccagctgatggccgcgtcgatggcgtcctcgatcttcttcttgtcgtc 609

              
Query: 463 ggc 465
           |||
Sbjct: 608 ggc 606

---

>gb|AY914601.1| Zea mays heat shock protein 70 mRNA, partial cds
          Length = 1284

 Score =  198 bits (100), Expect = 1e-47
 Identities = 207/243 (85%), Gaps = 6/243 (2%)
 Strand = Plus / Minus

                                                                        
Query: 229  ttagtcgacctcctcgatcttggggccagggccgccggatgcagcaggggtgtcatcgtc 288
            |||||| |||||||||||||||||||||||||| |||  | |||| || | ||| |||||
Sbjct: 1123 ttagtccacctcctcgatcttggggccagggccaccgcttccagccggagcgtcctcgtc 1064

                                                                        
Query: 289  catgccaccctc------catgtcggcaccagcaccctggtacatcttggcgatgatggg 342
            |||||| ||  |      |||||||||||| || ||||||||||||||||||||||||||
Sbjct: 1063 catgccgccggcgccacccatgtcggcacccgcgccctggtacatcttggcgatgatggg 1004

                                                                        
Query: 343  gttgcacagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagcaagctg 402
            |||||| |||  ||||||||||||||||||||| || | |||||||||||| || |||||
Sbjct: 1003 gttgcaaaggctctccagctccttcatcttgtcatcgaactcgtccgcctcggcgagctg 944

                                                                        
Query: 403  gttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtc 462
            ||| | |||||||||   |||||| || |||||||| |||||||||||||||||||||||
Sbjct: 943  gttggcgtccagccagctgatggccgcgtcgatggcgtcctcgatcttcttcttgtcgtc 884

               
Query: 463  ggc 465
            |||
Sbjct: 883  ggc 881

---

>gb|AY109330.1| Zea mays CL45_1 mRNA sequence
          Length = 3772

 Score =  198 bits (100), Expect = 1e-47
 Identities = 207/243 (85%), Gaps = 6/243 (2%)
 Strand = Plus / Minus

                                                                        
Query: 229  ttagtcgacctcctcgatcttggggccagggccgccggatgcagcaggggtgtcatcgtc 288
            |||||| |||||||||||||||||||||||||| |||  | |||| || | ||| |||||
Sbjct: 3222 ttagtccacctcctcgatcttggggccagggccaccgcttccagccggagcgtcctcgtc 3163

                                                                        
Query: 289  catgccaccctc------catgtcggcaccagcaccctggtacatcttggcgatgatggg 342
            |||||| ||  |      |||||||||||| || ||||||||||||||||||||||||||
Sbjct: 3162 catgccgccggcgccacccatgtcggcacccgcgccctggtacatcttggcgatgatggg 3103

                                                                        
Query: 343  gttgcacagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagcaagctg 402
            |||||| |||  ||||||||||||||||||||| || | |||||||||||| || |||||
Sbjct: 3102 gttgcaaaggctctccagctccttcatcttgtcatcgaactcgtccgcctcggcgagctg 3043

                                                                        
Query: 403  gttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtc 462
            ||| | |||||||||   |||||| || |||||||| |||||||||||||||||||||||
Sbjct: 3042 gttggcgtccagccagctgatggccgcgtcgatggcgtcctcgatcttcttcttgtcgtc 2983

               
Query: 463  ggc 465
            |||
Sbjct: 2982 ggc 2980

---

>gb|BT016812.1| Zea mays clone Contig645 mRNA sequence
          Length = 2327

 Score =  192 bits (97), Expect = 7e-46
 Identities = 210/248 (84%), Gaps = 6/248 (2%)
 Strand = Plus / Minus

                                                                        
Query: 229  ttagtcgacctcctcgatcttggggccagggccgccggatgcagcaggggtgtcatcgtc 288
            |||||| ||||||||||||||||||||||||||||||    | ||||||| ||| |||||
Sbjct: 1834 ttagtccacctcctcgatcttggggccagggccgccgctgccggcaggggcgtcctcgtc 1775

                                                                        
Query: 289  catgccaccctc------catgtcggcaccagcaccctggtacatcttggcgatgatggg 342
            |||||| ||  |      ||||||  |||| || ||||||||||||||||||||||||||
Sbjct: 1774 catgccgccagcgccgcccatgtcttcacccgcgccctggtacatcttggcgatgatggg 1715

                                                                        
Query: 343  gttgcacagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagcaagctg 402
            |||||| |||  ||||||||||||||||||||| || | |||||||||||| || |||||
Sbjct: 1714 gttgcagaggctctccagctccttcatcttgtcctcgaactcgtccgcctcggcgagctg 1655

                                                                        
Query: 403  gttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtc 462
            ||| | |||||||||   |||||| || |||||||| |||||||||||||||||||| ||
Sbjct: 1654 gttggcgtccagccagctgatggccgcgtcgatggcgtcctcgatcttcttcttgtcatc 1595

                    
Query: 463  ggccggca 470
            ||||||||
Sbjct: 1594 ggccggca 1587

---

>emb|X78415.1|ZMHSP705 Z.mays (cv DH5xDH7) hsp70-5 mRNA for heat shock protein 70
          Length = 842

 Score =  182 bits (92), Expect = 7e-43
 Identities = 205/243 (84%), Gaps = 6/243 (2%)
 Strand = Plus / Minus

                                                                       
Query: 229 ttagtcgacctcctcgatcttggggccagggccgccggatgcagcaggggtgtcatcgtc 288
           |||||| |||||||||||||||||||||||| | |||  | |||| || | ||| |||||
Sbjct: 662 ttagtccacctcctcgatcttggggccaggggcaccgcttccagccggagcgtcctcgtc 603

                                                                       
Query: 289 catgccaccctc------catgtcggcaccagcaccctggtacatcttggcgatgatggg 342
           |||||| ||| |      |||||||||||| || ||||||||||||||||||||||||||
Sbjct: 602 catgccgcccgcgccacccatgtcggcacccgcgccctggtacatcttggcgatgatggg 543

                                                                       
Query: 343 gttgcacagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagcaagctg 402
           |||  | |||  ||||||||||||||||||||| || | |||||||||||| || |||||
Sbjct: 542 gttcgaaaggctctccagctccttcatcttgtcatcgaactcgtccgcctcggcgagctg 483

                                                                       
Query: 403 gttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtc 462
           ||| | |||||||||   |||||| || |||||||| |||||||||||||||||||||||
Sbjct: 482 gttggcgtccagccagctgatggccgcgtcgatggcgtcctcgatcttcttcttgtcgtc 423

              
Query: 463 ggc 465
           |||
Sbjct: 422 ggc 420

---

>gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1281_H05,
             complete sequence
          Length = 163130

 Score =  172 bits (87), Expect = 7e-40
 Identities = 201/239 (84%)
 Strand = Plus / Plus

                                                                         
Query: 227   gtttagtcgacctcctcgatcttggggccagggccgccggatgcagcaggggtgtcatcg 286
             ||||||||||||||||||||||||||||| | ||||| |    | || || | ||| |||
Sbjct: 43944 gtttagtcgacctcctcgatcttggggcctgcgccgctgccgcccgccggcgcgtcctcg 44003

                                                                         
Query: 287   tccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatggggttg 346
             |||||||| ||  |||||||||| || |  ||||||||||||||||||||||| ||||||
Sbjct: 44004 tccatgcctccggccatgtcggcgccggggccctggtacatcttggcgatgatcgggttg 44063

                                                                         
Query: 347   cacagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagcaagctggttc 406
             || | | |||||||||||||||||||||| || | |||||| ||||| || |||||||| 
Sbjct: 44064 cagatgccctccagctccttcatcttgtcctcgaactcgtcggcctcggcgagctggttg 44123

                                                                        
Query: 407   gtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcggc 465
             ||||| |||||   ||||||  |||||||||| ||||||||| ||||||||||||||||
Sbjct: 44124 gtgtcgagccagctgatggcgccatcgatggcgtcctcgatcctcttcttgtcgtcggc 44182

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  172 bits (87), Expect = 7e-40
 Identities = 201/239 (84%)
 Strand = Plus / Plus

                                                                            
Query: 227      gtttagtcgacctcctcgatcttggggccagggccgccggatgcagcaggggtgtcatcg 286
                ||||||||||||||||||||||||||||| | ||||| |    | || || | ||| |||
Sbjct: 22454537 gtttagtcgacctcctcgatcttggggcctgcgccgctgccgcccgccggcgcgtcctcg 22454596

                                                                            
Query: 287      tccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatggggttg 346
                |||||||| ||  |||||||||| || |  ||||||||||||||||||||||| ||||||
Sbjct: 22454597 tccatgcctccggccatgtcggcgccggggccctggtacatcttggcgatgatcgggttg 22454656

                                                                            
Query: 347      cacagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagcaagctggttc 406
                || | | |||||||||||||||||||||| || | |||||| ||||| || |||||||| 
Sbjct: 22454657 cagatgccctccagctccttcatcttgtcctcgaactcgtcggcctcggcgagctggttg 22454716

                                                                           
Query: 407      gtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcggc 465
                ||||| |||||   ||||||  |||||||||| ||||||||| ||||||||||||||||
Sbjct: 22454717 gtgtcgagccagctgatggcgccatcgatggcgtcctcgatcctcttcttgtcgtcggc 22454775

---

>ref|XM_475365.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1941

 Score =  168 bits (85), Expect = 1e-38
 Identities = 199/237 (83%)
 Strand = Plus / Minus

                                                                        
Query: 229  ttagtcgacctcctcgatcttggggccagggccgccggatgcagcaggggtgtcatcgtc 288
            ||||||||||||||||||||||||||| | ||||| |    | || || | ||| |||||
Sbjct: 1941 ttagtcgacctcctcgatcttggggcctgcgccgctgccgcccgccggcgcgtcctcgtc 1882

                                                                        
Query: 289  catgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatggggttgca 348
            |||||| ||  |||||||||| || |  ||||||||||||||||||||||| ||||||||
Sbjct: 1881 catgcctccggccatgtcggcgccggggccctggtacatcttggcgatgatcgggttgca 1822

                                                                        
Query: 349  cagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagcaagctggttcgt 408
             | | |||||||||||||||||||||| || | |||||| ||||| || |||||||| ||
Sbjct: 1821 gatgccctccagctccttcatcttgtcctcgaactcgtcggcctcggcgagctggttggt 1762

                                                                     
Query: 409  gtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcggc 465
            ||| |||||   ||||||  |||||||||| ||||||||| ||||||||||||||||
Sbjct: 1761 gtcgagccagctgatggcgccatcgatggcgtcctcgatcctcttcttgtcgtcggc 1705

---

>gb|AC134045.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0022E16
              map C481S, complete sequence
          Length = 179668

 Score =  167 bits (84), Expect = 4e-38
 Identities = 153/176 (86%)
 Strand = Plus / Minus

                                                                          
Query: 284    tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 343
              ||||||||||| ||  ||||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 135577 tcgtccatgccgccggccatgtccgcgccagcgccctggtacatcttggcgatgatgggg 135518

                                                                          
Query: 344    ttgcacagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagcaagctgg 403
              ||||| | | |||||||||||||||||||||| || | ||| || |||||||| ||||||
Sbjct: 135517 ttgcagatgccctccagctccttcatcttgtcatcgaactcatcagcctcagcgagctgg 135458

                                                                      
Query: 404    ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtc 459
              ||   ||||||||||||||||||    |||||||| ||||||||||||||||||||
Sbjct: 135457 ttgccgtccagccactggatggcctggtcgatggcatcctcgatcttcttcttgtc 135402



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                           
Query: 229    ttagtcgacctcctcgatcttggggccag 257
              |||||||||||||||||||||||||||||
Sbjct: 135638 ttagtcgacctcctcgatcttggggccag 135610

---

>emb|X67711.2|OSHSC70A O.sativa hsp70 gene for heat shock protein 70
          Length = 4791

 Score =  167 bits (84), Expect = 4e-38
 Identities = 153/176 (86%)
 Strand = Plus / Minus

                                                                        
Query: 284  tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 343
            ||||||||||| ||  ||||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 4513 tcgtccatgccgccggccatgtccgcgccagcgccctggtacatcttggcgatgatgggg 4454

                                                                        
Query: 344  ttgcacagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagcaagctgg 403
            ||||| | | |||||||||||||||||||||| || | ||| || |||||||| ||||||
Sbjct: 4453 ttgcagatgccctccagctccttcatcttgtcatcgaactcatcagcctcagcgagctgg 4394

                                                                    
Query: 404  ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtc 459
            ||   ||||||||||||||||||    |||||||| ||||||||||||||||||||
Sbjct: 4393 ttgccgtccagccactggatggcctggtcgatggcatcctcgatcttcttcttgtc 4338



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                         
Query: 229  ttagtcgacctcctcgatcttggggccag 257
            |||||||||||||||||||||||||||||
Sbjct: 4574 ttagtcgacctcctcgatcttggggccag 4546

---

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score =  167 bits (84), Expect = 4e-38
 Identities = 153/176 (86%)
 Strand = Plus / Minus

                                                                            
Query: 284      tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 343
                ||||||||||| ||  ||||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 28177022 tcgtccatgccgccggccatgtccgcgccagcgccctggtacatcttggcgatgatgggg 28176963

                                                                            
Query: 344      ttgcacagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagcaagctgg 403
                ||||| | | |||||||||||||||||||||| || | ||| || |||||||| ||||||
Sbjct: 28176962 ttgcagatgccctccagctccttcatcttgtcatcgaactcatcagcctcagcgagctgg 28176903

                                                                        
Query: 404      ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtc 459
                ||   ||||||||||||||||||    |||||||| ||||||||||||||||||||
Sbjct: 28176902 ttgccgtccagccactggatggcctggtcgatggcatcctcgatcttcttcttgtc 28176847



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                             
Query: 229      ttagtcgacctcctcgatcttggggccag 257
                |||||||||||||||||||||||||||||
Sbjct: 28177083 ttagtcgacctcctcgatcttggggccag 28177055

---

>dbj|AK119710.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-E11, full
           insert sequence
          Length = 529

 Score =  167 bits (84), Expect = 4e-38
 Identities = 153/176 (86%)
 Strand = Plus / Minus

                                                                       
Query: 284 tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 343
           ||||||||||| ||  ||||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 253 tcgtccatgccgccggccatgtccgcgccagcgccctggtacatcttggcgatgatgggg 194

                                                                       
Query: 344 ttgcacagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagcaagctgg 403
           ||||| | | |||||||||||||||||||||| || | ||| || |||||||| ||||||
Sbjct: 193 ttgcagatgccctccagctccttcatcttgtcatcgaactcatcagcctcagcgagctgg 134

                                                                   
Query: 404 ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtc 459
           ||   ||||||||||||||||||    |||||||| ||||||||||||||||||||
Sbjct: 133 ttgccgtccagccactggatggcctggtcgatggcatcctcgatcttcttcttgtc 78



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                        
Query: 229 ttagtcgacctcctcgatcttggggccag 257
           |||||||||||||||||||||||||||||
Sbjct: 314 ttagtcgacctcctcgatcttggggccag 286

---

>dbj|AK119255.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-123-H02, full
            insert sequence
          Length = 2311

 Score =  167 bits (84), Expect = 4e-38
 Identities = 153/176 (86%)
 Strand = Plus / Minus

                                                                        
Query: 284  tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 343
            ||||||||||| ||  ||||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 2063 tcgtccatgccgccggccatgtccgcgccagcgccctggtacatcttggcgatgatgggg 2004

                                                                        
Query: 344  ttgcacagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagcaagctgg 403
            ||||| | | |||||||||||||||||||||| || | ||| || |||||||| ||||||
Sbjct: 2003 ttgcagatgccctccagctccttcatcttgtcatcgaactcatcagcctcagcgagctgg 1944

                                                                    
Query: 404  ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtc 459
            ||   ||||||||||||||||||    |||||||| ||||||||||||||||||||
Sbjct: 1943 ttgccgtccagccactggatggcctggtcgatggcatcctcgatcttcttcttgtc 1888



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                         
Query: 229  ttagtcgacctcctcgatcttggggccag 257
            |||||||||||||||||||||||||||||
Sbjct: 2124 ttagtcgacctcctcgatcttggggccag 2096

---

>dbj|AK065431.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013021C17, full
            insert sequence
          Length = 2380

 Score =  167 bits (84), Expect = 4e-38
 Identities = 153/176 (86%)
 Strand = Plus / Minus

                                                                        
Query: 284  tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 343
            ||||||||||| ||  ||||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 1961 tcgtccatgccgccggccatgtccgcgccagcgccctggtacatcttggcgatgatgggg 1902

                                                                        
Query: 344  ttgcacagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagcaagctgg 403
            ||||| | | |||||||||||||||||||||| || | ||| || |||||||| ||||||
Sbjct: 1901 ttgcagatgccctccagctccttcatcttgtcatcgaactcatcagcctcagcgagctgg 1842

                                                                    
Query: 404  ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtc 459
            ||   ||||||||||||||||||    |||||||| ||||||||||||||||||||
Sbjct: 1841 ttgccgtccagccactggatggcctggtcgatggcatcctcgatcttcttcttgtc 1786



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                         
Query: 229  ttagtcgacctcctcgatcttggggccag 257
            |||||||||||||||||||||||||||||
Sbjct: 2022 ttagtcgacctcctcgatcttggggccag 1994

---

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  167 bits (84), Expect = 4e-38
 Identities = 153/176 (86%)
 Strand = Plus / Minus

                                                                            
Query: 284      tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 343
                ||||||||||| ||  ||||||| || ||||| |||||||||||||||||||||||||||
Sbjct: 28161900 tcgtccatgccgccggccatgtccgcgccagcgccctggtacatcttggcgatgatgggg 28161841

                                                                            
Query: 344      ttgcacagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagcaagctgg 403
                ||||| | | |||||||||||||||||||||| || | ||| || |||||||| ||||||
Sbjct: 28161840 ttgcagatgccctccagctccttcatcttgtcatcgaactcatcagcctcagcgagctgg 28161781

                                                                        
Query: 404      ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtc 459
                ||   ||||||||||||||||||    |||||||| ||||||||||||||||||||
Sbjct: 28161780 ttgccgtccagccactggatggcctggtcgatggcatcctcgatcttcttcttgtc 28161725



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                             
Query: 229      ttagtcgacctcctcgatcttggggccag 257
                |||||||||||||||||||||||||||||
Sbjct: 28161961 ttagtcgacctcctcgatcttggggccag 28161933

---

>ref|XM_470141.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2522

 Score =  165 bits (83), Expect = 2e-37
 Identities = 128/143 (89%)
 Strand = Plus / Minus

                                                                        
Query: 281  tcatcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 340
            ||||||||||| |||||  |||||||||||||||||||||||||||||||||| || || 
Sbjct: 1990 tcatcgtccattccaccacccatgtcggcaccagcaccctggtacatcttggcaataatt 1931

                                                                        
Query: 341  gggttgcacagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagcaagc 400
            |||||||||||| ||||||||||||||||||||||||| | ||| ||  ||||||| |||
Sbjct: 1930 gggttgcacaggccctccagctccttcatcttgtcttcgaactcttcaacctcagcgagc 1871

                                   
Query: 401  tggttcgtgtccagccactggat 423
            |||||  ||||||||||||||||
Sbjct: 1870 tggttgttgtccagccactggat 1848



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 228  tttagtcgacctcctcgatcttggggccag 257
            |||||||||||||||| ||||| |||||||
Sbjct: 2046 tttagtcgacctcctcaatcttagggccag 2017

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  165 bits (83), Expect = 2e-37
 Identities = 128/143 (89%)
 Strand = Plus / Minus

                                                                            
Query: 281      tcatcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 340
                ||||||||||| |||||  |||||||||||||||||||||||||||||||||| || || 
Sbjct: 34146522 tcatcgtccattccaccacccatgtcggcaccagcaccctggtacatcttggcaataatt 34146463

                                                                            
Query: 341      gggttgcacagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagcaagc 400
                |||||||||||| ||||||||||||||||||||||||| | ||| ||  ||||||| |||
Sbjct: 34146462 gggttgcacaggccctccagctccttcatcttgtcttcgaactcttcaacctcagcgagc 34146403

                                       
Query: 401      tggttcgtgtccagccactggat 423
                |||||  ||||||||||||||||
Sbjct: 34146402 tggttgttgtccagccactggat 34146380



 Score =  145 bits (73), Expect = 1e-31
 Identities = 151/177 (85%)
 Strand = Plus / Minus

                                                                           
Query: 284     tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 343
               ||||||||||| ||  ||||||| || || || |||||||||||||||||||||||||||
Sbjct: 9344803 tcgtccatgcctccggccatgtcagctccggcgccctggtacatcttggcgatgatgggg 9344744

                                                                           
Query: 344     ttgcacagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagcaagctgg 403
               ||||| | | |||||||||||||||||||||| || | ||| || ||||| || ||||||
Sbjct: 9344743 ttgcagacgccctccagctccttcatcttgtcctcgaactcctcggcctcggcgagctgg 9344684

                                                                        
Query: 404     ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcg 460
               ||  |||| |||||   ||||||| | |||||||| |||||||||||||||||||||
Sbjct: 9344683 ttgctgtcgagccagctgatggcaccgtcgatggcgtcctcgatcttcttcttgtcg 9344627



 Score =  121 bits (61), Expect = 2e-24
 Identities = 127/149 (85%)
 Strand = Plus / Plus

                                                                           
Query: 317     ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 376
               |||||||||||||| | |||||| || ||||| |||  ||| ||||||||||||||||| 
Sbjct: 9383971 ccctggtacatctttgagatgatcggattgcagaggctctcgagctccttcatcttgtcc 9384030

                                                                           
Query: 377     tcaagctcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatg 436
               || | |||||| ||||| || ||||||||   ||| ||||||| ||||||| | ||||||
Sbjct: 9384031 tcgaactcgtcggcctcggcgagctggttgccgtcgagccacttgatggcatcctcgatg 9384090

                                            
Query: 437     gcctcctcgatcttcttcttgtcgtcggc 465
               || ||||||||||||||||||||||||||
Sbjct: 9384091 gcgtcctcgatcttcttcttgtcgtcggc 9384119



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                  
Query: 229     ttagtcgacctcctcgatcttggggccagggccgc 263
               |||||| || ||||||||||||||||||| |||||
Sbjct: 9383868 ttagtccacttcctcgatcttggggccagcgccgc 9383902



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                              
Query: 228      tttagtcgacctcctcgatcttggggccag 257
                |||||||||||||||| ||||| |||||||
Sbjct: 34146578 tttagtcgacctcctcaatcttagggccag 34146549



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 228     tttagtcgacctcctcgatcttggg 252
               |||||||||| ||||||||||||||
Sbjct: 9344868 tttagtcgacttcctcgatcttggg 9344844

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  165 bits (83), Expect = 2e-37
 Identities = 128/143 (89%)
 Strand = Plus / Minus

                                                                            
Query: 281      tcatcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 340
                ||||||||||| |||||  |||||||||||||||||||||||||||||||||| || || 
Sbjct: 34236994 tcatcgtccattccaccacccatgtcggcaccagcaccctggtacatcttggcaataatt 34236935

                                                                            
Query: 341      gggttgcacagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagcaagc 400
                |||||||||||| ||||||||||||||||||||||||| | ||| ||  ||||||| |||
Sbjct: 34236934 gggttgcacaggccctccagctccttcatcttgtcttcgaactcttcaacctcagcgagc 34236875

                                       
Query: 401      tggttcgtgtccagccactggat 423
                |||||  ||||||||||||||||
Sbjct: 34236874 tggttgttgtccagccactggat 34236852



 Score =  145 bits (73), Expect = 1e-31
 Identities = 151/177 (85%)
 Strand = Plus / Minus

                                                                           
Query: 284     tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 343
               ||||||||||| ||  ||||||| || || || |||||||||||||||||||||||||||
Sbjct: 9342924 tcgtccatgcctccggccatgtcagctccggcgccctggtacatcttggcgatgatgggg 9342865

                                                                           
Query: 344     ttgcacagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagcaagctgg 403
               ||||| | | |||||||||||||||||||||| || | ||| || ||||| || ||||||
Sbjct: 9342864 ttgcagacgccctccagctccttcatcttgtcctcgaactcctcggcctcggcgagctgg 9342805

                                                                        
Query: 404     ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcg 460
               ||  |||| |||||   ||||||| | |||||||| |||||||||||||||||||||
Sbjct: 9342804 ttgctgtcgagccagctgatggcaccgtcgatggcgtcctcgatcttcttcttgtcg 9342748



 Score =  121 bits (61), Expect = 2e-24
 Identities = 127/149 (85%)
 Strand = Plus / Plus

                                                                           
Query: 317     ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 376
               |||||||||||||| | |||||| || ||||| |||  ||| ||||||||||||||||| 
Sbjct: 9382092 ccctggtacatctttgagatgatcggattgcagaggctctcgagctccttcatcttgtcc 9382151

                                                                           
Query: 377     tcaagctcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatg 436
               || | |||||| ||||| || ||||||||   ||| ||||||| ||||||| | ||||||
Sbjct: 9382152 tcgaactcgtcggcctcggcgagctggttgccgtcgagccacttgatggcatcctcgatg 9382211

                                            
Query: 437     gcctcctcgatcttcttcttgtcgtcggc 465
               || ||||||||||||||||||||||||||
Sbjct: 9382212 gcgtcctcgatcttcttcttgtcgtcggc 9382240



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                  
Query: 229     ttagtcgacctcctcgatcttggggccagggccgc 263
               |||||| || ||||||||||||||||||| |||||
Sbjct: 9381989 ttagtccacttcctcgatcttggggccagcgccgc 9382023



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                              
Query: 228      tttagtcgacctcctcgatcttggggccag 257
                |||||||||||||||| ||||| |||||||
Sbjct: 34237050 tttagtcgacctcctcaatcttagggccag 34237021



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 228     tttagtcgacctcctcgatcttggg 252
               |||||||||| ||||||||||||||
Sbjct: 9342989 tttagtcgacttcctcgatcttggg 9342965

---

>gb|AC104433.8| Oryza sativa chromosome 3 BAC OJ1754_E06 genomic sequence, complete
              sequence
          Length = 163828

 Score =  165 bits (83), Expect = 2e-37
 Identities = 128/143 (89%)
 Strand = Plus / Minus

                                                                          
Query: 281    tcatcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 340
              ||||||||||| |||||  |||||||||||||||||||||||||||||||||| || || 
Sbjct: 110334 tcatcgtccattccaccacccatgtcggcaccagcaccctggtacatcttggcaataatt 110275

                                                                          
Query: 341    gggttgcacagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagcaagc 400
              |||||||||||| ||||||||||||||||||||||||| | ||| ||  ||||||| |||
Sbjct: 110274 gggttgcacaggccctccagctccttcatcttgtcttcgaactcttcaacctcagcgagc 110215

                                     
Query: 401    tggttcgtgtccagccactggat 423
              |||||  ||||||||||||||||
Sbjct: 110214 tggttgttgtccagccactggat 110192



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 228    tttagtcgacctcctcgatcttggggccag 257
              |||||||||||||||| ||||| |||||||
Sbjct: 110390 tttagtcgacctcctcaatcttagggccag 110361

---

>dbj|AK102784.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033107K19, full
            insert sequence
          Length = 2370

 Score =  165 bits (83), Expect = 2e-37
 Identities = 128/143 (89%)
 Strand = Plus / Minus

                                                                        
Query: 281  tcatcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 340
            ||||||||||| |||||  |||||||||||||||||||||||||||||||||| || || 
Sbjct: 2023 tcatcgtccattccaccacccatgtcggcaccagcaccctggtacatcttggcaataatt 1964

                                                                        
Query: 341  gggttgcacagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagcaagc 400
            |||||||||||| ||||||||||||||||||||||||| | ||| ||  ||||||| |||
Sbjct: 1963 gggttgcacaggccctccagctccttcatcttgtcttcgaactcttcaacctcagcgagc 1904

                                   
Query: 401  tggttcgtgtccagccactggat 423
            |||||  ||||||||||||||||
Sbjct: 1903 tggttgttgtccagccactggat 1881



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 228  tttagtcgacctcctcgatcttggggccag 257
            |||||||||||||||| ||||| |||||||
Sbjct: 2079 tttagtcgacctcctcaatcttagggccag 2050

---

>dbj|AK069740.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023030D03, full
            insert sequence
          Length = 2282

 Score =  165 bits (83), Expect = 2e-37
 Identities = 128/143 (89%)
 Strand = Plus / Minus

                                                                        
Query: 281  tcatcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 340
            ||||||||||| |||||  |||||||||||||||||||||||||||||||||| || || 
Sbjct: 2025 tcatcgtccattccaccacccatgtcggcaccagcaccctggtacatcttggcaataatt 1966

                                                                        
Query: 341  gggttgcacagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagcaagc 400
            |||||||||||| ||||||||||||||||||||||||| | ||| ||  ||||||| |||
Sbjct: 1965 gggttgcacaggccctccagctccttcatcttgtcttcgaactcttcaacctcagcgagc 1906

                                   
Query: 401  tggttcgtgtccagccactggat 423
            |||||  ||||||||||||||||
Sbjct: 1905 tggttgttgtccagccactggat 1883



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 228  tttagtcgacctcctcgatcttggggccag 257
            |||||||||||||||| ||||| |||||||
Sbjct: 2081 tttagtcgacctcctcaatcttagggccag 2052

---

>emb|X78414.1|ZMHSP704 Z.mays (cv DH5xDH7) hsp70-4 mRNA for heat shock protein 70
          Length = 913

 Score =  151 bits (76), Expect = 2e-33
 Identities = 209/250 (83%), Gaps = 10/250 (4%)
 Strand = Plus / Minus

                                                                       
Query: 229 ttagtcgacctcctcgatcttggggccagggccgccg-gatgcag-caggggtgtcatcg 286
           |||||| |||||||||||||||||||||||  ||||| | ||| | |||||| ||| |||
Sbjct: 662 ttagtccacctcctcgatcttggggccagg--cgccgcgctgccggcaggggcgtcctcg 605

                                                                       
Query: 287 tccatgccacc------ctccatgtcggcaccagcaccctggtacatcttggcgatgatg 340
           |||||||| ||      | |||||||  |||| || |||| |||||||||||||||||||
Sbjct: 604 tccatgccgccaggccgccccatgtcttcacccgcgcccttgtacatcttggcgatgatg 545

                                                                       
Query: 341 gggttgcacagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagcaagc 400
           |||||||| |||  ||||||||||||||||||||  || | |||||||||||| ||| ||
Sbjct: 544 gggttgcagaggctctccagctccttcatcttgtactcgaactcgtccgcctcggcaggc 485

                                                                       
Query: 401 tggttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcg 460
           ||||  | |||||||||   |||||| || |||||||| |||||||||||||||||||| 
Sbjct: 484 tggtcggcgtccagccagctgatggccgcgtcgatggcgtcctcgatcttcttcttgtca 425

                     
Query: 461 tcggccggca 470
           ||||||||||
Sbjct: 424 tcggccggca 415

---

>gb|AC083942.8| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0002D01, from chromosome 3, complete sequence
          Length = 187589

 Score =  145 bits (73), Expect = 1e-31
 Identities = 151/177 (85%)
 Strand = Plus / Minus

                                                                         
Query: 284   tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 343
             ||||||||||| ||  ||||||| || || || |||||||||||||||||||||||||||
Sbjct: 42203 tcgtccatgcctccggccatgtcagctccggcgccctggtacatcttggcgatgatgggg 42144

                                                                         
Query: 344   ttgcacagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagcaagctgg 403
             ||||| | | |||||||||||||||||||||| || | ||| || ||||| || ||||||
Sbjct: 42143 ttgcagacgccctccagctccttcatcttgtcctcgaactcctcggcctcggcgagctgg 42084

                                                                      
Query: 404   ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcg 460
             ||  |||| |||||   ||||||| | |||||||| |||||||||||||||||||||
Sbjct: 42083 ttgctgtcgagccagctgatggcaccgtcgatggcgtcctcgatcttcttcttgtcg 42027



 Score =  121 bits (61), Expect = 2e-24
 Identities = 127/149 (85%)
 Strand = Plus / Plus

                                                                         
Query: 317   ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 376
             |||||||||||||| | |||||| || ||||| |||  ||| ||||||||||||||||| 
Sbjct: 81371 ccctggtacatctttgagatgatcggattgcagaggctctcgagctccttcatcttgtcc 81430

                                                                         
Query: 377   tcaagctcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatg 436
             || | |||||| ||||| || ||||||||   ||| ||||||| ||||||| | ||||||
Sbjct: 81431 tcgaactcgtcggcctcggcgagctggttgccgtcgagccacttgatggcatcctcgatg 81490

                                          
Query: 437   gcctcctcgatcttcttcttgtcgtcggc 465
             || ||||||||||||||||||||||||||
Sbjct: 81491 gcgtcctcgatcttcttcttgtcgtcggc 81519



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                
Query: 229   ttagtcgacctcctcgatcttggggccagggccgc 263
             |||||| || ||||||||||||||||||| |||||
Sbjct: 81268 ttagtccacttcctcgatcttggggccagcgccgc 81302



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 228   tttagtcgacctcctcgatcttggg 252
             |||||||||| ||||||||||||||
Sbjct: 42268 tttagtcgacttcctcgatcttggg 42244

---

>gb|AC137698.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBb0014A21, from chromosome 3, complete sequence
          Length = 134014

 Score =  145 bits (73), Expect = 1e-31
 Identities = 151/177 (85%)
 Strand = Plus / Plus

                                                                         
Query: 284   tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 343
             ||||||||||| ||  ||||||| || || || |||||||||||||||||||||||||||
Sbjct: 11162 tcgtccatgcctccggccatgtcagctccggcgccctggtacatcttggcgatgatgggg 11221

                                                                         
Query: 344   ttgcacagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagcaagctgg 403
             ||||| | | |||||||||||||||||||||| || | ||| || ||||| || ||||||
Sbjct: 11222 ttgcagacgccctccagctccttcatcttgtcctcgaactcctcggcctcggcgagctgg 11281

                                                                      
Query: 404   ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcg 460
             ||  |||| |||||   ||||||| | |||||||| |||||||||||||||||||||
Sbjct: 11282 ttgctgtcgagccagctgatggcaccgtcgatggcgtcctcgatcttcttcttgtcg 11338



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 228   tttagtcgacctcctcgatcttggg 252
             |||||||||| ||||||||||||||
Sbjct: 11097 tttagtcgacttcctcgatcttggg 11121

---

>dbj|AK109474.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-129-B01, full
            insert sequence
          Length = 2253

 Score =  145 bits (73), Expect = 1e-31
 Identities = 151/177 (85%)
 Strand = Plus / Minus

                                                                        
Query: 284  tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 343
            ||||||||||| ||  ||||||| || || || |||||||||||||||||||||||||||
Sbjct: 1996 tcgtccatgcctccggccatgtcagctccggcgccctggtacatcttggcgatgatgggg 1937

                                                                        
Query: 344  ttgcacagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagcaagctgg 403
            ||||| | | |||||||||||||||||||||| || | ||| || ||||| || ||||||
Sbjct: 1936 ttgcagacgccctccagctccttcatcttgtcctcgaactcctcggcctcggcgagctgg 1877

                                                                     
Query: 404  ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcg 460
            ||  |||| |||||   ||||||| | |||||||| |||||||||||||||||||||
Sbjct: 1876 ttgctgtcgagccagctgatggcaccgtcgatggcgtcctcgatcttcttcttgtcg 1820



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 228  tttagtcgacctcctcgatcttggg 252
            |||||||||| ||||||||||||||
Sbjct: 2061 tttagtcgacttcctcgatcttggg 2037

---

>dbj|AK099275.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023078D02, full
            insert sequence
          Length = 2243

 Score =  145 bits (73), Expect = 1e-31
 Identities = 151/177 (85%)
 Strand = Plus / Minus

                                                                        
Query: 284  tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 343
            ||||||||||| ||  ||||||| || || || |||||||||||||||||||||||||||
Sbjct: 1999 tcgtccatgcctccggccatgtcagctccggcgccctggtacatcttggcgatgatgggg 1940

                                                                        
Query: 344  ttgcacagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagcaagctgg 403
            ||||| | | |||||||||||||||||||||| || | ||| || ||||| || ||||||
Sbjct: 1939 ttgcagacgccctccagctccttcatcttgtcctcgaactcctcggcctcggcgagctgg 1880

                                                                     
Query: 404  ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcg 460
            ||  |||| |||||   ||||||| | |||||||| |||||||||||||||||||||
Sbjct: 1879 ttgctgtcgagccagctgatggcaccgtcgatggcgtcctcgatcttcttcttgtcg 1823



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 228  tttagtcgacctcctcgatcttggg 252
            |||||||||| ||||||||||||||
Sbjct: 2064 tttagtcgacttcctcgatcttggg 2040

---

>dbj|AK072830.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023139H01, full
            insert sequence
          Length = 2252

 Score =  145 bits (73), Expect = 1e-31
 Identities = 151/177 (85%)
 Strand = Plus / Minus

                                                                        
Query: 284  tcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatgggg 343
            ||||||||||| ||  ||||||| || || || |||||||||||||||||||||||||||
Sbjct: 2003 tcgtccatgcctccggccatgtcagctccggcgccctggtacatcttggcgatgatgggg 1944

                                                                        
Query: 344  ttgcacagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagcaagctgg 403
            ||||| | | |||||||||||||||||||||| || | ||| || ||||| || ||||||
Sbjct: 1943 ttgcagacgccctccagctccttcatcttgtcctcgaactcctcggcctcggcgagctgg 1884

                                                                     
Query: 404  ttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcg 460
            ||  |||| |||||   ||||||| | |||||||| |||||||||||||||||||||
Sbjct: 1883 ttgctgtcgagccagctgatggcaccgtcgatggcgtcctcgatcttcttcttgtcg 1827



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 228  tttagtcgacctcctcgatcttggg 252
            |||||||||| ||||||||||||||
Sbjct: 2068 tttagtcgacttcctcgatcttggg 2044

---

>ref|NM_190528.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1947

 Score =  143 bits (72), Expect = 6e-31
 Identities = 144/168 (85%)
 Strand = Plus / Minus

                                                                        
Query: 300  ccatgtcggcaccagcaccctggtacatcttggcgatgatggggttgcacagggcctcca 359
            ||||||| || || || |||||||||||||| ||||||||||||||||| | |  |||||
Sbjct: 1870 ccatgtccgcgccggcgccctggtacatcttcgcgatgatggggttgcagatgctctcca 1811

                                                                        
Query: 360  gctccttcatcttgtcttcaagctcgtccgcctcagcaagctggttcgtgtccagccact 419
            |||||||||||||||| || | |||||||||||| || ||||||||  |||| ||||| |
Sbjct: 1810 gctccttcatcttgtcctcgaactcgtccgcctccgcgagctggttgctgtcgagccagt 1751

                                                            
Query: 420  ggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcggccg 467
             ||||||  | |||||||| ||||||||||||||||||||||| ||||
Sbjct: 1750 tgatggcgccgtcgatggcgtcctcgatcttcttcttgtcgtccgccg 1703



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 233  tcgacctcctcgatcttggggcc 255
            |||||||||||||||||||||||
Sbjct: 1943 tcgacctcctcgatcttggggcc 1921

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  143 bits (72), Expect = 6e-31
 Identities = 144/168 (85%)
 Strand = Plus / Minus

                                                                            
Query: 300      ccatgtcggcaccagcaccctggtacatcttggcgatgatggggttgcacagggcctcca 359
                ||||||| || || || |||||||||||||| ||||||||||||||||| | |  |||||
Sbjct: 36036152 ccatgtccgcgccggcgccctggtacatcttcgcgatgatggggttgcagatgctctcca 36036093

                                                                            
Query: 360      gctccttcatcttgtcttcaagctcgtccgcctcagcaagctggttcgtgtccagccact 419
                |||||||||||||||| || | |||||||||||| || ||||||||  |||| ||||| |
Sbjct: 36036092 gctccttcatcttgtcctcgaactcgtccgcctccgcgagctggttgctgtcgagccagt 36036033

                                                                
Query: 420      ggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcggccg 467
                 ||||||  | |||||||| ||||||||||||||||||||||| ||||
Sbjct: 36036032 tgatggcgccgtcgatggcgtcctcgatcttcttcttgtcgtccgccg 36035985



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 233      tcgacctcctcgatcttggggcc 255
                |||||||||||||||||||||||
Sbjct: 36036225 tcgacctcctcgatcttggggcc 36036203



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 445      gatcttcttcttgtcgtcggccggc 469
                |||||||||||| ||||||||||||
Sbjct: 40186339 gatcttcttcttctcgtcggccggc 40186363



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 17       acatcatcgaactaatatat 36
                ||||||||||||||||||||
Sbjct: 15119654 acatcatcgaactaatatat 15119673



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 103     cacggaataactacgaccac 122
               ||||||||||||||||||||
Sbjct: 5589872 cacggaataactacgaccac 5589853

---

>dbj|AP003241.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0408C03
          Length = 141273

 Score =  143 bits (72), Expect = 6e-31
 Identities = 144/168 (85%)
 Strand = Plus / Minus

                                                                         
Query: 300   ccatgtcggcaccagcaccctggtacatcttggcgatgatggggttgcacagggcctcca 359
             ||||||| || || || |||||||||||||| ||||||||||||||||| | |  |||||
Sbjct: 48877 ccatgtccgcgccggcgccctggtacatcttcgcgatgatggggttgcagatgctctcca 48818

                                                                         
Query: 360   gctccttcatcttgtcttcaagctcgtccgcctcagcaagctggttcgtgtccagccact 419
             |||||||||||||||| || | |||||||||||| || ||||||||  |||| ||||| |
Sbjct: 48817 gctccttcatcttgtcctcgaactcgtccgcctccgcgagctggttgctgtcgagccagt 48758

                                                             
Query: 420   ggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcggccg 467
              ||||||  | |||||||| ||||||||||||||||||||||| ||||
Sbjct: 48757 tgatggcgccgtcgatggcgtcctcgatcttcttcttgtcgtccgccg 48710



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 233   tcgacctcctcgatcttggggcc 255
             |||||||||||||||||||||||
Sbjct: 48950 tcgacctcctcgatcttggggcc 48928

---

>dbj|AP003231.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0031D11
          Length = 138108

 Score =  143 bits (72), Expect = 6e-31
 Identities = 144/168 (85%)
 Strand = Plus / Minus

                                                                          
Query: 300    ccatgtcggcaccagcaccctggtacatcttggcgatgatggggttgcacagggcctcca 359
              ||||||| || || || |||||||||||||| ||||||||||||||||| | |  |||||
Sbjct: 134830 ccatgtccgcgccggcgccctggtacatcttcgcgatgatggggttgcagatgctctcca 134771

                                                                          
Query: 360    gctccttcatcttgtcttcaagctcgtccgcctcagcaagctggttcgtgtccagccact 419
              |||||||||||||||| || | |||||||||||| || ||||||||  |||| ||||| |
Sbjct: 134770 gctccttcatcttgtcctcgaactcgtccgcctccgcgagctggttgctgtcgagccagt 134711

                                                              
Query: 420    ggatggcagcatcgatggcctcctcgatcttcttcttgtcgtcggccg 467
               ||||||  | |||||||| ||||||||||||||||||||||| ||||
Sbjct: 134710 tgatggcgccgtcgatggcgtcctcgatcttcttcttgtcgtccgccg 134663



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 233    tcgacctcctcgatcttggggcc 255
              |||||||||||||||||||||||
Sbjct: 134903 tcgacctcctcgatcttggggcc 134881

---

>gb|U41653.1|SBU41653 Sorghum bicolor heat shock protein 70 (hsp70) pseudogene
          Length = 3305

 Score =  137 bits (69), Expect = 4e-29
 Identities = 129/149 (86%)
 Strand = Plus / Minus

                                                                        
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatc 370
            ||||| |||||||||||||| || |||||||||||||| | | |||||||||||||||||
Sbjct: 3052 ccagctccctggtacatcttcgcaatgatggggttgcagatgccctccagctccttcatc 2993

                                                                        
Query: 371  ttgtcttcaagctcgtccgcctcagcaagctggttcgtgtccagccactggatggcagca 430
            |||||||| | |||||| |||||||| ||||||||  ||||||||||   ||||||  ||
Sbjct: 2992 ttgtcttcgaactcgtcggcctcagcgagctggttgctgtccagccagctgatggctcca 2933

                                         
Query: 431  tcgatggcctcctcgatcttcttcttgtc 459
            ||||  || ||||||||||||||||||||
Sbjct: 2932 tcgacagcgtcctcgatcttcttcttgtc 2904



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 229  ttagtcgacctcctcgatcttggg 252
            ||||||||||||||| ||||||||
Sbjct: 3122 ttagtcgacctcctcaatcttggg 3099

---

>emb|X61491.1|SOSCE70 S.oleracea sce70 mRNA for 70 kDa heat shock protein of the
            chloroplast envelope membrane
          Length = 2535

 Score =  133 bits (67), Expect = 6e-28
 Identities = 151/179 (84%)
 Strand = Plus / Minus

                                                                        
Query: 281  tcatcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 340
            ||||| |||||||| ||  |||||||  |||||||||| |||||||||||||| ||||| 
Sbjct: 2269 tcatcttccatgcctccacccatgtcaccaccagcaccttggtacatcttggcaatgatt 2210

                                                                        
Query: 341  gggttgcacagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagcaagc 400
            |||||||| | |  ||||| ||||||||||||||| || | ||| || ||||||||||||
Sbjct: 2209 gggttgcagatgctctccaactccttcatcttgtcatcgaactcatcagcctcagcaagc 2150

                                                                       
Query: 401  tggttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtc 459
            |||||   ||| ||||| || |||| |||||||||||| || |||||||||||||||||
Sbjct: 2149 tggttaccgtcaagccattgaatggaagcatcgatggcttcttcgatcttcttcttgtc 2091

---

>gb|AF034618.1|AF034618 Spinacia oleracea cytosolic heat shock 70 protein (HSC70-1) gene,
            complete cds
          Length = 4349

 Score =  133 bits (67), Expect = 6e-28
 Identities = 151/179 (84%)
 Strand = Plus / Minus

                                                                        
Query: 281  tcatcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 340
            ||||| |||||||| ||  |||||||  |||||||||| |||||||||||||| ||||| 
Sbjct: 4091 tcatcttccatgcctccacccatgtcaccaccagcaccttggtacatcttggcaatgatt 4032

                                                                        
Query: 341  gggttgcacagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagcaagc 400
            |||||||| | |  ||||| ||||||||||||||| || | ||| || ||||||||||||
Sbjct: 4031 gggttgcagatgctctccaactccttcatcttgtcatcgaactcatcagcctcagcaagc 3972

                                                                       
Query: 401  tggttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtc 459
            |||||   ||| ||||| || |||| |||||||||||| || |||||||||||||||||
Sbjct: 3971 tggttaccgtcaagccattgaatggaagcatcgatggcttcttcgatcttcttcttgtc 3913

---

>gb|L26243.1|SPIC70A Spinacia oleracea heat shock C70 protein mRNA, complete cds
          Length = 2194

 Score =  133 bits (67), Expect = 6e-28
 Identities = 151/179 (84%)
 Strand = Plus / Minus

                                                                        
Query: 281  tcatcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 340
            ||||| |||||||| ||  |||||||  |||||||||| |||||||||||||| ||||| 
Sbjct: 1936 tcatcttccatgcctccacccatgtcaccaccagcaccttggtacatcttggcaatgatt 1877

                                                                        
Query: 341  gggttgcacagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagcaagc 400
            |||||||| | |  ||||| ||||||||||||||| || | ||| || ||||||||||||
Sbjct: 1876 gggttgcagatgctctccaactccttcatcttgtcatcgaactcatcagcctcagcaagc 1817

                                                                       
Query: 401  tggttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtc 459
            |||||   ||| ||||| || |||| |||||||||||| || |||||||||||||||||
Sbjct: 1816 tggttaccgtcaagccattgaatggaagcatcgatggcttcttcgatcttcttcttgtc 1758

---

>gb|AF005993.1|AF005993 Triticum aestivum 70 kDa heat shock protein (TaHSP70d) mRNA, complete
            cds
          Length = 2311

 Score =  123 bits (62), Expect = 5e-25
 Identities = 125/146 (85%)
 Strand = Plus / Minus

                                                                        
Query: 317  ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 376
            |||||||||||||||||||||||||||||||| | | |||||||||||||||||||||| 
Sbjct: 1967 ccctggtacatcttggcgatgatggggttgcagatgccctccagctccttcatcttgtcc 1908

                                                                        
Query: 377  tcaagctcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatg 436
            || | |||||| ||||| || |||||||| | |||||||||   |||||   | ||||| 
Sbjct: 1907 tcgaactcgtcggcctcggcgagctggttggcgtccagccagctgatggtgccctcgatc 1848

                                      
Query: 437  gcctcctcgatcttcttcttgtcgtc 462
            |||||||| | |||||||||||||||
Sbjct: 1847 gcctcctccaccttcttcttgtcgtc 1822



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                 
Query: 229  ttagtcgacctcctcgatcttggggccagggccgccg 265
            |||||| |||||||||||||||||||||| |||||||
Sbjct: 2061 ttagtccacctcctcgatcttggggccagcgccgccg 2025

---

>emb|AJ249331.1|CSA249331 Cucumis sativus mRNA for heat shock protein 70 isoform-2
          Length = 2617

 Score =  119 bits (60), Expect = 9e-24
 Identities = 128/148 (86%), Gaps = 2/148 (1%)
 Strand = Plus / Minus

                                                                        
Query: 314  gcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttg 373
            ||||| |||||||||||||| ||||| |||||||| | |  ||||| |||||||||||||
Sbjct: 2223 gcaccttggtacatcttggcaatgattgggttgcaaatgctctccaactccttcatcttg 2164

                                                                        
Query: 374  tcttcaagctcgtccgcctcagcaagctggttcgtgtccagccactggatgg-cagcatc 432
            ||||| | |||||| |||||||| |||||||| | ||||||||| ||||||| | || ||
Sbjct: 2163 tcttcgaactcgtcagcctcagctagctggttggcgtccagccattggatggactgc-tc 2105

                                        
Query: 433  gatggcctcctcgatcttcttcttgtcg 460
            |||||| || ||||||||||||||||||
Sbjct: 2104 gatggcatcgtcgatcttcttcttgtcg 2077

---

>gb|AF479058.1| Sandersonia aurantiaca 70 kDa heat shock protein mRNA, complete cds
          Length = 1241

 Score =  119 bits (60), Expect = 9e-24
 Identities = 102/116 (87%)
 Strand = Plus / Minus

                                                                       
Query: 308 gcaccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
           ||||||||||| ||||||||||||||||||||||||||||| | |  |||||| ||||||
Sbjct: 994 gcaccagcaccttggtacatcttggcgatgatggggttgcagatgctctccagttccttc 935

                                                                   
Query: 368 atcttgtcttcaagctcgtccgcctcagcaagctggttcgtgtccagccactggat 423
           |||||||| |||| ||| || || ||||||||||||||  |||| |||||||||||
Sbjct: 934 atcttgtcatcaaactcatcagcttcagcaagctggttgttgtcgagccactggat 879



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 229  ttagtcgacctcctcgatcttggggccag 257
            ||||||||||||||| |||||||| ||||
Sbjct: 1076 ttagtcgacctcctcaatcttgggaccag 1048

---

>gb|BT018649.1| Zea mays clone EL01N0505F04.d mRNA sequence
          Length = 1788

 Score =  117 bits (59), Expect = 3e-23
 Identities = 95/107 (88%)
 Strand = Plus / Minus

                                                                        
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatc 370
            ||||| || ||||||||||||||||||||||||||||| | | |||| ||||||||||||
Sbjct: 1539 ccagcgccttggtacatcttggcgatgatggggttgcagatgccctcgagctccttcatc 1480

                                                           
Query: 371  ttgtcttcaagctcgtccgcctcagcaagctggttcgtgtccagcca 417
            |||||||| | ||||||| ||||||| ||||||||  ||||||||||
Sbjct: 1479 ttgtcttcgaactcgtccacctcagctagctggttgctgtccagcca 1433

---

>gb|AF527796.1| Cucurbita maxima cell-autonomous heat shock cognate protein 70
            (Hsc70-3) mRNA, complete cds
          Length = 1953

 Score =  107 bits (54), Expect = 3e-20
 Identities = 128/150 (85%), Gaps = 2/150 (1%)
 Strand = Plus / Minus

                                                                        
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatc 370
            ||||| || |||||||||||||||||||| |||||||| | |  ||||| ||||||||||
Sbjct: 1862 ccagcgccttggtacatcttggcgatgattgggttgcagatgctctccaactccttcatc 1803

                                                                        
Query: 371  ttgtcttcaagctcgtccgcctcagcaagctggttcgtgtccagccactggatgg-cagc 429
            |||||||| | ||| || || ||||| |||||||| | ||| ||||||||||||| | ||
Sbjct: 1802 ttgtcttcgaactcatcggcttcagccagctggttggcgtcaagccactggatggactgc 1743

                                          
Query: 430  atcgatggcctcctcgatcttcttcttgtc 459
             |||||||| || |||||||||||||||||
Sbjct: 1742 -tcgatggcatcttcgatcttcttcttgtc 1714



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 229  ttagtcgacctcctcgatcttggggccag 257
            ||||||||| |||||||||||||| ||||
Sbjct: 1953 ttagtcgacttcctcgatcttgggaccag 1925

---

>gb|BT016692.1| Zea mays clone Contig525 mRNA sequence
          Length = 1806

 Score =  105 bits (53), Expect = 1e-19
 Identities = 89/101 (88%)
 Strand = Plus / Minus

                                                                        
Query: 317  ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 376
            |||||||||||||| ||||||||||||||||| |   |||| ||||||||||||||||||
Sbjct: 1560 ccctggtacatcttcgcgatgatggggttgcagatcccctcaagctccttcatcttgtct 1501

                                                     
Query: 377  tcaagctcgtccgcctcagcaagctggttcgtgtccagcca 417
            |||| ||| ||| ||||||| ||||||||  ||||||||||
Sbjct: 1500 tcaaactcctccacctcagccagctggttgctgtccagcca 1460

---

>gb|AF161180.1|AF161180 Malus domestica high molecular weight heat shock protein (Hsp2) mRNA,
            complete cds
          Length = 2212

 Score =  105 bits (53), Expect = 1e-19
 Identities = 122/145 (84%)
 Strand = Plus / Minus

                                                                        
Query: 315  caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 374
            ||||||||||||||||||| ||||| || ||||| | |  ||||||||||||||||||||
Sbjct: 1891 caccctggtacatcttggcaatgatcggattgcagatgctctccagctccttcatcttgt 1832

                                                                        
Query: 375  cttcaagctcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcga 434
            | |||| |||||| |||||||||||||||||   ||| ||||| ||||||||    || |
Sbjct: 1831 cctcaaactcgtcggcctcagcaagctggtttccgtcaagccattggatggcctggtcaa 1772

                                     
Query: 435  tggcctcctcgatcttcttcttgtc 459
            | || ||||| ||||||||||||||
Sbjct: 1771 ttgcatcctcaatcttcttcttgtc 1747

---

>gb|AY104350.1| Zea mays PCO083553 mRNA sequence
          Length = 1167

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 122/146 (83%)
 Strand = Plus / Minus

                                                                       
Query: 317 ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 376
           ||||| |||||||| ||||||||||||||||| | | |||||||||||||||||||||| 
Sbjct: 844 ccctgatacatcttcgcgatgatggggttgcagatgccctccagctccttcatcttgtcc 785

                                                                       
Query: 377 tcaagctcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatg 436
           |||| ||| ||  |||| || ||||||||  |||| ||||| | ||||||  | |||| |
Sbjct: 784 tcaaactcatcaacctcggcgagctggttgttgtcgagccaattgatggccccctcgacg 725

                                     
Query: 437 gcctcctcgatcttcttcttgtcgtc 462
           || || |||||||| |||||||||||
Sbjct: 724 gcgtcatcgatctttttcttgtcgtc 699

---

>dbj|AB012716.1| Salix gilgiana Hsc70 mRNA for heat shock protein 70 cognate, partial
            cds
          Length = 1475

 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 149/182 (81%)
 Strand = Plus / Minus

                                                                        
Query: 281  tcatcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 340
            ||||| |||||||||||  |||| || || |||||||| || |||||||| || ||||||
Sbjct: 1172 tcatcctccatgccaccacccatatcagctccagcaccttgatacatcttagcaatgatg 1113

                                                                        
Query: 341  gggttgcacagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagcaagc 400
            || ||||| | |  ||| ||||||||||||||||| |||| ||| || |||||||| |||
Sbjct: 1112 ggattgcagatgctctcaagctccttcatcttgtcctcaaactcatctgcctcagcgagc 1053

                                                                        
Query: 401  tggttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtcg 460
            |||||  |||| ||||||||||| ||    || || || |||||||| ||||||||||||
Sbjct: 1052 tggttgctgtcgagccactggatagcctggtcaatcgcatcctcgattttcttcttgtcg 993

              
Query: 461  tc 462
            ||
Sbjct: 992  tc 991

---

>gb|AF033852.1|AF033852 Spinacia oleracea cytosolic heat shock 70 protein (HSC70) mRNA,
            complete cds
          Length = 2184

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 85/97 (87%)
 Strand = Plus / Minus

                                                                        
Query: 309  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 368
            |||||||||| ||||||||||| || |||||||||||||| |    ||||||||||||||
Sbjct: 1911 caccagcaccttggtacatcttagcaatgatggggttgcaaatactctccagctccttca 1852

                                                 
Query: 369  tcttgtcttcaagctcgtccgcctcagcaagctggtt 405
            |||| ||||||| ||| || |||||||||||||||||
Sbjct: 1851 tcttatcttcaaactcatcagcctcagcaagctggtt 1815

---

>gb|AF034617.1|AF034617 Spinacia oleracea cytosolic heat shock 70 protein (HSC70-3alpha)
            gene, complete cds
          Length = 5903

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 85/97 (87%)
 Strand = Plus / Minus

                                                                        
Query: 309  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 368
            |||||||||| ||||||||||| || |||||||||||||| |    ||||||||||||||
Sbjct: 4486 caccagcaccttggtacatcttagcaatgatggggttgcaaatactctccagctccttca 4427

                                                 
Query: 369  tcttgtcttcaagctcgtccgcctcagcaagctggtt 405
            |||| ||||||| ||| || |||||||||||||||||
Sbjct: 4426 tcttatcttcaaactcatcagcctcagcaagctggtt 4390

---

>gb|AF034616.1|AF034616 Spinacia oleracea cytosolic heat shock 70 protein (HSC70-3beta) gene,
            complete cds
          Length = 6425

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 85/97 (87%)
 Strand = Plus / Minus

                                                                        
Query: 309  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 368
            |||||||||| ||||||||||| || |||||||||||||| |    ||||||||||||||
Sbjct: 5013 caccagcaccttggtacatcttagcaatgatggggttgcaaatactctccagctccttca 4954

                                                 
Query: 369  tcttgtcttcaagctcgtccgcctcagcaagctggtt 405
            |||| ||||||| ||| || |||||||||||||||||
Sbjct: 4953 tcttatcttcaaactcatcagcctcagcaagctggtt 4917

---

>emb|X03697.1|ZMHSP702 Maize gene for heat shock protein 70 exon 2 and 3'-UT (hsp70; clone
            pMON 9502)
          Length = 1934

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 117/140 (83%)
 Strand = Plus / Minus

                                                                        
Query: 320  tggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttca 379
            ||||||||||| ||||||||||||||||| |   |||| |||||||||||||||||||| 
Sbjct: 1772 tggtacatcttcgcgatgatggggttgcagatcccctcaagctccttcatcttgtcttcg 1713

                                                                        
Query: 380  agctcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatggcc 439
            | ||| ||| ||||||| ||||||||  ||||||||||   ||||||  | || | ||| 
Sbjct: 1712 aactcctccacctcagccagctggttgctgtccagccagctgatggcgccgtcaacggca 1653

                                
Query: 440  tcctcgatcttcttcttgtc 459
            || |||||||||||||||||
Sbjct: 1652 tcttcgatcttcttcttgtc 1633

---

>gb|AF527795.1| Cucurbita maxima non-cell-autonomous heat shock cognate protein 70
            (Hsc70-1) mRNA, complete cds
          Length = 1959

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 125/151 (82%)
 Strand = Plus / Minus

                                                                        
Query: 309  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 368
            |||||||||||||||||||||| || |  || |||||||| | |  ||| || |||||||
Sbjct: 1864 caccagcaccctggtacatcttagcaacaattgggttgcaaatgctctcaagttccttca 1805

                                                                        
Query: 369  tcttgtcttcaagctcgtccgcctcagcaagctggttcgtgtccagccactggatggcag 428
            | |||||||||| |||||| ||||| ||||| |||||  |||||||||||||||  ||  
Sbjct: 1804 ttttgtcttcaaactcgtcggcctctgcaagttggttattgtccagccactggactgctc 1745

                                           
Query: 429  catcgatggcctcctcgatcttcttcttgtc 459
            | |||||||| || ||||||||||| |||||
Sbjct: 1744 cctcgatggcatcttcgatcttctttttgtc 1714

---

>dbj|AB112816.1| Nicotiana benthamiana Hsp70 mRNA for heat shock protein 70, partial
           cds, sub_clone:NbHsp70c-C
          Length = 351

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 76/86 (88%)
 Strand = Plus / Minus

                                                                       
Query: 320 tggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttca 379
           |||||||||||||| |||||||||||||| | |  ||| |||||||||||||| ||||||
Sbjct: 233 tggtacatcttggcaatgatggggttgcagatgctctcgagctccttcatcttatcttca 174

                                     
Query: 380 agctcgtccgcctcagcaagctggtt 405
           | |||||| || ||||||||||||||
Sbjct: 173 aactcgtcagcttcagcaagctggtt 148

---

>gb|AY106152.1| Zea mays PCO094428 mRNA sequence
          Length = 1011

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 127/154 (82%)
 Strand = Plus / Minus

                                                                       
Query: 317 ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 376
           |||||||||||||  | ||||||||||||||| | |  ||||||||||||||||||||| 
Sbjct: 678 ccctggtacatctgtgagatgatggggttgcagatgctctccagctccttcatcttgtcc 619

                                                                       
Query: 377 tcaagctcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatg 436
           || | ||| || ||||| || ||||||||   ||| ||||||| ||||||  | ||||| 
Sbjct: 618 tcgaactcctcggcctccgcgagctggttgccgtcgagccacttgatggcgtcctcgatc 559

                                             
Query: 437 gcctcctcgatcttcttcttgtcgtcggccggca 470
           |  |||||||||||||||||||| ||||| ||||
Sbjct: 558 gtgtcctcgatcttcttcttgtcatcggcgggca 525

---

>gb|AF509339.1| Saussurea medusa heat shock protein 70 (HSP70) mRNA, partial cds
          Length = 1484

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 120/145 (82%)
 Strand = Plus / Minus

                                                                        
Query: 315  caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 374
            |||| ||||||||||| || ||||| ||||||||||    ||| ||||||||||||||||
Sbjct: 1198 caccttggtacatcttagcaatgatcgggttgcacacattctcaagctccttcatcttgt 1139

                                                                        
Query: 375  cttcaagctcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcga 434
            | |||| ||| || |||||||||||||||||  |||||| ||||   || ||  |||| |
Sbjct: 1138 cctcaaactcatcagcctcagcaagctggttgctgtccaaccacgaaatagcctcatcaa 1079

                                     
Query: 435  tggcctcctcgatcttcttcttgtc 459
            |||| ||||| ||||||||||||||
Sbjct: 1078 tggcatcctcaatcttcttcttgtc 1054

---

>gb|AC150776.2| Medicago truncatula chromosome 7 BAC clone mte1-45n16, complete
             sequence
          Length = 107886

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 120/145 (82%)
 Strand = Plus / Plus

                                                                         
Query: 315   caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 374
             |||| |||||||||||||| ||||| |||||||| |   | || || |||||||||||||
Sbjct: 27323 caccttggtacatcttggcaatgatagggttgcagacaccttcaagttccttcatcttgt 27382

                                                                         
Query: 375   cttcaagctcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcga 434
             | |||| ||| || ||||| ||||||||||| |  || ||||||||||| ||||| || |
Sbjct: 27383 cctcaaactcatcagcctctgcaagctggttggcatctagccactggatagcagcctcaa 27442

                                      
Query: 435   tggcctcctcgatcttcttcttgtc 459
             |||  |||||||||||||| |||||
Sbjct: 27443 tggtgtcctcgatcttctttttgtc 27467



 Score = 44.1 bits (22), Expect = 0.41
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 228   tttagtcgacctcctcgatcttggggccag 257
             |||||||||||||||| ||||| |||||||
Sbjct: 27230 tttagtcgacctcctcaatcttagggccag 27259

---

>gb|AF527794.1| Cucurbita maxima non-cell-autonomous heat shock cognate protein 70
            (Hsc70-2) mRNA, complete cds
          Length = 1944

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 132/161 (81%)
 Strand = Plus / Minus

                                                                        
Query: 300  ccatgtcggcaccagcaccctggtacatcttggcgatgatggggttgcacagggcctcca 359
            ||||||| || || ||||| |||||||||||||||||||| |||||||| | |  |||||
Sbjct: 1873 ccatgtcagctccggcaccttggtacatcttggcgatgattgggttgcagatgctctcca 1814

                                                                        
Query: 360  gctccttcatcttgtcttcaagctcgtccgcctcagcaagctggttcgtgtccagccact 419
             ||||||||||||||| || |  || || ||||| || |||||||| |  || |||||||
Sbjct: 1813 actccttcatcttgtcctcgaattcatcggcctccgccagctggttggcatcgagccact 1754

                                                     
Query: 420  ggatggcagcatcgatggcctcctcgatcttcttcttgtcg 460
            |||||||    |||||||| || || |||||||||||||||
Sbjct: 1753 ggatggcttgctcgatggcgtcttcaatcttcttcttgtcg 1713

---

>dbj|AB112814.1| Nicotiana benthamiana Hsp70 mRNA for heat shock protein 70, partial
           cds, sub_clone:NbHsp70c-A
          Length = 422

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 84/97 (86%)
 Strand = Plus / Minus

                                                                       
Query: 309 caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 368
           ||||||||||||||||||||||||| |||||||| || || | | |||| ||||||||||
Sbjct: 328 caccagcaccctggtacatcttggcaatgatgggattacaaatgccctcaagctccttca 269

                                                
Query: 369 tcttgtcttcaagctcgtccgcctcagcaagctggtt 405
           ||||||| |||| ||| || || || |||||||||||
Sbjct: 268 tcttgtcctcaaactcatcagcttctgcaagctggtt 232

---

>gb|AF002667.1|SCAF002667 Solanum commersonii heat shock cognate protein (SCHSP70) mRNA,
           complete cds
          Length = 1149

 Score = 89.7 bits (45), Expect = 8e-15
 Identities = 84/97 (86%)
 Strand = Plus / Minus

                                                                       
Query: 309 caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 368
           |||||||||||||||||||||| || || ||||| ||||| |||  |||||| |||||||
Sbjct: 949 caccagcaccctggtacatcttagcaattatgggattgcataggctctccagttccttca 890

                                                
Query: 369 tcttgtcttcaagctcgtccgcctcagcaagctggtt 405
           |||| ||||||| ||| || || ||||||||||||||
Sbjct: 889 tcttatcttcaaactcatcagcttcagcaagctggtt 853

---

>gb|AY694190.1| Camellia sinensis HSP70 (hsp70) mRNA, partial cds
          Length = 491

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 83/96 (86%)
 Strand = Plus / Minus

                                                                       
Query: 310 accagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcat 369
           |||||||||||| |||||||| || || ||||| ||||| | |  |||||||||||||||
Sbjct: 192 accagcaccctgatacatctttgcaattatgggattgcagatgctctccagctccttcat 133

                                               
Query: 370 cttgtcttcaagctcgtccgcctcagcaagctggtt 405
           |||||| |||| ||| |||||||| |||||||||||
Sbjct: 132 cttgtcctcaaactcatccgcctcggcaagctggtt 97

---

>gb|AY257488.1| Lycopersicon esculentum HSC2-like mRNA, partial sequence
          Length = 804

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 98/116 (84%)
 Strand = Plus / Minus

                                                                       
Query: 311 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatc 370
           |||||||| |||||||||||||| || || |||||||| | |  ||||| ||||||||||
Sbjct: 523 ccagcaccttggtacatcttggcaataattgggttgcaaatgctctccaactccttcatc 464

                                                                   
Query: 371 ttgtcttcaagctcgtccgcctcagcaagctggttcgtgtccagccactggatggc 426
           ||||||||||  || || | ||||||||||||||| |  || ||||||||||||||
Sbjct: 463 ttgtcttcaaattcatcagactcagcaagctggttggcatcgagccactggatggc 408



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 229 ttagtcgacctcctcgatcttggggccag 257
           |||||||||||||||||||||||| ||||
Sbjct: 611 ttagtcgacctcctcgatcttgggaccag 583

---

>dbj|AB105430.2| Nicotiana benthamiana Hsp70 mRNA for heat shock protein 70, partial
            cds
          Length = 1203

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 118/143 (82%)
 Strand = Plus / Minus

                                                                        
Query: 317  ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 376
            ||||||||||| || || |||| ||||||||| ||| |||| || |||||||| ||||||
Sbjct: 1054 ccctggtacatttttgcaatgaaggggttgcagaggccctctagttccttcattttgtct 995

                                                                        
Query: 377  tcaagctcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatg 436
            |||| ||| || ||||| |||||||||||    || ||||| ||||||||  | || |||
Sbjct: 994  tcaaactcatcagcctcggcaagctggtttccatcaagccattggatggcttcctcaatg 935

                                   
Query: 437  gcctcctcgatcttcttcttgtc 459
            || ||||| ||||||||||||||
Sbjct: 934  gcatcctcaatcttcttcttgtc 912

---

>gb|AY836799.1| Saussurea medusa heat shock protein hsp70 gene, complete cds
          Length = 3290

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 119/145 (82%)
 Strand = Plus / Minus

                                                                        
Query: 315  caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 374
            |||| ||||||||||| || ||||| ||||||||||    ||| ||||||||||||||||
Sbjct: 3048 caccttggtacatcttagcaatgatcgggttgcacacattctcaagctccttcatcttgt 2989

                                                                        
Query: 375  cttcaagctcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcga 434
            | |||| ||| || |||||||||||||||||  |||||| ||||   || ||  |||| |
Sbjct: 2988 cctcaaactcatcagcctcagcaagctggttgctgtccaaccacgaaatagcctcatcaa 2929

                                     
Query: 435  tggcctcctcgatcttcttcttgtc 459
            | || ||||| ||||||||||||||
Sbjct: 2928 tcgcatcctcaatcttcttcttgtc 2904

---

>gb|AY372071.1| Nicotiana tabacum heat shock protein 70-3 (HSP70-3) gene, complete
            cds
          Length = 3208

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                        
Query: 309  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 368
            |||||||||| ||||||||||| || |||||||| ||||| | |  ||| ||||||||||
Sbjct: 2928 caccagcaccttggtacatcttagcaatgatgggattgcagatgctctcgagctccttca 2869

                                                 
Query: 369  tcttgtcttcaagctcgtccgcctcagcaagctggtt 405
            |||| ||||||| ||| || || ||||||||||||||
Sbjct: 2868 tcttatcttcaaactcatcagcttcagcaagctggtt 2832



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 229  ttagtcgacctcctcgatcttggg 252
            ||||||||||||||| ||||||||
Sbjct: 3011 ttagtcgacctcctcaatcttggg 2988

---

>gb|AY253326.1| Nicotiana tabacum heat shock protein 70 (Hsp70) mRNA, complete cds
          Length = 2259

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 83/97 (85%)
 Strand = Plus / Minus

                                                                        
Query: 309  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 368
            |||||||||| ||||||||||| || |||||||| ||||| | |  ||| ||||||||||
Sbjct: 1966 caccagcaccttggtacatcttagcaatgatgggattgcagatgctctcgagctccttca 1907

                                                 
Query: 369  tcttgtcttcaagctcgtccgcctcagcaagctggtt 405
            |||| ||||||| ||| || || ||||||||||||||
Sbjct: 1906 tcttatcttcaaactcatcagcttcagcaagctggtt 1870



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 229  ttagtcgacctcctcgatcttggg 252
            ||||||||||||||| ||||||||
Sbjct: 2049 ttagtcgacctcctcaatcttggg 2026

---

>gb|AF509336.1| Saussurea medusa heat shock protein 70 (HSP70) mRNA, complete cds
          Length = 2224

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 119/145 (82%)
 Strand = Plus / Minus

                                                                        
Query: 315  caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 374
            |||| ||||||||||| || ||||| ||||||||||    ||| ||||||||||||||||
Sbjct: 1914 caccttggtacatcttagcaatgatcgggttgcacacattctcaagctccttcatcttgt 1855

                                                                        
Query: 375  cttcaagctcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcga 434
            | |||| ||| || |||||||||||||||||  |||||| ||||   || ||  |||| |
Sbjct: 1854 cctcaaactcatcagcctcagcaagctggttgctgtccaaccacgaaatagcctcatcaa 1795

                                     
Query: 435  tggcctcctcgatcttcttcttgtc 459
            | || ||||| ||||||||||||||
Sbjct: 1794 tcgcatcctcaatcttcttcttgtc 1770

---

>gb|AY485986.1| Vigna radiata 70 kDa heat shock cognate protein 1 mRNA, complete cds
          Length = 2218

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                        
Query: 309  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 368
            |||||||||| ||||||||||| ||||||||||| ||||| | |  ||||| ||||||||
Sbjct: 1948 caccagcaccttggtacatcttagcgatgatgggattgcatatgctctccaactccttca 1889

                                                  
Query: 369  tcttgtcttcaagctcgtccgcctcagcaagctggttc 406
            ||||||| ||||  || || |||||| |||| ||||||
Sbjct: 1888 tcttgtcctcaaattcatcagcctcaccaagttggttc 1851

---

>gb|AY261674.1| Citrus x paradisi HSP70 mRNA, partial cds
          Length = 276

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 113/138 (81%)
 Strand = Plus / Minus

                                                                       
Query: 322 gtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttcaag 381
           |||||||||||| || || |||||||| | | |||||||||| |||||||| ||||||| 
Sbjct: 276 gtacatcttggcaataattgggttgcagatgccctccagctctttcatcttatcttcaaa 217

                                                                       
Query: 382 ctcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatggcctc 441
           ||| || ||||| || |||||||||  ||| ||||| ||||||||  | || ||||| ||
Sbjct: 216 ctcatctgcctctgcgagctggttcccgtcaagccattggatggcctcctcaatggcatc 157

                             
Query: 442 ctcgatcttcttcttgtc 459
            || || |||||||||||
Sbjct: 156 ttcaattttcttcttgtc 139

---

>gb|BT013586.1| Lycopersicon esculentum clone 132340F, mRNA sequence
          Length = 2190

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 82/97 (84%)
 Strand = Plus / Minus

                                                                        
Query: 309  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 368
            |||||||||||||||||||||| || |||||||| || || | | |||| ||||||||||
Sbjct: 1959 caccagcaccctggtacatctttgcaatgatgggattacagatgccctcgagctccttca 1900

                                                 
Query: 369  tcttgtcttcaagctcgtccgcctcagcaagctggtt 405
            ||||||| |||| ||| ||  | || |||||||||||
Sbjct: 1899 tcttgtcctcaaactcatcaacttctgcaagctggtt 1863

---

>emb|X54029.1|LEHSC170 Lycopersicon esculentum hsc-1 mRNA for heat shock protein 70 kD
          Length = 2120

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 82/97 (84%)
 Strand = Plus / Minus

                                                                        
Query: 309  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 368
            |||||||||||||||||||||| || |||||||| || || | | |||| ||||||||||
Sbjct: 1907 caccagcaccctggtacatctttgcaatgatgggattacagatgccctcgagctccttca 1848

                                                 
Query: 369  tcttgtcttcaagctcgtccgcctcagcaagctggtt 405
            ||||||| |||| ||| ||  | || |||||||||||
Sbjct: 1847 tcttgtcctcaaactcatcaacttctgcaagctggtt 1811

---

>gb|DQ124007.1| Coffea arabica x Coffea canephora clone HT-SSH4-F01 mRNA sequence
          Length = 262

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 88/105 (83%)
 Strand = Plus / Minus

                                                                       
Query: 322 gtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttcaag 381
           |||||||||||| |||||||| ||||| |||  ||||||||||||||||||||| || | 
Sbjct: 262 gtacatcttggctatgatgggattgcaaaggctctccagctccttcatcttgtcctcgaa 203

                                                        
Query: 382 ctcgtccgcctcagcaagctggttcgtgtccagccactggatggc 426
            || || |||||||| ||||| ||  |||| ||||||| ||||||
Sbjct: 202 ttcatctgcctcagctagctgattactgtcaagccacttgatggc 158

---

>emb|X99197.1|MS70KDHSP M.sativa mRNA for 70 kD heat shock protein
          Length = 830

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 63/72 (87%)
 Strand = Plus / Minus

                                                                       
Query: 309 caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 368
           |||||||||| || ||||||||| | ||||| |||||||| | | |||||||||||||||
Sbjct: 560 caccagcaccttgatacatcttgccaatgatagggttgcaaatgccctccagctccttca 501

                       
Query: 369 tcttgtcttcaa 380
           ||||||| ||||
Sbjct: 500 tcttgtcctcaa 489

---

>gb|AY830127.1| Medicago sativa heat shock protein 70 (HSP70-1) mRNA, complete cds
          Length = 2302

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 77/91 (84%)
 Strand = Plus / Minus

                                                                        
Query: 315  caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 374
            |||| ||||||||||| || ||||| |||||||| | ||  || ||||||||||||||||
Sbjct: 1962 caccttggtacatctttgcaatgattgggttgcagatggtttcaagctccttcatcttgt 1903

                                           
Query: 375  cttcaagctcgtccgcctcagcaagctggtt 405
            |||| | ||| || || ||||||||||||||
Sbjct: 1902 cttcgaactcatcggcttcagcaagctggtt 1872



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 229  ttagtcgacctcctcgatcttggggccag 257
            ||||||||||||||| |||||||| ||||
Sbjct: 2054 ttagtcgacctcctcaatcttgggaccag 2026

---

>gb|AC146757.19| Medicago truncatula clone mth2-16n21, complete sequence
          Length = 135915

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 77/91 (84%)
 Strand = Plus / Plus

                                                                          
Query: 315    caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 374
              |||| ||||||||||| || ||||| ||||| || |  | ||| ||||||||||||||||
Sbjct: 118421 caccttggtacatctttgcaatgattgggttacagattgtctcaagctccttcatcttgt 118480

                                             
Query: 375    cttcaagctcgtccgcctcagcaagctggtt 405
              |||||| ||| || || ||||||||||||||
Sbjct: 118481 cttcaaactcatcggcttcagcaagctggtt 118511



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 111/137 (81%)
 Strand = Plus / Minus

                                                                         
Query: 323   tacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttcaagc 382
             ||||||||||| ||||| |||||||| |||  ||| || ||||||||||| ||||||| |
Sbjct: 35431 tacatcttggcaatgattgggttgcaaaggctctcaagttccttcatcttatcttcaaac 35372

                                                                         
Query: 383   tcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatggcctcc 442
             || || ||||| || | ||||||  |||||| |||||| || ||||| || || || || 
Sbjct: 35371 tcatcagcctctgccaactggttactgtccaaccactgaattgcagcgtcaattgcatca 35312

                              
Query: 443   tcgatcttcttcttgtc 459
             || |||||||| |||||
Sbjct: 35311 tcaatcttctttttgtc 35295



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 229    ttagtcgacctcctcgatcttggggccag 257
              ||||||||||||||| |||||||| ||||
Sbjct: 118329 ttagtcgacctcctcaatcttgggaccag 118357

---

>gb|AC147536.12| Medicago truncatula clone mth2-9l3, complete sequence
          Length = 111486

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 77/91 (84%)
 Strand = Plus / Plus

                                                                         
Query: 315   caccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgt 374
             |||| ||||||||||| || ||||| ||||| || |  | ||| ||||||||||||||||
Sbjct: 93989 caccttggtacatctttgcaatgattgggttacagattgtctcaagctccttcatcttgt 94048

                                            
Query: 375   cttcaagctcgtccgcctcagcaagctggtt 405
             |||||| ||| || || ||||||||||||||
Sbjct: 94049 cttcaaactcatcggcttcagcaagctggtt 94079



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 111/137 (81%)
 Strand = Plus / Minus

                                                                         
Query: 323   tacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttcaagc 382
             ||||||||||| ||||| |||||||| |||  ||| || ||||||||||| ||||||| |
Sbjct: 10998 tacatcttggcaatgattgggttgcaaaggctctcaagttccttcatcttatcttcaaac 10939

                                                                         
Query: 383   tcgtccgcctcagcaagctggttcgtgtccagccactggatggcagcatcgatggcctcc 442
             || || ||||| || | ||||||  |||||| |||||| || ||||| || || || || 
Sbjct: 10938 tcatcagcctctgccaactggttactgtccaaccactgaattgcagcgtcaattgcatca 10879

                              
Query: 443   tcgatcttcttcttgtc 459
             || |||||||| |||||
Sbjct: 10878 tcaatcttctttttgtc 10862



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 229   ttagtcgacctcctcgatcttggggccag 257
             ||||||||||||||| |||||||| ||||
Sbjct: 93897 ttagtcgacctcctcaatcttgggaccag 93925

---

>gb|S85730.1| hsc71=major heat-shock-protein-like gene [rainbow trout, testes,
            Genomic, 6825 nt]
          Length = 6825

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                      
Query: 309  caccagcaccctggtacatcttggcgatgatggggttgcaca 350
            |||||||||||||||||| ||||| |||||||||||||||||
Sbjct: 6055 caccagcaccctggtacagcttggtgatgatggggttgcaca 6014

---

>dbj|AB196460.1| Oncorhynchus mykiss HSC70A mRNA for heat shock 70kDa protein 8
            isoform a, complete cds
          Length = 2359

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                      
Query: 309  caccagcaccctggtacatcttggcgatgatggggttgcaca 350
            |||||||||||||||||| ||||| |||||||||||||||||
Sbjct: 1958 caccagcaccctggtacagcttggtgatgatggggttgcaca 1917

---

>ref|NM_120328.2| Arabidopsis thaliana HSC70-1; ATP binding AT5G02500 (HSC70-1) mRNA,
            complete cds
          Length = 2371

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 81/97 (83%)
 Strand = Plus / Minus

                                                                        
Query: 309  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 368
            ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 1969 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 1910

                                                 
Query: 369  tcttgtcttcaagctcgtccgcctcagcaagctggtt 405
            |||||||||| | ||| || |||||||| | ||||||
Sbjct: 1909 tcttgtcttcgaactcatcagcctcagccaactggtt 1873



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 229  ttagtcgacctcctcgatctt 249
            |||||||||||||||||||||
Sbjct: 2061 ttagtcgacctcctcgatctt 2041



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 440  tcctcgatcttcttcttgtc 459
            ||||||||||||||||||||
Sbjct: 1838 tcctcgatcttcttcttgtc 1819

---

>emb|X77199.1|ATHSC701 A.thaliana hsc70-1 gene
          Length = 4297

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 81/97 (83%)
 Strand = Plus / Minus

                                                                        
Query: 309  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 368
            ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 2146 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 2087

                                                 
Query: 369  tcttgtcttcaagctcgtccgcctcagcaagctggtt 405
            |||||||||| | ||| || |||||||| | ||||||
Sbjct: 2086 tcttgtcttcgaactcatcagcctcagccaactggtt 2050



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 229  ttagtcgacctcctcgatctt 249
            |||||||||||||||||||||
Sbjct: 2238 ttagtcgacctcctcgatctt 2218



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 440  tcctcgatcttcttcttgtc 459
            ||||||||||||||||||||
Sbjct: 2015 tcctcgatcttcttcttgtc 1996

---

>emb|X74604.1|ATHSC70 A.thaliana hsc70 mRNA for heat shock cognate protein
          Length = 2209

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 81/97 (83%)
 Strand = Plus / Minus

                                                                        
Query: 309  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 368
            ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 1938 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 1879

                                                 
Query: 369  tcttgtcttcaagctcgtccgcctcagcaagctggtt 405
            |||||||||| | ||| || |||||||| | ||||||
Sbjct: 1878 tcttgtcttcgaactcatcagcctcagccaactggtt 1842



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 229  ttagtcgacctcctcgatctt 249
            |||||||||||||||||||||
Sbjct: 2030 ttagtcgacctcctcgatctt 2010



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 440  tcctcgatcttcttcttgtc 459
            ||||||||||||||||||||
Sbjct: 1807 tcctcgatcttcttcttgtc 1788

---

>gb|AY035123.1| Arabidopsis thaliana putative dnaK-type molecular chaperone hsc70.1
           protein (At5g02500) mRNA, partial cds
          Length = 860

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 81/97 (83%)
 Strand = Plus / Minus

                                                                       
Query: 309 caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 368
           ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 556 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 497

                                                
Query: 369 tcttgtcttcaagctcgtccgcctcagcaagctggtt 405
           |||||||||| | ||| || |||||||| | ||||||
Sbjct: 496 tcttgtcttcgaactcatcagcctcagccaactggtt 460



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 229 ttagtcgacctcctcgatctt 249
           |||||||||||||||||||||
Sbjct: 648 ttagtcgacctcctcgatctt 628



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 440 tcctcgatcttcttcttgtc 459
           ||||||||||||||||||||
Sbjct: 425 tcctcgatcttcttcttgtc 406

---

>emb|AL162971.1|ATT22P11 Arabidopsis thaliana DNA chromosome 5, BAC clone T22P11 (ESSA project)
          Length = 96424

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 81/97 (83%)
 Strand = Plus / Plus

                                                                         
Query: 309   caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 368
             ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 35077 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 35136

                                                  
Query: 369   tcttgtcttcaagctcgtccgcctcagcaagctggtt 405
             |||||||||| | ||| || |||||||| | ||||||
Sbjct: 35137 tcttgtcttcgaactcatcagcctcagccaactggtt 35173



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                         
Query: 320   tggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttca 379
             ||||||||||| |||||||| || ||||| |    ||||| |||||||||||||||||||
Sbjct: 31335 tggtacatcttagcgatgatcggattgcaaacactctccaactccttcatcttgtcttca 31394

                     
Query: 380   agctcgtc 387
             | ||||||
Sbjct: 31395 aactcgtc 31402



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 229   ttagtcgacctcctcgatctt 249
             |||||||||||||||||||||
Sbjct: 34985 ttagtcgacctcctcgatctt 35005



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 229   ttagtcgacctcctcgatcttggggccag 257
             ||||||||| |||||||||||||| ||||
Sbjct: 31226 ttagtcgacttcctcgatcttgggaccag 31254



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 440   tcctcgatcttcttcttgtc 459
             ||||||||||||||||||||
Sbjct: 35208 tcctcgatcttcttcttgtc 35227

---

>gb|AY120747.1| Arabidopsis thaliana DnaK-type molecular chaperone hsc70.1
            (At5g02500) mRNA, complete cds
          Length = 2254

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 81/97 (83%)
 Strand = Plus / Minus

                                                                        
Query: 309  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 368
            ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 1968 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 1909

                                                 
Query: 369  tcttgtcttcaagctcgtccgcctcagcaagctggtt 405
            |||||||||| | ||| || |||||||| | ||||||
Sbjct: 1908 tcttgtcttcgaactcatcagcctcagccaactggtt 1872



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 229  ttagtcgacctcctcgatctt 249
            |||||||||||||||||||||
Sbjct: 2060 ttagtcgacctcctcgatctt 2040



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 440  tcctcgatcttcttcttgtc 459
            ||||||||||||||||||||
Sbjct: 1837 tcctcgatcttcttcttgtc 1818

---

>gb|AY057481.1| Arabidopsis thaliana AT5g02500/T22P11_90 mRNA, complete cds
          Length = 2228

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 81/97 (83%)
 Strand = Plus / Minus

                                                                        
Query: 309  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 368
            ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 1968 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 1909

                                                 
Query: 369  tcttgtcttcaagctcgtccgcctcagcaagctggtt 405
            |||||||||| | ||| || |||||||| | ||||||
Sbjct: 1908 tcttgtcttcgaactcatcagcctcagccaactggtt 1872



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 229  ttagtcgacctcctcgatctt 249
            |||||||||||||||||||||
Sbjct: 2060 ttagtcgacctcctcgatctt 2040



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 440  tcctcgatcttcttcttgtc 459
            ||||||||||||||||||||
Sbjct: 1837 tcctcgatcttcttcttgtc 1818

---

>emb|BX832460.1|CNS0A1Q8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH75ZA02 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 2188

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 81/97 (83%)
 Strand = Plus / Minus

                                                                        
Query: 309  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 368
            ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 1949 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 1890

                                                 
Query: 369  tcttgtcttcaagctcgtccgcctcagcaagctggtt 405
            |||||||||| | ||| || |||||||| | ||||||
Sbjct: 1889 tcttgtcttcgaactcatcagcctcagccaactggtt 1853



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 229  ttagtcgacctcctcgatctt 249
            |||||||||||||||||||||
Sbjct: 2041 ttagtcgacctcctcgatctt 2021



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 440  tcctcgatcttcttcttgtc 459
            ||||||||||||||||||||
Sbjct: 1818 tcctcgatcttcttcttgtc 1799

---

>gb|BT002754.1| Arabidopsis thaliana clone C104920 putative dnaK-type molecular
            chaperone hsc70.1 protein (At5g02500) mRNA, complete cds
          Length = 1987

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 81/97 (83%)
 Strand = Plus / Minus

                                                                        
Query: 309  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 368
            ||||||| || |||||||||||||| ||||| |||||||| | |  |||||  |||||||
Sbjct: 1864 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaattccttca 1805

                                                 
Query: 369  tcttgtcttcaagctcgtccgcctcagcaagctggtt 405
            |||||||||| | ||| || |||||||| | ||||||
Sbjct: 1804 tcttgtcttcgaactcatcagcctcagccaactggtt 1768



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 229  ttagtcgacctcctcgatctt 249
            |||||||||||||||||||||
Sbjct: 1956 ttagtcgacctcctcgatctt 1936



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 440  tcctcgatcttcttcttgtc 459
            ||||||||||||||||||||
Sbjct: 1733 tcctcgatcttcttcttgtc 1714

---

>gb|AY929184.1| Latimeria chalumnae heat shock protein 70 (Hsp70) gene, partial cds
          Length = 1839

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 84/101 (83%)
 Strand = Plus / Minus

                                                                        
Query: 317  ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 376
            |||||||||| ||||||||||||||| |||||||    |||||| |||||| ||||||  
Sbjct: 1757 ccctggtacagcttggcgatgatgggtttgcacacttgctccagttccttcttcttgtgc 1698

                                                     
Query: 377  tcaagctcgtccgcctcagcaagctggttcgtgtccagcca 417
            |||  |||||||  |||||| ||||||||  ||||||||||
Sbjct: 1697 tcatactcgtccttctcagccagctggttgctgtccagcca 1657

---

>gb|BC077998.1| Xenopus laevis cDNA clone MGC:82390 IMAGE:4406669, complete cds
          Length = 2723

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                        
Query: 309  caccagcaccctggtacatcttggcgatgatggggttgcacagg 352
            |||||||||||||||| | ||||| |||||||||||||||||||
Sbjct: 1874 caccagcaccctggtatagcttggtgatgatggggttgcacagg 1831

---

>emb|X54030.1|LEHSC270 Lycopersicon esculentum hsc-2 mRNA for heat shock protein cognate 70
          Length = 2117

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                        
Query: 299  tccatgtcggcaccagcaccctggtacatcttggcgatgatggggttgcacagggcctcc 358
            ||||||||  |||| || || |||||||| || || ||||| |||||||| ||   ||| 
Sbjct: 1946 tccatgtcaccacctgctccttggtacatttttgcaatgatagggttgcaaagactctct 1887

                                                                        
Query: 359  agctccttcatcttgtcttcaagctcgtccgcctcagcaagctggttcgtgtccagccac 418
            ||||||||||||||||| |||| ||| || |||||||| ||||||||    || ||||||
Sbjct: 1886 agctccttcatcttgtcctcaaactcttcagcctcagcgagctggttaccatcaagccac 1827

                    
Query: 419  tggatggc 426
            ||||||||
Sbjct: 1826 tggatggc 1819

---

>gb|L41253.1|TOMHSC70A Lycopersicon esculentum Hsc70 gene, complete cds
          Length = 3573

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 56/64 (87%)
 Strand = Plus / Minus

                                                                        
Query: 317  ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtct 376
            |||||||||||||| ||||| ||||||||||| | |  ||| ||||||||||||||||| 
Sbjct: 3206 ccctggtacatcttcgcgataatggggttgcatatgctctcaagctccttcatcttgtcc 3147

                
Query: 377  tcaa 380
            ||||
Sbjct: 3146 tcaa 3143

---

>gb|DQ324856.1| Haliotis discus hannai heat shock protein 70 mRNA, complete cds
          Length = 2631

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 83/100 (83%)
 Strand = Plus / Minus

                                                                        
Query: 318  cctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtctt 377
            ||||||||| ||||| |||||||||||| ||||   ||||||||||||||  ||||| ||
Sbjct: 1924 cctggtacaacttggtgatgatggggttacacactccctccagctccttctgcttgtgtt 1865

                                                    
Query: 378  caagctcgtccgcctcagcaagctggttcgtgtccagcca 417
            | | ||| |||  ||| ||||||||||| | |||||||||
Sbjct: 1864 cgaactcatccttctcggcaagctggttagagtccagcca 1825

---

>gb|DQ059998.1| Volvox carteri f. nagariensis heat-shock inducible Hsp70 (hsp70A)
            gene, complete cds
          Length = 6449

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 229  ttagtcgacctcctcgatcttggggccagggccgc 263
            ||||||||||||||||||||||||||||| |||||
Sbjct: 5694 ttagtcgacctcctcgatcttggggccagcgccgc 5660

---

>gb|DQ059999.1| Volvox carteri f. nagariensis heat-shock inducible Hsp70 (hsp70A)
            mRNA, complete cds
          Length = 1950

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 229  ttagtcgacctcctcgatcttggggccagggccgc 263
            ||||||||||||||||||||||||||||| |||||
Sbjct: 1950 ttagtcgacctcctcgatcttggggccagcgccgc 1916

---

>gb|AF035414.1|AF035414 Brassica napus heat shock cognate protein (Hsc70) mRNA, complete cds
          Length = 2184

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 121/151 (80%)
 Strand = Plus / Minus

                                                                        
Query: 309  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttca 368
            ||||||| || |||||||||||||| ||||| |||||||| | |  ||||| ||||||||
Sbjct: 1930 caccagctccttggtacatcttggcaatgattgggttgcagatgctctccaactccttca 1871

                                                                        
Query: 369  tcttgtcttcaagctcgtccgcctcagcaagctggttcgtgtccagccactggatggcag 428
            ||||||| || | ||| || |||||| | | ||| ||  | ||||||||||| || ||  
Sbjct: 1870 tcttgtcctcgaactcatcagcctcacccaactgattgttctccagccactgaatcgcct 1811

                                           
Query: 429  catcgatggcctcctcgatcttcttcttgtc 459
              || || || ||||||||||||||||||||
Sbjct: 1810 gctcaatagcgtcctcgatcttcttcttgtc 1780



 Score = 46.1 bits (23), Expect = 0.10
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                        
Query: 229  ttagtcgacctcctcgatcttggggccagggccgccggatgcagcaggggtgtcatcgtc 288
            |||||||||||| |||||||| |||||||  ||||| || |||| ||| |  ||||||||
Sbjct: 2007 ttagtcgacctcttcgatcttagggccagcaccgcctgaggcaggaggagcatcatcgtc 1948

               
Query: 289  cat 291
            |||
Sbjct: 1947 cat 1945

---

>gb|AY485987.1| Vigna radiata 70 kDa heat shock cognate protein 2 mRNA, complete cds
          Length = 2264

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 115/143 (80%), Gaps = 3/143 (2%)
 Strand = Plus / Minus

                                                                        
Query: 281  tcatcgtccatgccaccctccatgtcggcaccagcacc---ctggtacatcttggcgatg 337
            ||||||||||| |||||  ||||||| | |||||||||   ||||||||||||||| |||
Sbjct: 1905 tcatcgtccattccacctcccatgtctggaccagcacctccctggtacatcttggcaatg 1846

                                                                        
Query: 338  atggggttgcacagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagca 397
            || || ||||| | |   ||||  |||||||| ||||| |||| ||| || |||||  ||
Sbjct: 1845 ataggattgcagatgctttccaattccttcattttgtcctcaaactcatctgcctctcca 1786

                                   
Query: 398  agctggttcgtgtccagccactg 420
            || |||||  |||||||||||||
Sbjct: 1785 agttggttgctgtccagccactg 1763

---

>emb|CR735051.2|CNS0GTY2 Tetraodon nigroviridis full-length cDNA
          Length = 1868

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1577 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1521

---

>emb|CR734665.2|CNS0GTNC Tetraodon nigroviridis full-length cDNA
          Length = 2238

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1940 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1884

---

>emb|CR732389.2|CNS0GS22 Tetraodon nigroviridis full-length cDNA
          Length = 1982

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1687 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1631

---

>emb|CR731254.2|CNS0GR6J Tetraodon nigroviridis full-length cDNA
          Length = 1156

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 311 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 854 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 798

---

>emb|CR730967.2|CNS0GQYK Tetraodon nigroviridis full-length cDNA
          Length = 2232

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1933 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1877

---

>emb|CR730283.2|CNS0GQFK Tetraodon nigroviridis full-length cDNA
          Length = 2238

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1942 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1886

---

>emb|CR729311.2|CNS0GPOL Tetraodon nigroviridis full-length cDNA
          Length = 2216

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1927 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1871

---

>emb|CR725754.2|CNS0GMXS Tetraodon nigroviridis full-length cDNA
          Length = 1557

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 311 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 801 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 745

---

>emb|CR724374.2|CNS0GLVG Tetraodon nigroviridis full-length cDNA
          Length = 1874

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1575 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1519

---

>emb|CR722706.2|CNS0GKL4 Tetraodon nigroviridis full-length cDNA
          Length = 1374

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1078 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1022

---

>emb|CR719367.2|CNS0GI0D Tetraodon nigroviridis full-length cDNA
          Length = 646

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 311 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 347 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 291

---

>emb|CR716753.2|CNS0GFZU Tetraodon nigroviridis full-length cDNA
          Length = 956

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 311 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 657 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 601

---

>emb|CR711358.2|CNS0GBU2 Tetraodon nigroviridis full-length cDNA
          Length = 623

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 311 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 324 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 268

---

>emb|CR703631.2|CNS0G5VF Tetraodon nigroviridis full-length cDNA
          Length = 1151

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 311 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 870 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 814

---

>emb|CR699773.2|CNS0G2W9 Tetraodon nigroviridis full-length cDNA
          Length = 1414

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1114 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1058

---

>emb|CR700210.2|CNS0G38E Tetraodon nigroviridis full-length cDNA
          Length = 1664

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1377 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1321

---

>emb|CR699628.2|CNS0G2S8 Tetraodon nigroviridis full-length cDNA
          Length = 1096

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 311 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 800 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 744

---

>emb|CR699327.2|CNS0G2JV Tetraodon nigroviridis full-length cDNA
          Length = 1645

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1349 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1293

---

>emb|CR698441.2|CNS0G1V9 Tetraodon nigroviridis full-length cDNA
          Length = 433

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 311 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 134 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 78

---

>emb|CR696974.2|CNS0G0QI Tetraodon nigroviridis full-length cDNA
          Length = 1832

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1543 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1487

---

>emb|CR696115.2|CNS0G02N Tetraodon nigroviridis full-length cDNA
          Length = 2230

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1931 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1875

---

>emb|CR694651.2|CNS0FYXZ Tetraodon nigroviridis full-length cDNA
          Length = 1683

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1393 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1337

---

>emb|CR693639.2|CNS0FY5V Tetraodon nigroviridis full-length cDNA
          Length = 2235

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1939 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1883

---

>emb|CR691059.2|CNS0FW67 Tetraodon nigroviridis full-length cDNA
          Length = 1779

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1485 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1429

---

>emb|CR688768.2|CNS0FUEK Tetraodon nigroviridis full-length cDNA
          Length = 1419

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1123 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1067

---

>emb|CR688743.2|CNS0FUDV Tetraodon nigroviridis full-length cDNA
          Length = 1013

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 311 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 725 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 669

---

>emb|CR688098.2|CNS0FTVY Tetraodon nigroviridis full-length cDNA
          Length = 2216

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1929 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1873

---

>emb|CR685229.2|CNS0FRO9 Tetraodon nigroviridis full-length cDNA
          Length = 2234

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1937 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1881

---

>emb|CR684600.2|CNS0FR6S Tetraodon nigroviridis full-length cDNA
          Length = 2217

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1932 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1876

---

>emb|CR682045.2|CNS0FP7T Tetraodon nigroviridis full-length cDNA
          Length = 1538

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1253 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1197

---

>emb|CR682007.2|CNS0FP6R Tetraodon nigroviridis full-length cDNA
          Length = 978

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 311 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 679 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 623

---

>emb|CR681947.2|CNS0FP53 Tetraodon nigroviridis full-length cDNA
          Length = 1673

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1377 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1321

---

>emb|CR681557.2|CNS0FOU9 Tetraodon nigroviridis full-length cDNA
          Length = 1581

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1281 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1225

---

>emb|CR680840.2|CNS0FOAC Tetraodon nigroviridis full-length cDNA
          Length = 1046

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 311 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 746 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 690

---

>emb|CR680599.1|CNS0FO3N Tetraodon nigroviridis full-length cDNA
          Length = 1226

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 311 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 948 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 892

---

>emb|CR674390.2|CNS0FJBW Tetraodon nigroviridis full-length cDNA
          Length = 1296

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1005 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 949

---

>emb|CR673444.2|CNS0FILM Tetraodon nigroviridis full-length cDNA
          Length = 1467

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1170 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1114

---

>emb|CR668849.2|CNS0FF1Z Tetraodon nigroviridis full-length cDNA
          Length = 1580

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1282 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1226

---

>emb|CR668292.2|CNS0FEMI Tetraodon nigroviridis full-length cDNA
          Length = 1459

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1167 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1111

---

>emb|CR666588.2|CNS0FDB6 Tetraodon nigroviridis full-length cDNA
          Length = 1261

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 311 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 963 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 907

---

>emb|CR664947.2|CNS0FC1L Tetraodon nigroviridis full-length cDNA
          Length = 1560

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1262 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1206

---

>emb|CR664739.2|CNS0FBVT Tetraodon nigroviridis full-length cDNA
          Length = 917

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 311 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 617 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 561

---

>emb|CR664071.2|CNS0FBD9 Tetraodon nigroviridis full-length cDNA
          Length = 2047

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1762 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1706

---

>emb|CR663097.2|CNS0FAM7 Tetraodon nigroviridis full-length cDNA
          Length = 1285

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1002 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 946

---

>emb|CR662148.2|CNS0F9VU Tetraodon nigroviridis full-length cDNA
          Length = 1562

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1263 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1207

---

>emb|CR657309.2|CNS0F65F Tetraodon nigroviridis full-length cDNA
          Length = 1218

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 311 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 930 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 874

---

>emb|CR656869.2|CNS0F5T7 Tetraodon nigroviridis full-length cDNA
          Length = 1801

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1505 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1449

---

>emb|CR655448.1|CNS0F4PQ Tetraodon nigroviridis full-length cDNA
          Length = 1372

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1088 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1032

---

>emb|CR656433.1|CNS0F5H3 Tetraodon nigroviridis full-length cDNA
          Length = 1511

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1212 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1156

---

>emb|CR656379.1|CNS0F5FL Tetraodon nigroviridis full-length cDNA
          Length = 2215

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1930 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1874

---

>emb|CR656173.1|CNS0F59V Tetraodon nigroviridis full-length cDNA
          Length = 1228

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 311 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 938 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 882

---

>emb|CR655567.2|CNS0F4T1 Tetraodon nigroviridis full-length cDNA
          Length = 1251

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 311 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 954 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 898

---

>emb|CR654938.1|CNS0F4BK Tetraodon nigroviridis full-length cDNA
          Length = 1232

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 311 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 939 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 883

---

>emb|CR654405.2|CNS0F3WR Tetraodon nigroviridis full-length cDNA
          Length = 1263

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 311 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 968 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 912

---

>emb|CR654109.2|CNS0F3OJ Tetraodon nigroviridis full-length cDNA
          Length = 1642

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1377 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1321

---

>emb|CR654231.1|CNS0F3RX Tetraodon nigroviridis full-length cDNA
          Length = 2038

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1753 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1697

---

>emb|CR651953.2|CNS0F20N Tetraodon nigroviridis full-length cDNA
          Length = 1144

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 311 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 847 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 791

---

>emb|CR651660.2|CNS0F1SI Tetraodon nigroviridis full-length cDNA
          Length = 431

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 311 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 134 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 78

---

>emb|CR651251.2|CNS0F1H5 Tetraodon nigroviridis full-length cDNA
          Length = 1937

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1640 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1584

---

>emb|CR650378.1|CNS0F0SW Tetraodon nigroviridis full-length cDNA
          Length = 1483

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1199 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1143

---

>emb|CR649698.2|CNS0F0A0 Tetraodon nigroviridis full-length cDNA
          Length = 1245

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 311 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 946 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 890

---

>emb|CR648821.2|CNS0EZLN Tetraodon nigroviridis full-length cDNA
          Length = 1887

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1586 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1530

---

>emb|CR643803.1|CNS0EVQ9 Tetraodon nigroviridis full-length cDNA
          Length = 1221

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 311 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 942 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 886

---

>emb|CR641941.2|CNS0EUAJ Tetraodon nigroviridis full-length cDNA
          Length = 445

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 311 ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
           ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 146 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 90

---

>emb|CR638956.2|CNS0ERZM Tetraodon nigroviridis full-length cDNA
          Length = 2037

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1756 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1700

---

>emb|CR633864.2|CNS0EO26 Tetraodon nigroviridis full-length cDNA
          Length = 1618

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1323 ccagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1267

---

>emb|X62799.1|GMHSP70 Glycine max hsp 70 gene
          Length = 3272

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                 
Query: 312  cagcaccctggtacatcttggcgatgatggggttgca 348
            ||||||||||||||||||| || ||||||||||||||
Sbjct: 2628 cagcaccctggtacatcttagcaatgatggggttgca 2592

---

>ref|NM_120327.3| Arabidopsis thaliana ATP binding AT5G02490 mRNA, complete cds
          Length = 2303

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                        
Query: 320  tggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttca 379
            ||||||||||| |||||||| || ||||| |    ||||| |||||||||||||||||||
Sbjct: 1933 tggtacatcttagcgatgatcggattgcaaacactctccaactccttcatcttgtcttca 1874

                    
Query: 380  agctcgtc 387
            | ||||||
Sbjct: 1873 aactcgtc 1866



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 229  ttagtcgacctcctcgatcttggggccag 257
            ||||||||| |||||||||||||| ||||
Sbjct: 2042 ttagtcgacttcctcgatcttgggaccag 2014

---

>emb|CR734111.2|CNS0GT7Y Tetraodon nigroviridis full-length cDNA
          Length = 1839

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 312  cagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            |||||| |||||||||||| | |||||||||||||||||    |||||||||||||
Sbjct: 1541 cagcactctggtacatctttgtgatgatggggttgcacaccttctccagctccttc 1486

---

>emb|CR728102.2|CNS0GOR0 Tetraodon nigroviridis full-length cDNA
          Length = 2238

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcaca 350
            ||||||| |||||||||||| | |||||||||||||||||
Sbjct: 1940 ccagcactctggtacatctttgtgatgatggggttgcaca 1901

---

>emb|CR703946.1|CNS0G646 Tetraodon nigroviridis full-length cDNA
          Length = 2204

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcaca 350
            ||||||| |||||||||||| | |||||||||||||||||
Sbjct: 1922 ccagcactctggtacatctttgtgatgatggggttgcaca 1883

---

>emb|CR683400.2|CNS0FQ9G Tetraodon nigroviridis full-length cDNA
          Length = 1560

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcaca 350
            ||||||| |||||||||||| | |||||||||||||||||
Sbjct: 1274 ccagcactctggtacatctttgtgatgatggggttgcaca 1235

---

>emb|CR656537.1|CNS0F5JZ Tetraodon nigroviridis full-length cDNA
          Length = 1198

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 311 ccagcaccctggtacatcttggcgatgatggggttgcaca 350
           ||||||| |||||||||||| | |||||||||||||||||
Sbjct: 902 ccagcactctggtacatctttgtgatgatggggttgcaca 863

---

>gb|BT008411.1| Arabidopsis thaliana At5g02490 gene, complete cds
          Length = 1962

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                        
Query: 320  tggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttca 379
            ||||||||||| |||||||| || ||||| |    ||||| |||||||||||||||||||
Sbjct: 1853 tggtacatcttagcgatgatcggattgcaaacactctccaactccttcatcttgtcttca 1794

                    
Query: 380  agctcgtc 387
            | ||||||
Sbjct: 1793 aactcgtc 1786



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 229  ttagtcgacctcctcgatcttggggccag 257
            ||||||||| |||||||||||||| ||||
Sbjct: 1962 ttagtcgacttcctcgatcttgggaccag 1934

---

>gb|AY093152.1| Arabidopsis thaliana DnaK-type molecular chaperone hsc70.1-like
            (At5g02490) mRNA, complete cds
          Length = 2124

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                        
Query: 320  tggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttca 379
            ||||||||||| |||||||| || ||||| |    ||||| |||||||||||||||||||
Sbjct: 1933 tggtacatcttagcgatgatcggattgcaaacactctccaactccttcatcttgtcttca 1874

                    
Query: 380  agctcgtc 387
            | ||||||
Sbjct: 1873 aactcgtc 1866



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 229  ttagtcgacctcctcgatcttggggccag 257
            ||||||||| |||||||||||||| ||||
Sbjct: 2042 ttagtcgacttcctcgatcttgggaccag 2014

---

>emb|Y08892.1|ATHSC70G8 A.thaliana mRNA for Hsc70-G8 protein, partial
          Length = 315

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 320 tggtacatcttggcgatgatggggttgcacagggcctccagctccttcatcttgtcttca 379
           ||||||||||| |||||||| || ||||| |    ||||| |||||||||||||||||||
Sbjct: 206 tggtacatcttagcgatgatcggattgcaaacactctccaactccttcatcttgtcttca 147

                   
Query: 380 agctcgtc 387
           | ||||||
Sbjct: 146 aactcgtc 139



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 229 ttagtcgacctcctcgatcttggggccag 257
           |||||||||||||||||||||||| ||||
Sbjct: 315 ttagtcgacctcctcgatcttgggaccag 287

---

>gb|U23504.1|TNU23504 Trichoplusia ni HSC70 mRNA, complete cds
          Length = 2161

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                            
Query: 317  ccctggtacatcttggcgatgatggggttgca 348
            |||||||||||||||| |||||||||||||||
Sbjct: 1953 ccctggtacatcttggtgatgatggggttgca 1922



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 226  tgtttagtcgacctcctcgat 246
            |||||||||||||||||||||
Sbjct: 2074 tgtttagtcgacctcctcgat 2054

---

>emb|CR626889.13| Zebrafish DNA sequence from clone DKEY-4P15 in linkage group 15, complete
              sequence
          Length = 205513

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                                 
Query: 317    ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
              |||||||||| ||||| ||||||||||||||| ||   |||||||||||||
Sbjct: 138774 ccctggtacagcttggtgatgatggggttgcagagcttctccagctccttc 138824

---

>gb|AY762969.1| Acanthopagrus schlegelii HSC70 (HSC70) mRNA, complete cds
          Length = 1953

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                       
Query: 309  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            |||| |||| |||||||| ||||| |||||||||||||||||    |||||||||||||
Sbjct: 1846 caccggcactctggtacaacttggtgatgatggggttgcacaccttctccagctccttc 1788

---

>gb|M76725.2| Chlamydomonas reinhardtii 70 kDa heat shock protein (hsp70) gene,
            complete cds
          Length = 4808

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                       
Query: 229  ttagtcgacctcctcgatcttggggcc 255
            |||||||||||||||||||||||||||
Sbjct: 3799 ttagtcgacctcctcgatcttggggcc 3773



 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 334  gatgatggggttgcacagggcctccagctcctt 366
            ||||||||||||||||||  |||||||||||||
Sbjct: 3682 gatgatggggttgcacagcccctccagctcctt 3650

---

>gb|AY029210.1| Ambystoma mexicanum heat shock protein 70 (HSP70) mRNA, complete cds
          Length = 2250

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                       
Query: 309  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            |||||||||||||||||| |||||  ||||| ||||||||||    |||||||||||||
Sbjct: 1901 caccagcaccctggtacagcttggtaatgatcgggttgcacactttctccagctccttc 1843

---

>ref|XM_686300.1| PREDICTED: Danio rerio similar to heat shock cognate 70 kDa protein
            (LOC562935), mRNA
          Length = 2448

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 317  ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            |||||||||| ||||| ||||||||||||||| ||   |||||||||||||
Sbjct: 2057 ccctggtacagcttggtgatgatggggttgcagagcttctccagctccttc 2007

---

>gb|AY436786.1| Rhabdosargus sarba heat shock cognate 70 (hsc70) mRNA, complete cds
          Length = 1950

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                       
Query: 309  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||||| |||||| | ||||| |||||||||||||||||    |||||||||||||
Sbjct: 1846 caccagcactctggtatagcttggtgatgatggggttgcacactttctccagctccttc 1788

---

>dbj|AB112815.1| Nicotiana benthamiana Hsp70 mRNA for heat shock protein 70, partial
           cds, sub_clone:NbHsp70c-B
          Length = 313

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 141/179 (78%)
 Strand = Plus / Minus

                                                                       
Query: 281 tcatcgtccatgccaccctccatgtcggcaccagcaccctggtacatcttggcgatgatg 340
           ||||| |||||| ||||  |||||||  |||| ||||| |||||||| ||||| ||||| 
Sbjct: 215 tcatcatccatggcaccgcccatgtcaccacctgcaccttggtacattttggcaatgatt 156

                                                                       
Query: 341 gggttgcacagggcctccagctccttcatcttgtcttcaagctcgtccgcctcagcaagc 400
           || ||||| | |  |||||   ||||||| ||||| ||||  || || | ||||||||||
Sbjct: 155 ggattgcagatgctctccaatcccttcattttgtcctcaaattcatcagactcagcaagc 96

                                                                      
Query: 401 tggttcgtgtccagccactggatggcagcatcgatggcctcctcgatcttcttcttgtc 459
           ||||| |  || |||||||| ||||| |  || ||||| || ||||||||||| |||||
Sbjct: 95  tggttggcatcaagccactgtatggctgactcaatggcatcttcgatcttctttttgtc 37



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 229 ttagtcgacctcctcgatctt 249
           |||||||||||||||||||||
Sbjct: 273 ttagtcgacctcctcgatctt 253

---

>gb|BC091445.1| Danio rerio cDNA clone IMAGE:7286763, containing frame-shift errors
          Length = 1375

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 317 ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
           |||||||||| ||||| ||||||||||||||| ||   |||||||||||||
Sbjct: 970 ccctggtacagcttggtgatgatggggttgcagagcttctccagctccttc 920

---

>ref|NM_104519.1| Arabidopsis thaliana HSP70T-1; ATP binding AT1G56410 (HSP70T-1) mRNA,
            complete cds
          Length = 1854

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                      
Query: 355  ctccagctccttcatcttgtcttcaagctcgtccgcctcagc 396
            ||||| |||||||||||||| ||||| |||||| ||||||||
Sbjct: 1812 ctccaactccttcatcttgtgttcaaactcgtcagcctcagc 1771

---

>gb|AY456093.1| Phytophthora nicotianae heat shock protein 70 (Hsp70a) gene,
           complete cds
          Length = 4220

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 222 cgactgtttagtcgacctcctcgatcttggggcc 255
           |||||| ||||||||||||||| |||||||||||
Sbjct: 407 cgactgcttagtcgacctcctcaatcttggggcc 440

---

>gb|DQ446367.1| Arabidopsis thaliana clone pENTR221-At1g56410 heat shock cognate 70
            kDa protein/HSC70/HSP70 (At1g56410) mRNA, complete cds
          Length = 1854

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                      
Query: 355  ctccagctccttcatcttgtcttcaagctcgtccgcctcagc 396
            ||||| |||||||||||||| ||||| |||||| ||||||||
Sbjct: 1812 ctccaactccttcatcttgtgttcaaactcgtcagcctcagc 1771

---

>gb|AY219845.1| Cyprinus carpio constitutive heat shock protein HSC70-2 (hsc70-2)
            mRNA, partial cds
          Length = 1935

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgca 348
            ||||||| |||||||| ||||| |||||||||||||||
Sbjct: 1829 ccagcactctggtacagcttggtgatgatggggttgca 1792

---

>emb|Z32537.1|PSHSC71R P.sativum (little marvel) HSC71.0 mRNA
          Length = 2122

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                              
Query: 315  caccctggtacatcttggcgatgatggggttgca 348
            ||||||||||||||||||| ||||| ||||||||
Sbjct: 1890 caccctggtacatcttggcaatgatagggttgca 1857

---

>emb|X51765.1|LPHSP70 L.polyphyllus mRNA for heat schock protein 70
          Length = 1005

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 32/34 (94%)
 Strand = Plus / Minus

                                             
Query: 315 caccctggtacatcttggcgatgatggggttgca 348
           ||||||||||||||||||| ||||| ||||||||
Sbjct: 684 caccctggtacatcttggcaatgattgggttgca 651

---

>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome
          Length = 4940217

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                             
Query: 431     tcgatggcctcctcgatcttcttcttgtcg 460
               ||||||||| ||||||||||||||||||||
Sbjct: 1338539 tcgatggccgcctcgatcttcttcttgtcg 1338510

---

>gb|AC058785.8|AC058785 Arabidopsis thaliana chromosome 1 BAC F13N6 genomic sequence, complete
             sequence
          Length = 90698

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                       
Query: 355   ctccagctccttcatcttgtcttcaagctcgtccgcctcagc 396
             ||||| |||||||||||||| ||||| |||||| ||||||||
Sbjct: 29212 ctccaactccttcatcttgtgttcaaactcgtcagcctcagc 29171

---

>dbj|AB196461.1| Oncorhynchus mykiss HSC70B mRNA for heat shock 70kDa protein 8
            isoform b, partial cds
          Length = 1864

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                      
Query: 309  caccagcaccctggtacatcttggcgatgatggggttgcaca 350
            |||| |||| |||||||| ||||| |||||||||||||||||
Sbjct: 1507 caccggcactctggtacagcttggtgatgatggggttgcaca 1466

---

>dbj|AB092840.1| Carassius auratus HSC70 mRNA for heat shock cognate 70 kDa, partial
            cds
          Length = 2208

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgca 348
            ||||||| |||||||| ||||| |||||||||||||||
Sbjct: 1792 ccagcactctggtacagcttggtgatgatggggttgca 1755

---

>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome
          Length = 4941439

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                             
Query: 431     tcgatggcctcctcgatcttcttcttgtcg 460
               ||||||||| ||||||||||||||||||||
Sbjct: 1362119 tcgatggccgcctcgatcttcttcttgtcg 1362090

---

>gb|AY423868.1| Leishmania tarentolae 70 kDa heat shock protein (hsp70) gene,
            complete cds
          Length = 1974

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                             
Query: 319  ctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||||||||||  ||||| |||||||| | | ||||||||||||||
Sbjct: 1845 ctggtacatcttggtcatgatcgggttgcatatgtcctccagctccttc 1797



 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 229  ttagtcgacctcctcgatcttggg 252
            ||||||||||||||||| ||||||
Sbjct: 1974 ttagtcgacctcctcgaccttggg 1951

---

>gb|AY078499.4| Dunaliella salina heat shock protein 70a (HSP70) mRNA, complete cds
          Length = 2652

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 228  tttagtcgacctcctcgatcttggg 252
            |||||||||||||||||||||||||
Sbjct: 2014 tttagtcgacctcctcgatcttggg 1990

---

>emb|X52314.1|LDHSP70 Leishmania hsp70 gene for heat shock protein 70
          Length = 2126

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                         
Query: 229  ttagtcgacctcctcgatcttggggccag 257
            ||||||||||||||||| |||||||||||
Sbjct: 2126 ttagtcgacctcctcgaccttggggccag 2098



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                             
Query: 319  ctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||||||||||  ||||| |||||||| | |  |||||||||||||
Sbjct: 2006 ctggtacatcttggtcatgatcgggttgcatacgctctccagctccttc 1958

---

>emb|X13301.1|PHHSP70R Petunia mRNA for heat shock protein hsp70
          Length = 2079

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 82/101 (81%)
 Strand = Plus / Minus

                                                                        
Query: 356  tccagctccttcatcttgtcttcaagctcgtccgcctcagcaagctggttcgtgtccagc 415
            |||| ||||||||||||||||||||  || || ||||| ||||| |||||  |||| |||
Sbjct: 1802 tccaactccttcatcttgtcttcaaattcatcagcctctgcaagttggttattgtctagc 1743

                                                     
Query: 416  cactggatggcagcatcgatggcctcctcgatcttcttctt 456
            |||| ||| ||  |||| || || ||||| ||| |||||||
Sbjct: 1742 cacttgatagcttcatcaattgcatcctcaatcctcttctt 1702

---

>emb|X06932.1|PHHSP70G Petunia hsp70 gene
          Length = 2958

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 82/101 (81%)
 Strand = Plus / Minus

                                                                        
Query: 356  tccagctccttcatcttgtcttcaagctcgtccgcctcagcaagctggttcgtgtccagc 415
            |||| ||||||||||||||||||||  || || ||||| ||||| |||||  |||| |||
Sbjct: 2678 tccaactccttcatcttgtcttcaaattcatcagcctctgcaagttggttattgtctagc 2619

                                                     
Query: 416  cactggatggcagcatcgatggcctcctcgatcttcttctt 456
            |||| ||| ||  |||| || || ||||| ||| |||||||
Sbjct: 2618 cacttgatagcttcatcaattgcatcctcaatcctcttctt 2578

---

>dbj|AK222068.1| Arabidopsis thaliana mRNA for dnaK-type molecular chaperone hsc70.1 -
            like, partial cds, clone: RAFL22-80-J10
          Length = 1371

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 355  ctccagctccttcatcttgtcttcaagctcgtc 387
            ||||| |||||||||||||||||||| ||||||
Sbjct: 1071 ctccaactccttcatcttgtcttcaaactcgtc 1039



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 229  ttagtcgacctcctcgatcttggggccag 257
            ||||||||| |||||||||||||| ||||
Sbjct: 1215 ttagtcgacttcctcgatcttgggaccag 1187

---

>emb|Z30176.1|TRMHSP70 T.repens (Huia) mRNA for heat shock protein 70
          Length = 554

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 229 ttagtcgacctcctcgatcttggggccag 257
           ||||||||||||||| |||||||||||||
Sbjct: 397 ttagtcgacctcctcaatcttggggccag 369

---

>gb|U26448.1|EGU26448 Echinococcus granulosus heat shock 70 kDa protein mRNA, complete cds
          Length = 2136

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 318  cctggtacatcttggcgatgatggggttgcaca 350
            ||||||||||||| ||||| |||||||||||||
Sbjct: 1843 cctggtacatcttcgcgattatggggttgcaca 1811

---

>gb|BT023894.1| Drosophila melanogaster LP19893 full insert cDNA
          Length = 2773

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 227  gtttagtcgacctcctcgatcttggggccagggccgccgg 266
            ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 2458 gtttagtcgacctcctcgatggtggggccagcaccgccgg 2419

---

>ref|XM_882866.1| PREDICTED: Bos taurus similar to Rab GTPase binding effector
           protein 1 (Rabaptin-5) (Rabaptin-5alpha), transcript
           variant 6 (LOC504785), mRNA
          Length = 3746

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 352 ggcctccagctccttcatcttgtcttca 379
           ||||||||||||||| ||||||||||||
Sbjct: 858 ggcctccagctccttaatcttgtcttca 831

---

>ref|XM_882853.1| PREDICTED: Bos taurus similar to Rab GTPase binding effector
           protein 1 (Rabaptin-5) (Rabaptin-5alpha), transcript
           variant 5 (LOC504785), mRNA
          Length = 3824

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 352 ggcctccagctccttcatcttgtcttca 379
           ||||||||||||||| ||||||||||||
Sbjct: 858 ggcctccagctccttaatcttgtcttca 831

---

>ref|XM_882846.1| PREDICTED: Bos taurus similar to Rab GTPase binding effector
           protein 1 (Rabaptin-5) (Rabaptin-5alpha), transcript
           variant 4 (LOC504785), mRNA
          Length = 1229

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 352 ggcctccagctccttcatcttgtcttca 379
           ||||||||||||||| ||||||||||||
Sbjct: 858 ggcctccagctccttaatcttgtcttca 831

---

>ref|XM_869715.1| PREDICTED: Bos taurus similar to Rab GTPase binding effector
           protein 1 (Rabaptin-5) (Rabaptin-5alpha), transcript
           variant 2 (LOC504785), mRNA
          Length = 3845

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 352 ggcctccagctccttcatcttgtcttca 379
           ||||||||||||||| ||||||||||||
Sbjct: 858 ggcctccagctccttaatcttgtcttca 831

---

>emb|AJ249330.1|CSA249330 Cucumis sativus mRNA for heat shock protein 70 isoform-1
          Length = 2370

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 90/112 (80%)
 Strand = Plus / Minus

                                                                        
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttcatc 370
            |||||||| || |||||||| || | |||||||||||| |    ||| ||||||||||| 
Sbjct: 2055 ccagcaccttgatacatcttagcaacgatggggttgcaaatactctcaagctccttcatt 1996

                                                                
Query: 371  ttgtcttcaagctcgtccgcctcagcaagctggttcgtgtccagccactgga 422
            || ||||| | ||| || || |||||||| |||||  |||| ||||||||||
Sbjct: 1995 ttatcttcgaactcatcagcttcagcaagttggttgttgtcaagccactgga 1944

---

>gb|AY913842.2| Leishmania donovani strain DD8 heat shock protein 70 (hsp70) mRNA,
           partial cds
          Length = 821

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 228 tttagtcgacctcctcgatcttggggcc 255
           |||||||||||||||||| |||||||||
Sbjct: 814 tttagtcgacctcctcgaccttggggcc 787



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 319 ctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
           ||||||||||||||  ||||| |||||||| | |  |||||||||||||
Sbjct: 693 ctggtacatcttggtcatgatcgggttgcatacgttctccagctccttc 645

---

>emb|CR723474.2|CNS0GL6G Tetraodon nigroviridis full-length cDNA
          Length = 1722

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 311  ccagcaccctggtacatcttggcgatgatggggttgcaca 350
            ||||||| |||||||||||| |  ||||||||||||||||
Sbjct: 1415 ccagcactctggtacatctttgtcatgatggggttgcaca 1376

---

>ref|XM_797036.1| PREDICTED: Strongylocentrotus purpuratus similar to heat shock
            protein 8, transcript variant 7 (LOC576276), mRNA
          Length = 2475

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 309  caccagcaccctggtacatcttggcgatgatggggttgca 348
            |||||||| | ||||||||||||| |||||||||| ||||
Sbjct: 1977 caccagcagcttggtacatcttggtgatgatgggggtgca 1938

---

>ref|XM_797035.1| PREDICTED: Strongylocentrotus purpuratus similar to heat shock
            protein 8, transcript variant 6 (LOC576276), mRNA
          Length = 2069

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 309  caccagcaccctggtacatcttggcgatgatggggttgca 348
            |||||||| | ||||||||||||| |||||||||| ||||
Sbjct: 1977 caccagcagcttggtacatcttggtgatgatgggggtgca 1938

---

>ref|XM_797034.1| PREDICTED: Strongylocentrotus purpuratus similar to heat shock
            protein 8, transcript variant 5 (LOC576276), mRNA
          Length = 2045

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 309  caccagcaccctggtacatcttggcgatgatggggttgca 348
            |||||||| | ||||||||||||| |||||||||| ||||
Sbjct: 1977 caccagcagcttggtacatcttggtgatgatgggggtgca 1938

---

>ref|XM_776060.1| PREDICTED: Strongylocentrotus purpuratus similar to heat shock
            protein 8, transcript variant 1 (LOC576276), mRNA
          Length = 2075

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 309  caccagcaccctggtacatcttggcgatgatggggttgca 348
            |||||||| | ||||||||||||| |||||||||| ||||
Sbjct: 1977 caccagcagcttggtacatcttggtgatgatgggggtgca 1938

---

>ref|XM_797027.1| PREDICTED: Strongylocentrotus purpuratus similar to heat shock
            protein 8, transcript variant 4 (LOC576276), mRNA
          Length = 1449

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 309  caccagcaccctggtacatcttggcgatgatggggttgca 348
            |||||||| | ||||||||||||| |||||||||| ||||
Sbjct: 1357 caccagcagcttggtacatcttggtgatgatgggggtgca 1318

---

>ref|XM_797023.1| PREDICTED: Strongylocentrotus purpuratus similar to heat shock
            protein 8, transcript variant 3 (LOC576276), mRNA
          Length = 1976

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 309  caccagcaccctggtacatcttggcgatgatggggttgca 348
            |||||||| | ||||||||||||| |||||||||| ||||
Sbjct: 1887 caccagcagcttggtacatcttggtgatgatgggggtgca 1848

---

>emb|Y08020.1|LIHSP706 L.infantum hsp70 gene, clone B2g6
          Length = 3758

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 228  tttagtcgacctcctcgatcttggggcc 255
            |||||||||||||||||| |||||||||
Sbjct: 2265 tttagtcgacctcctcgaccttggggcc 2238



 Score = 42.1 bits (21), Expect = 1.6
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                             
Query: 319  ctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            ||||||||||||||  ||||| |||||||| | |  |||||||||||||
Sbjct: 2144 ctggtacatcttggtcatgatcgggttgcatacgctctccagctccttc 2096

---

>emb|AJ004940.1|GGAJ4940 Gallus gallus mRNA for heat shock cognate 70
          Length = 2120

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 319  ctggtacatcttggcgatgatggggttgcaca 350
            |||||||| ||||| |||||||||||||||||
Sbjct: 1882 ctggtacagcttggtgatgatggggttgcaca 1851

---

>emb|Y08019.1|LIHSP701 L.infantum hsp70 gene, clone B2g1
          Length = 1119

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 228 tttagtcgacctcctcgatcttggggcc 255
           |||||||||||||||||| |||||||||
Sbjct: 64  tttagtcgacctcctcgaccttggggcc 37

---

>ref|NM_176503.1| Drosophila melanogaster Heat shock protein cognate 4 CG4264-RF,
            transcript variant F (Hsc70-4), mRNA
          Length = 2362

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 227  gtttagtcgacctcctcgatcttggggccagggccgccgg 266
            ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 2062 gtttagtcgacctcctcgatggtggggccagcaccgccgg 2023

---

>ref|NM_176502.1| Drosophila melanogaster Heat shock protein cognate 4 CG4264-RE,
            transcript variant E (Hsc70-4), mRNA
          Length = 2287

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 227  gtttagtcgacctcctcgatcttggggccagggccgccgg 266
            ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 1987 gtttagtcgacctcctcgatggtggggccagcaccgccgg 1948

---

>ref|NM_169627.1| Drosophila melanogaster Heat shock protein cognate 4 CG4264-RD,
            transcript variant D (Hsc70-4), mRNA
          Length = 2355

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 227  gtttagtcgacctcctcgatcttggggccagggccgccgg 266
            ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 2055 gtttagtcgacctcctcgatggtggggccagcaccgccgg 2016

---

>ref|NM_169626.1| Drosophila melanogaster Heat shock protein cognate 4 CG4264-RC,
            transcript variant C (Hsc70-4), mRNA
          Length = 2283

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 227  gtttagtcgacctcctcgatcttggggccagggccgccgg 266
            ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 1983 gtttagtcgacctcctcgatggtggggccagcaccgccgg 1944

---

>ref|NM_169625.1| Drosophila melanogaster Heat shock protein cognate 4 CG4264-RB,
            transcript variant B (Hsc70-4), mRNA
          Length = 2342

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 227  gtttagtcgacctcctcgatcttggggccagggccgccgg 266
            ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 2042 gtttagtcgacctcctcgatggtggggccagcaccgccgg 2003

---

>dbj|AB167744.1| Numida meleagris hspa8 mRNA for heat shock protein, complete cds
          Length = 2269

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 319  ctggtacatcttggcgatgatggggttgcaca 350
            |||||||| ||||| |||||||||||||||||
Sbjct: 1962 ctggtacagcttggtgatgatggggttgcaca 1931

---

>ref|NM_079632.4| Drosophila melanogaster Heat shock protein cognate 4 CG4264-RA,
            transcript variant A (Hsc70-4), mRNA
          Length = 2413

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 227  gtttagtcgacctcctcgatcttggggccagggccgccgg 266
            ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 2113 gtttagtcgacctcctcgatggtggggccagcaccgccgg 2074

---

>gb|AY084193.1| Drosophila melanogaster RH04426 full insert cDNA
          Length = 2425

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 227  gtttagtcgacctcctcgatcttggggccagggccgccgg 266
            ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 2112 gtttagtcgacctcctcgatggtggggccagcaccgccgg 2073

---

>ref|XM_694544.1| PREDICTED: Danio rerio similar to Splicing factor 3B subunit 2
           (Spliceosome associated protein 145) (SAP 145) (SF3b150)
           (Pre-mRNA splicing factor SF3b 145 kDa subunit)
           (LOC570994), partial mRNA
          Length = 858

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 429 catcgatggcctcctcgatcttcttctt 456
           |||| |||||||||||||||||||||||
Sbjct: 562 catccatggcctcctcgatcttcttctt 535

---

>ref|XM_691025.1| PREDICTED: Danio rerio similar to Splicing factor 3B subunit 2
           (Spliceosome associated protein 145) (SAP 145) (SF3b150)
           (Pre-mRNA splicing factor SF3b 145 kDa subunit)
           (LOC567725), mRNA
          Length = 462

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 429 catcgatggcctcctcgatcttcttctt 456
           |||| |||||||||||||||||||||||
Sbjct: 133 catccatggcctcctcgatcttcttctt 106

---

>gb|L19533.1|CRUU14HS Cricetulus griseus heat resistant protein gene
          Length = 4730

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 309  caccagcaccctggtacatcttggcgatgatggggttgca 348
            ||||||||| |||||||| |||||  ||||||||||||||
Sbjct: 4195 caccagcactctggtacagcttggtaatgatggggttgca 4156

---

>gb|AC009904.7| Drosophila melanogaster, chromosome 3R, region 88E-88E, BAC clone
              BACR32A03, complete sequence
          Length = 182601

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                      
Query: 227    gtttagtcgacctcctcgatcttggggccagggccgccgg 266
              ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 156340 gtttagtcgacctcctcgatggtggggccagcaccgccgg 156301

---

>emb|CR386963.1| Gallus gallus finished cDNA, clone ChEST104m7
          Length = 747

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 319 ctggtacatcttggcgatgatggggttgcaca 350
           |||||||| ||||| |||||||||||||||||
Sbjct: 351 ctggtacagcttggtgatgatggggttgcaca 320

---

>gb|AC007648.6|AC007648 Drosophila melanogaster, chromosome 3R, region 88E-88F, BAC clone
            BACR13A02, complete sequence
          Length = 166141

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 227  gtttagtcgacctcctcgatcttggggccagggccgccgg 266
            ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 5374 gtttagtcgacctcctcgatggtggggccagcaccgccgg 5335

---

>ref|NM_205003.1| Gallus gallus heat shock cognate 70 (HSC70), mRNA
          Length = 2120

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 319  ctggtacatcttggcgatgatggggttgcaca 350
            |||||||| ||||| |||||||||||||||||
Sbjct: 1882 ctggtacagcttggtgatgatggggttgcaca 1851

---

>gb|AE003708.3| Drosophila melanogaster chromosome 3R, section 46 of 118 of the
             complete sequence
          Length = 236375

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                     
Query: 227   gtttagtcgacctcctcgatcttggggccagggccgccgg 266
             ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 49806 gtttagtcgacctcctcgatggtggggccagcaccgccgg 49767

---

>gb|U64207.1|PCU64207 Penicillium citrinum heat shock protein 70 mRNA, partial cds
          Length = 1739

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 440  tcctcgatcttcttcttgtcgtcg 463
            ||||||||||||||||||||||||
Sbjct: 1315 tcctcgatcttcttcttgtcgtcg 1292

---

>gb|M34561.1|CRUHSP70A Chinese hamster heat shock protein (cognate form of hsp70) mRNA,
            complete cds
          Length = 2243

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 309  caccagcaccctggtacatcttggcgatgatggggttgca 348
            ||||||||| |||||||| |||||  ||||||||||||||
Sbjct: 1895 caccagcactctggtacagcttggtaatgatggggttgca 1856

---

>gb|M36114.1|DROHSC4A2 D.melanogaster heat shock cognate 4 (hsc4) gene, exon 2
          Length = 2082

 Score = 48.1 bits (24), Expect = 0.026
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 227  gtttagtcgacctcctcgatcttggggccagggccgccgg 266
            ||||||||||||||||||||  |||||||||  |||||||
Sbjct: 1983 gtttagtcgacctcctcgatggtggggccagcaccgccgg 1944

---

>gb|AY651253.1| Rhynchobodo ATCC50359 heat shock protein 70 cytosolic isoform gene,
            partial cds
          Length = 1828

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 314  gcaccctggtacatcttggcgat 336
            |||||||||||||||||||||||
Sbjct: 1791 gcaccctggtacatcttggcgat 1769

---

>gb|DQ025691.1| Oncorhynchus nerka clone One.hsc71.19.34 genomic sequence
          Length = 340

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 309 caccagcaccctggtacatcttggcgatgatgggg 343
           |||||||||||||||| | ||||| ||||||||||
Sbjct: 35  caccagcaccctggtatagcttggtgatgatgggg 1

---

>gb|DQ025620.1| Oncorhynchus keta clone Oke.hsc71.19.23 genomic sequence
          Length = 343

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 309 caccagcaccctggtacatcttggcgatgatgggg 343
           |||||||||||||||| | ||||| ||||||||||
Sbjct: 35  caccagcaccctggtatagcttggtgatgatgggg 1

---

>gb|DQ025546.1| Oncorhynchus tshawytscha clone Ots.hsc71.19.32 genomic sequence
          Length = 360

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 309 caccagcaccctggtacatcttggcgatgatgggg 343
           |||||||||||||||| | ||||| ||||||||||
Sbjct: 326 caccagcaccctggtatagcttggtgatgatgggg 360

---

>ref|XM_508938.1| PREDICTED: Pan troglodytes similar to heat shock protein 8; heat
           shock protein cognate 70; heat shock 70kD protein 8
           (LOC451761), mRNA
          Length = 816

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 314 gcaccctggtacatcttggcgatgatggggttgca 348
           |||| |||||||| ||||| |||||||||||||||
Sbjct: 716 gcactctggtacagcttggtgatgatggggttgca 682

---

>ref|XM_508830.1| PREDICTED: Pan troglodytes heat shock 70kDa protein 8 (LOC451629),
            mRNA
          Length = 3500

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 314  gcaccctggtacatcttggcgatgatggggttgca 348
            |||| |||||||| ||||| |||||||||||||||
Sbjct: 3146 gcactctggtacagcttggtgatgatggggttgca 3112

---

>gb|BC016660.1| Homo sapiens heat shock 70kDa protein 8, transcript variant 1, mRNA
            (cDNA clone MGC:9495 IMAGE:3923981), complete cds
          Length = 2259

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 314  gcaccctggtacatcttggcgatgatggggttgca 348
            |||| |||||||| ||||| |||||||||||||||
Sbjct: 1899 gcactctggtacagcttggtgatgatggggttgca 1865

---

>gb|BC016179.1| Homo sapiens heat shock 70kDa protein 8, transcript variant 1, mRNA
            (cDNA clone MGC:17984 IMAGE:3920744), complete cds
          Length = 2276

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 314  gcaccctggtacatcttggcgatgatggggttgca 348
            |||| |||||||| ||||| |||||||||||||||
Sbjct: 1899 gcactctggtacagcttggtgatgatggggttgca 1865

---

>gb|BC019816.2| Homo sapiens heat shock 70kDa protein 8, transcript variant 1, mRNA
            (cDNA clone MGC:29929 IMAGE:2899894), complete cds
          Length = 2250

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 314  gcaccctggtacatcttggcgatgatggggttgca 348
            |||| |||||||| ||||| |||||||||||||||
Sbjct: 1899 gcactctggtacagcttggtgatgatggggttgca 1865

---

>gb|BC007276.1| Homo sapiens heat shock 70kDa protein 8, mRNA (cDNA clone
            IMAGE:3162067), partial cds
          Length = 2031

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 314  gcaccctggtacatcttggcgatgatggggttgca 348
            |||| |||||||| ||||| |||||||||||||||
Sbjct: 1666 gcactctggtacagcttggtgatgatggggttgca 1632

---

>ref|NM_006597.3| Homo sapiens heat shock 70kDa protein 8 (HSPA8), transcript variant
            1, mRNA
          Length = 2276

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 314  gcaccctggtacatcttggcgatgatggggttgca 348
            |||| |||||||| ||||| |||||||||||||||
Sbjct: 1919 gcactctggtacagcttggtgatgatggggttgca 1885

---

>gb|DQ440299.1| Aedes aegypti clone AET-381 heat shock cognate 70 mRNA, complete cds
          Length = 1956

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                       
Query: 309  caccagcaccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            |||| |||| |||||||| ||||| ||||||||| ||||| | ||  ||||||||||||
Sbjct: 1846 caccggcactctggtacagcttggtgatgatgggattgcagacggattccagctccttc 1788

---

>gb|BC008907.2| Homo sapiens heat shock 70kDa protein 8, mRNA (cDNA clone
           IMAGE:3836086), partial cds
          Length = 919

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 314 gcaccctggtacatcttggcgatgatggggttgca 348
           |||| |||||||| ||||| |||||||||||||||
Sbjct: 561 gcactctggtacagcttggtgatgatggggttgca 527

---

>gb|BC002423.1| Homo sapiens ribosomal protein L8, mRNA (cDNA clone IMAGE:3163368),
           **** WARNING: chimeric clone ****
          Length = 1912

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 314 gcaccctggtacatcttggcgatgatggggttgca 348
           |||| |||||||| ||||| |||||||||||||||
Sbjct: 661 gcactctggtacagcttggtgatgatggggttgca 627

---

>ref|XM_812644.1| Trypanosoma cruzi strain CL Brener heat shock protein 70 (HSP70)
            (Tc00.1047053511211.160) partial mRNA
          Length = 1965

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                               
Query: 317  ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            |||||||||||||| |  ||||||||  ||||||||  |||||||||||||
Sbjct: 1850 ccctggtacatcttcgtcatgatgggcgtgcacaggttctccagctccttc 1800

---

>ref|XM_812645.1| Trypanosoma cruzi strain CL Brener heat shock protein 70 (HSP70)
            (Tc00.1047053511211.170) partial mRNA
          Length = 2034

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                               
Query: 317  ccctggtacatcttggcgatgatggggttgcacagggcctccagctccttc 367
            |||||||||||||| |  ||||||||  ||||||||  |||||||||||||
Sbjct: 1847 ccctggtacatcttcgtcatgatgggcgtgcacaggttctccagctccttc 1797

---

>gb|BC112920.1| Homo sapiens cDNA clone IMAGE:7484542, **** WARNING: chimeric clone
           ****
          Length = 1273

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 314 gcaccctggtacatcttggcgatgatggggttgca 348
           |||| |||||||| ||||| |||||||||||||||
Sbjct: 912 gcactctggtacagcttggtgatgatggggttgca 878

---

>emb|Y00371.1|HSHSC70 Human hsc70 gene for 71 kd heat shock cognate protein
          Length = 5408

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 314  gcaccctggtacatcttggcgatgatggggttgca 348
            |||| |||||||| ||||| |||||||||||||||
Sbjct: 4530 gcactctggtacagcttggtgatgatggggttgca 4496


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,948,775
Number of Sequences: 3902068
Number of extensions: 3948775
Number of successful extensions: 78394
Number of sequences better than 10.0: 490
Number of HSP's better than 10.0 without gapping: 496
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 76991
Number of HSP's gapped (non-prelim): 1365
length of query: 470
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 448
effective length of database: 17,147,199,772
effective search space: 7681945497856
effective search space used: 7681945497856
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---