>gb|AY549651.1| Desmognathus monticola isolate VAN46 12S ribosomal RNA gene,
           partial sequence; tRNA-Val gene, complete sequence; and
           16S ribosomal RNA gene, partial sequence; mitochondrial
          Length = 593

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 224 tttttggtgtagcaaaatgctttat 248
           ||||||||| |||||||||||||||
Sbjct: 495 tttttggtgaagcaaaatgctttat 471

>gb|AY549650.1| Desmognathus monticola isolate VAJ4 12S ribosomal RNA gene, partial
           sequence; tRNA-Val gene, complete sequence; and 16S
           ribosomal RNA gene, partial sequence; mitochondrial
          Length = 596

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 224 tttttggtgtagcaaaatgctttat 248
           ||||||||| |||||||||||||||
Sbjct: 493 tttttggtgaagcaaaatgctttat 469

>gb|AY549649.1| Desmognathus monticola isolate VAJ3 12S ribosomal RNA gene, partial
           sequence; tRNA-Val gene, complete sequence; and 16S
           ribosomal RNA gene, partial sequence; mitochondrial
          Length = 590

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 224 tttttggtgtagcaaaatgctttat 248
           ||||||||| |||||||||||||||
Sbjct: 496 tttttggtgaagcaaaatgctttat 472

>gb|AF437350.1| Desmognathus ochrophaeus isolate OJN003OC_1 12S ribosomal RNA gene,
           partial sequence; tRNA-Val gene, complete sequence; and
           16S ribosomal RNA gene, partial sequence; mitochondrial
           genes for mitochondrial products
          Length = 596

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 224 tttttggtgtagcaaaatgctttat 248
           ||||||||| |||||||||||||||
Sbjct: 494 tttttggtgaagcaaaatgctttat 470

>dbj|AP002439.3| Homo sapiens genomic DNA, chromosome 18 clone:RP11-691H4, complete
              sequence
          Length = 188604

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 341    gcctgggaaatgactccattc 361
              |||||||||||||||||||||
Sbjct: 178220 gcctgggaaatgactccattc 178240

>dbj|AP005131.2| Homo sapiens genomic DNA, chromosome 18, clone:RP11-53B2, complete
             sequence
          Length = 162119

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 341   gcctgggaaatgactccattc 361
             |||||||||||||||||||||
Sbjct: 50686 gcctgggaaatgactccattc 50706

>gb|AC154680.2| Mus musculus BAC clone RP24-313N16 from chromosome 13, complete sequence
          Length = 167328

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 226    tttggtgtagcaaaatgctt 245
              ||||||||||||||||||||
Sbjct: 137146 tttggtgtagcaaaatgctt 137127

>gb|AC005711.2| Drosophila melanogaster clone BACR48M09, complete sequence
          Length = 165267

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 285   atggtcttgccatgccatct 304
             ||||||||||||||||||||
Sbjct: 27849 atggtcttgccatgccatct 27868

>gb|AC091324.10| Mus musculus chromosome 7, clone RP23-7G1, complete sequence
          Length = 225556

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 225   ttttggtgtagcaaaatgctttat 248
             |||||| |||||||||||||||||
Sbjct: 91186 ttttggagtagcaaaatgctttat 91209

>gb|AC127387.3| Homo sapiens BAC clone RP11-28J3 from UL, complete sequence
          Length = 47702

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 349  aatgactccattcggttcca 368
            ||||||||||||||||||||
Sbjct: 6208 aatgactccattcggttcca 6227

>tpg|BK003390.1| TPA: TPA_inf: Drosophila melanogaster HDC02164 (HDC02164) gene,
            complete cds
          Length = 2089

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 285  atggtcttgccatgccatct 304
            ||||||||||||||||||||
Sbjct: 1824 atggtcttgccatgccatct 1843

>gb|AC150442.2| Medicago truncatula chromosome 7 BAC clone mth2-2o12, complete sequence
          Length = 89504

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 211   cgctattttcaaatttttgg 230
             ||||||||||||||||||||
Sbjct: 29379 cgctattttcaaatttttgg 29360

>gb|AC158529.2| Mus musculus BAC clone RP23-263H3 from chromosome 13, complete sequence
          Length = 172769

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 172    acagatggacagcagggctc 191
              ||||||||||||||||||||
Sbjct: 110186 acagatggacagcagggctc 110167

>gb|AE003635.2| Drosophila melanogaster chromosome 2L, section 44 of 83 of the complete
              sequence
          Length = 308012

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 285    atggtcttgccatgccatct 304
              ||||||||||||||||||||
Sbjct: 238627 atggtcttgccatgccatct 238646

>emb|CT030195.12| Mouse DNA sequence from clone RP23-191J8 on chromosome 13, complete
             sequence
          Length = 219800

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 172   acagatggacagcagggctc 191
             ||||||||||||||||||||
Sbjct: 61762 acagatggacagcagggctc 61743

>dbj|AP000795.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-876F8, complete
             sequence
          Length = 76999

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 370   caaatgcagagaaggccttc 389
             ||||||||||||||||||||
Sbjct: 31931 caaatgcagagaaggccttc 31912


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,561,025
Number of Sequences: 3902068
Number of extensions: 3561025
Number of successful extensions: 64409
Number of sequences better than 10.0: 16
Number of HSP's better than 10.0 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 64375
Number of HSP's gapped (non-prelim): 34
length of query: 403
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 381
effective length of database: 17,147,199,772
effective search space: 6533083113132
effective search space used: 6533083113132
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)