ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl01b11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK071334.1| Oryza sativa (japonica cultivar-group) cDNA clon... 202 8e-49
2dbj|AK060581.1| Oryza sativa (japonica cultivar-group) cDNA clon... 202 8e-49
3dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 170 3e-39
4dbj|AP005524.3| Oryza sativa (japonica cultivar-group) genomic D... 170 3e-39
5gb|AF272752.1|AF272752 Zea mays kinesin heavy chain (KIN4) mRNA,... 121 2e-24
6gb|BT018857.1| Zea mays clone EL01N0556F08.d mRNA sequence 107 3e-20
7gb|AF272755.1|AF272755 Zea mays kinesin heavy chain (KIN8) mRNA,... 107 3e-20
8gb|AC173289.2| Medicago truncatula chromosome 2 BAC clone mth2-3... 42 1.7
9ref|XM_383550.1| Gibberella zeae PH-1 chromosome 2 hypothetical ... 40 6.6
10emb|AL356865.19| Human DNA sequence from clone RP11-36N22 on chr... 40 6.6
11emb|CR387936.8| Zebrafish DNA sequence from clone CH211-85P6 in ... 40 6.6
12emb|Z19150.1|RNABSRECB R.norvegicus androgen receptor DNA-bindin... 40 6.6
13emb|BX511153.9| Zebrafish DNA sequence from clone DKEYP-66D1 in ... 40 6.6
14gb|AC036214.9| Homo sapiens chromosome 8, clone RP11-26J3, compl... 40 6.6
15gb|AC018952.9| Homo sapiens chromosome 8, clone RP11-498N9, comp... 40 6.6
16emb|AL844556.4| Mouse DNA sequence from clone RP23-21N12 on chro... 40 6.6

>dbj|AK071334.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023090L01, full
            insert sequence
          Length = 3709

 Score =  202 bits (102), Expect = 8e-49
 Identities = 186/214 (86%)
 Strand = Plus / Minus

                                                                        
Query: 262  ggcgagcgagggatgagcgacggcttgggttccttgctcgattcatagggatggttctca 321
            |||||||||||||||||||| ||| || | ||||||||||  || ||||| |||||||| 
Sbjct: 3398 ggcgagcgagggatgagcgatggcctgcggtccttgctcggctcgtaggggtggttctcg 3339

                                                                        
Query: 322  cggaactcatccatcagggactctattggcatcgctcgcaacgactcgatcgtgcctttg 381
            |||||||| |||||||||||||| || ||||||||||||| ||||||||||| | |||||
Sbjct: 3338 cggaactcgtccatcagggactccatcggcatcgctcgcagcgactcgatcgcgtctttg 3279

                                                                        
Query: 382  ctcgggacttccggctcacacctcaccggagtttcaccagtcggctcatagtccctgtag 441
            ||||| || ||||||||  |||||||||||||||| || |||||||| |||||| |||||
Sbjct: 3278 ctcggcacctccggctccgacctcaccggagtttcgccggtcggctcgtagtccttgtag 3219

                                              
Query: 442  ctgctttggaaagccttctcggcatgtgtgttga 475
            ||||| |||||||| || ||||| || |||||||
Sbjct: 3218 ctgctctggaaagcgttgtcggcgtgggtgttga 3185



to top

>dbj|AK060581.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-023-H01, full
            insert sequence
          Length = 1784

 Score =  202 bits (102), Expect = 8e-49
 Identities = 186/214 (86%)
 Strand = Plus / Minus

                                                                        
Query: 262  ggcgagcgagggatgagcgacggcttgggttccttgctcgattcatagggatggttctca 321
            |||||||||||||||||||| ||| || | ||||||||||  || ||||| |||||||| 
Sbjct: 1478 ggcgagcgagggatgagcgatggcctgcggtccttgctcggctcgtaggggtggttctcg 1419

                                                                        
Query: 322  cggaactcatccatcagggactctattggcatcgctcgcaacgactcgatcgtgcctttg 381
            |||||||| |||||||||||||| || ||||||||||||| ||||||||||| | |||||
Sbjct: 1418 cggaactcgtccatcagggactccatcggcatcgctcgcagcgactcgatcgcgtctttg 1359

                                                                        
Query: 382  ctcgggacttccggctcacacctcaccggagtttcaccagtcggctcatagtccctgtag 441
            ||||| || ||||||||  |||||||||||||||| || |||||||| |||||| |||||
Sbjct: 1358 ctcggcacctccggctccgacctcaccggagtttcgccggtcggctcgtagtccttgtag 1299

                                              
Query: 442  ctgctttggaaagccttctcggcatgtgtgttga 475
            ||||| |||||||| || ||||| || |||||||
Sbjct: 1298 ctgctctggaaagcgttgtcggcgtgggtgttga 1265



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score =  170 bits (86), Expect = 3e-39
 Identities = 152/174 (87%)
 Strand = Plus / Plus

                                                                            
Query: 262      ggcgagcgagggatgagcgacggcttgggttccttgctcgattcatagggatggttctca 321
                |||||||||||||||||||| ||| || | ||||||||||  || ||||| |||||||| 
Sbjct: 27935778 ggcgagcgagggatgagcgatggcctgcggtccttgctcggctcgtaggggtggttctcg 27935837

                                                                            
Query: 322      cggaactcatccatcagggactctattggcatcgctcgcaacgactcgatcgtgcctttg 381
                |||||||| |||||||||||||| || ||||||||||||| ||||||||||| | |||||
Sbjct: 27935838 cggaactcgtccatcagggactccatcggcatcgctcgcagcgactcgatcgcgtctttg 27935897

                                                                      
Query: 382      ctcgggacttccggctcacacctcaccggagtttcaccagtcggctcatagtcc 435
                ||||| || ||||||||  |||||||||||||||| || |||||||| ||||||
Sbjct: 27935898 ctcggcacctccggctccgacctcaccggagtttcgccggtcggctcgtagtcc 27935951



to top

>dbj|AP005524.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0562A06
          Length = 154198

 Score =  170 bits (86), Expect = 3e-39
 Identities = 152/174 (87%)
 Strand = Plus / Plus

                                                                         
Query: 262   ggcgagcgagggatgagcgacggcttgggttccttgctcgattcatagggatggttctca 321
             |||||||||||||||||||| ||| || | ||||||||||  || ||||| |||||||| 
Sbjct: 13270 ggcgagcgagggatgagcgatggcctgcggtccttgctcggctcgtaggggtggttctcg 13329

                                                                         
Query: 322   cggaactcatccatcagggactctattggcatcgctcgcaacgactcgatcgtgcctttg 381
             |||||||| |||||||||||||| || ||||||||||||| ||||||||||| | |||||
Sbjct: 13330 cggaactcgtccatcagggactccatcggcatcgctcgcagcgactcgatcgcgtctttg 13389

                                                                   
Query: 382   ctcgggacttccggctcacacctcaccggagtttcaccagtcggctcatagtcc 435
             ||||| || ||||||||  |||||||||||||||| || |||||||| ||||||
Sbjct: 13390 ctcggcacctccggctccgacctcaccggagtttcgccggtcggctcgtagtcc 13443



to top

>gb|AF272752.1|AF272752 Zea mays kinesin heavy chain (KIN4) mRNA, partial cds
          Length = 3385

 Score =  121 bits (61), Expect = 2e-24
 Identities = 130/153 (84%)
 Strand = Plus / Minus

                                                                        
Query: 302  attcatagggatggttctcacggaactcatccatcagggactctattggcatcgctcgca 361
            ||||||| |||||||||||||||||||| | ||||| || ||| || ||||| ||||| |
Sbjct: 3092 attcatacggatggttctcacggaactcgttcatcaaggtctccatgggcatggctcgaa 3033

                                                                        
Query: 362  acgactcgatcgtgcctttgctcgggacttccggctcacacctcaccggagtttcaccag 421
             ||||||||||| ||||||||| || || | ||||||| ||||||| ||||||||||| |
Sbjct: 3032 gcgactcgatcgagcctttgcttggcacgttcggctcaaacctcactggagtttcacccg 2973

                                             
Query: 422  tcggctcatagtccctgtagctgctttggaaag 454
            ||||||| || ||| |||| ||| |||||||||
Sbjct: 2972 tcggctcgtaatccttgtaactggtttggaaag 2940



to top

>gb|BT018857.1| Zea mays clone EL01N0556F08.d mRNA sequence
          Length = 2117

 Score =  107 bits (54), Expect = 3e-20
 Identities = 135/162 (83%)
 Strand = Plus / Minus

                                                                        
Query: 303  ttcatagggatggttctcacggaactcatccatcagggactctattggcatcgctcgcaa 362
            |||||| |||||||||||||||||||||| ||||| || ||| |  ||||| ||||||| 
Sbjct: 1902 ttcatacggatggttctcacggaactcattcatcatggtctccacgggcatggctcgcag 1843

                                                                        
Query: 363  cgactcgatcgtgcctttgctcgggacttccggctcacacctcaccggagtttcaccagt 422
            ||| || |||| ||||||||| || || | ||||||| ||||||||||||||||||| | 
Sbjct: 1842 cgattcaatcgagcctttgcttggcacgttcggctcagacctcaccggagtttcacctga 1783

                                                      
Query: 423  cggctcatagtccctgtagctgctttggaaagccttctcggc 464
             || || |||||| |||| ||| |||||| |||||| |||||
Sbjct: 1782 gggttcgtagtccttgtaactggtttggagagccttatcggc 1741



to top

>gb|AF272755.1|AF272755 Zea mays kinesin heavy chain (KIN8) mRNA, partial cds
          Length = 3514

 Score =  107 bits (54), Expect = 3e-20
 Identities = 135/162 (83%)
 Strand = Plus / Minus

                                                                        
Query: 303  ttcatagggatggttctcacggaactcatccatcagggactctattggcatcgctcgcaa 362
            |||||| |||||||||||||||||||||| ||||| || ||| |  ||||| ||||||| 
Sbjct: 3176 ttcatacggatggttctcacggaactcattcatcatggtctccacgggcatggctcgcag 3117

                                                                        
Query: 363  cgactcgatcgtgcctttgctcgggacttccggctcacacctcaccggagtttcaccagt 422
            ||| || |||| ||||||||| || || | ||||||| ||||||||||||||||||| | 
Sbjct: 3116 cgattcaatcgagcctttgcttggcacgttcggctcagacctcaccggagtttcacctga 3057

                                                      
Query: 423  cggctcatagtccctgtagctgctttggaaagccttctcggc 464
             || || |||||| |||| ||| |||||| |||||| |||||
Sbjct: 3056 gggttcgtagtccttgtaactggtttggagagccttgtcggc 3015



to top

>gb|AC173289.2| Medicago truncatula chromosome 2 BAC clone mth2-33e9, complete sequence
          Length = 127190

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 220    aaaagaagtatcatcattgtttctc 244
              ||||||||||| |||||||||||||
Sbjct: 116413 aaaagaagtattatcattgtttctc 116437



to top

>ref|XM_383550.1| Gibberella zeae PH-1 chromosome 2 hypothetical protein (FG03374.1)
            partial mRNA
          Length = 4185

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 353  tcgctcgcaacgactcgatc 372
            ||||||||||||||||||||
Sbjct: 3898 tcgctcgcaacgactcgatc 3879



to top

>emb|AL356865.19| Human DNA sequence from clone RP11-36N22 on chromosome 10 Contains a
              pseudogene similar to part of solute carrier family 25,
              (mitochondrial carrier), member 18 (SLC25A18), the GPR10
              gene for G protein-coupled receptor 10 (GR3, PrRPR), a
              translocase of outer mitochondrial membrane 22 homolog
              (yeast) (TOM22) (TOMM22) pseudogene and one CpG island,
              complete sequence
          Length = 156604

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 331    tccatcagggactctattgg 350
              ||||||||||||||||||||
Sbjct: 114185 tccatcagggactctattgg 114204



to top

>emb|CR387936.8| Zebrafish DNA sequence from clone CH211-85P6 in linkage group 8,
             complete sequence
          Length = 170195

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 205   ttacactgcacacagaaaag 224
             ||||||||||||||||||||
Sbjct: 96460 ttacactgcacacagaaaag 96441



to top

>emb|Z19150.1|RNABSRECB R.norvegicus androgen receptor DNA-binding domain DNA sequence
          Length = 1720

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 209 actgcacacagaaaagaagt 228
           ||||||||||||||||||||
Sbjct: 285 actgcacacagaaaagaagt 304



to top

>emb|BX511153.9| Zebrafish DNA sequence from clone DKEYP-66D1 in linkage group 2, complete
              sequence
          Length = 146969

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     aattttttacaagaatattc 77
              ||||||||||||||||||||
Sbjct: 120050 aattttttacaagaatattc 120069



to top

>gb|AC036214.9| Homo sapiens chromosome 8, clone RP11-26J3, complete sequence
          Length = 160545

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 98     atacattctagcaagaatgcaaaa 121
              ||||||||||| ||||||||||||
Sbjct: 102314 atacattctagtaagaatgcaaaa 102291



to top

>gb|AC018952.9| Homo sapiens chromosome 8, clone RP11-498N9, complete sequence
          Length = 180535

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 98    atacattctagcaagaatgcaaaa 121
             ||||||||||| ||||||||||||
Sbjct: 30566 atacattctagtaagaatgcaaaa 30589



to top

>emb|AL844556.4| Mouse DNA sequence from clone RP23-21N12 on chromosome 2, complete
             sequence
          Length = 178656

 Score = 40.1 bits (20), Expect = 6.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 216   acagaaaagaagtatcatca 235
             ||||||||||||||||||||
Sbjct: 22549 acagaaaagaagtatcatca 22530


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,086,113
Number of Sequences: 3902068
Number of extensions: 4086113
Number of successful extensions: 68323
Number of sequences better than 10.0: 16
Number of HSP's better than 10.0 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 68283
Number of HSP's gapped (non-prelim): 40
length of query: 485
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 463
effective length of database: 17,147,199,772
effective search space: 7939153494436
effective search space used: 7939153494436
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top