Clone Name | rbart61g08 |
---|---|
Clone Library Name | barley_pub |
No. | Definition | Score (bits) |
E Value |
1 | gb|AC108773.9| Mus musculus chromosome 5, clone RP23-118L1, comp... | 40 | 4.0 | 2 | emb|AL596132.7| Human DNA sequence from clone RP11-30A1 on chrom... | 40 | 4.0 | 3 | gb|AF074095.1|AF074095 Salvelinus namaycush clone A1 intergenic ... | 40 | 4.0 |
---|
>gb|AC108773.9| Mus musculus chromosome 5, clone RP23-118L1, complete sequence Length = 222706 Score = 40.1 bits (20), Expect = 4.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 136 cctcactatcttattcagtt 155 |||||||||||||||||||| Sbjct: 36122 cctcactatcttattcagtt 36103
>emb|AL596132.7| Human DNA sequence from clone RP11-30A1 on chromosome 9 Contains part of the NTRK2 gene for Neurotrophic tyrosine kinase, receptor, type 2 (TRKB), complete sequence Length = 124156 Score = 40.1 bits (20), Expect = 4.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 cacctaggccttggccccaa 245 |||||||||||||||||||| Sbjct: 23969 cacctaggccttggccccaa 23950
>gb|AF074095.1|AF074095 Salvelinus namaycush clone A1 intergenic spacer region, partial sequence Length = 3114 Score = 40.1 bits (20), Expect = 4.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 142 tatcttattcagttccggcc 161 |||||||||||||||||||| Sbjct: 1853 tatcttattcagttccggcc 1872 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,905,517 Number of Sequences: 3902068 Number of extensions: 1905517 Number of successful extensions: 39140 Number of sequences better than 10.0: 3 Number of HSP's better than 10.0 without gapping: 3 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 39137 Number of HSP's gapped (non-prelim): 3 length of query: 307 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 285 effective length of database: 17,147,199,772 effective search space: 4886951935020 effective search space used: 4886951935020 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)